ID: 1111665884

View in Genome Browser
Species Human (GRCh38)
Location 13:91267338-91267360
Sequence CACTCACAGCAGTGCCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111665880_1111665884 12 Left 1111665880 13:91267303-91267325 CCCTGTGATCTGCTTTCCAGAAG No data
Right 1111665884 13:91267338-91267360 CACTCACAGCAGTGCCTCTCAGG No data
1111665881_1111665884 11 Left 1111665881 13:91267304-91267326 CCTGTGATCTGCTTTCCAGAAGT No data
Right 1111665884 13:91267338-91267360 CACTCACAGCAGTGCCTCTCAGG No data
1111665882_1111665884 -4 Left 1111665882 13:91267319-91267341 CCAGAAGTTCACAAACTGCCACT No data
Right 1111665884 13:91267338-91267360 CACTCACAGCAGTGCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111665884 Original CRISPR CACTCACAGCAGTGCCTCTC AGG Intergenic
No off target data available for this crispr