ID: 1111663836

View in Genome Browser
Species Human (GRCh38)
Location 13:91243185-91243207
Sequence GATTTACGTGACTATAAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111663836_1111663841 5 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663841 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
1111663836_1111663842 9 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663842 13:91243217-91243239 TTGCATGCAAATTAAGGGGTAGG No data
1111663836_1111663843 25 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG No data
1111663836_1111663844 30 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663844 13:91243238-91243260 GGTTGATACAAATTGAGGAGTGG No data
1111663836_1111663839 4 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663839 13:91243212-91243234 TCCAATTGCATGCAAATTAAGGG No data
1111663836_1111663838 3 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663838 13:91243211-91243233 TTCCAATTGCATGCAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111663836 Original CRISPR GATTTACGTGACTATAAATG CGG (reversed) Intergenic
No off target data available for this crispr