ID: 1111658559

View in Genome Browser
Species Human (GRCh38)
Location 13:91181007-91181029
Sequence GATACTACCACCTATGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111658555_1111658559 -5 Left 1111658555 13:91180989-91181011 CCCAGGCAATAGCAGGGAGATAC No data
Right 1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG No data
1111658556_1111658559 -6 Left 1111658556 13:91180990-91181012 CCAGGCAATAGCAGGGAGATACT No data
Right 1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111658559 Original CRISPR GATACTACCACCTATGGGTT TGG Intergenic
No off target data available for this crispr