ID: 1111663843

View in Genome Browser
Species Human (GRCh38)
Location 13:91243233-91243255
Sequence GGGTAGGTTGATACAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111663836_1111663843 25 Left 1111663836 13:91243185-91243207 CCGCATTTATAGTCACGTAAATC No data
Right 1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG No data
1111663837_1111663843 3 Left 1111663837 13:91243207-91243229 CCACTTCCAATTGCATGCAAATT No data
Right 1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG No data
1111663840_1111663843 -3 Left 1111663840 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG No data
Right 1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111663843 Original CRISPR GGGTAGGTTGATACAAATTG AGG Intergenic
No off target data available for this crispr