ID: 1111657367

View in Genome Browser
Species Human (GRCh38)
Location 13:91170607-91170629
Sequence ATGTTTCAGCCTAGTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111657365_1111657367 -7 Left 1111657365 13:91170591-91170613 CCTATTGGCACACTAGATGTTTC No data
Right 1111657367 13:91170607-91170629 ATGTTTCAGCCTAGTAGAGGTGG No data
1111657364_1111657367 4 Left 1111657364 13:91170580-91170602 CCAAAACGCTGCCTATTGGCACA No data
Right 1111657367 13:91170607-91170629 ATGTTTCAGCCTAGTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111657367 Original CRISPR ATGTTTCAGCCTAGTAGAGG TGG Intergenic
No off target data available for this crispr