ID: 1111663840

View in Genome Browser
Species Human (GRCh38)
Location 13:91243213-91243235
Sequence CCCCTTAATTTGCATGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111663840_1111663848 29 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663848 13:91243265-91243287 TTTAGAACTTTCTAGAAATGGGG No data
1111663840_1111663844 2 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663844 13:91243238-91243260 GGTTGATACAAATTGAGGAGTGG No data
1111663840_1111663847 28 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663847 13:91243264-91243286 ATTTAGAACTTTCTAGAAATGGG No data
1111663840_1111663845 3 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663845 13:91243239-91243261 GTTGATACAAATTGAGGAGTGGG No data
1111663840_1111663843 -3 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG No data
1111663840_1111663846 27 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663846 13:91243263-91243285 TATTTAGAACTTTCTAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111663840 Original CRISPR CCCCTTAATTTGCATGCAAT TGG (reversed) Intergenic
No off target data available for this crispr