ID: 1111684752

View in Genome Browser
Species Human (GRCh38)
Location 13:91488215-91488237
Sequence ACTGATGTTCTGTATTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 598}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111684749_1111684752 0 Left 1111684749 13:91488192-91488214 CCTAGGGCTAAGTTTGATGTAAA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1111684752 13:91488215-91488237 ACTGATGTTCTGTATTTTAGGGG 0: 1
1: 0
2: 1
3: 43
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111684752 Original CRISPR ACTGATGTTCTGTATTTTAG GGG Intronic
900925329 1:5702485-5702507 AATCATGTTCTGTATTTTTGGGG + Intergenic
904666399 1:32125007-32125029 GCTAATTTTTTGTATTTTAGTGG + Intronic
906767430 1:48446546-48446568 ACTGAAGCTTTGTATATTAGAGG - Intronic
906876898 1:49549104-49549126 AATGATCTTTTGTATTTCAGTGG + Intronic
906985905 1:50682924-50682946 GCTAATTTTTTGTATTTTAGTGG - Intronic
907419799 1:54339564-54339586 AATGATGTTTTTTTTTTTAGTGG - Intronic
907908085 1:58803015-58803037 AGTGATGTAGTGTAGTTTAGTGG - Intergenic
908074820 1:60504537-60504559 CCTGATGTTTTCTTTTTTAGTGG + Intergenic
908093402 1:60710650-60710672 ATTGATCTTTTGTATTTTTGGGG - Intergenic
908298838 1:62741093-62741115 AATGATCTTTTGTATTTCAGCGG - Intergenic
909639528 1:77856685-77856707 AATGATCTTTTGTATTTCAGTGG + Intronic
909642198 1:77881735-77881757 GCTCATTTTTTGTATTTTAGTGG - Intergenic
909948089 1:81686445-81686467 AATGATCTTTTGTATTTTGGTGG + Intronic
910016149 1:82526840-82526862 AATGATCTTTTGTATTTCAGTGG + Intergenic
910077923 1:83302170-83302192 AATGATCTTTTGTATTTCAGTGG - Intergenic
910598165 1:89002162-89002184 AATGATCTTTTGTATTTCAGTGG + Intergenic
910738709 1:90491832-90491854 AATGATCTTTTGTATTTCAGTGG + Intergenic
910900938 1:92120063-92120085 GCTAATTTTTTGTATTTTAGTGG + Intronic
911935906 1:103971562-103971584 GCTAATTTTTTGTATTTTAGTGG + Intergenic
912978396 1:114349777-114349799 TCTGATAGTCTATATTTTAGAGG + Intergenic
913143402 1:115964764-115964786 AATGATCTTTTGTATTTCAGTGG - Intergenic
913151628 1:116049927-116049949 AATGATCTTTTGTATTTCAGTGG - Intronic
913312798 1:117519509-117519531 AATGATCTTTTGTATTTCAGTGG - Intronic
913429267 1:118772121-118772143 AATGATCTTTTGTATTTTTGTGG - Intergenic
915201163 1:154230169-154230191 GCTAATTTTTTGTATTTTAGTGG + Intronic
916272695 1:162960765-162960787 ACTTTTGTTATGTATTTAAGTGG + Intergenic
916360887 1:163967159-163967181 TGTGATGTTCTGAATATTAGAGG - Intergenic
917319271 1:173762053-173762075 AATGATCTTTTGTATTTCAGTGG - Intronic
917345792 1:174026980-174027002 GCTAATTTTTTGTATTTTAGCGG + Intergenic
917898198 1:179513873-179513895 AATGATCTTTTGTATTTCAGCGG + Intronic
918691396 1:187484603-187484625 AATGATGTTCTCTCTTTTATTGG - Intergenic
918754978 1:188328770-188328792 ATTGAAGTTCTGTACTTTAGGGG + Intergenic
919073157 1:192781531-192781553 AATGATCTTTTGTATTTCAGTGG + Intergenic
920008631 1:202851734-202851756 GCTAATTTTTTGTATTTTAGTGG - Intergenic
920075191 1:203330982-203331004 GCTAATTTTTTGTATTTTAGTGG + Intergenic
920330682 1:205205608-205205630 GCTAATTTTTTGTATTTTAGTGG + Intronic
920726692 1:208442537-208442559 AATGATCTTTTGTATTTCAGTGG + Intergenic
921037104 1:211391097-211391119 TTTTCTGTTCTGTATTTTAGTGG + Intergenic
921834784 1:219767059-219767081 AATGATCTTTTGTATTTCAGTGG - Intronic
922377344 1:224981596-224981618 AATGATCTTTTGTATTTCAGTGG + Intronic
922658149 1:227404058-227404080 AATGATCTTTTGTATTTAAGTGG - Intergenic
922927091 1:229358219-229358241 AATGATCTTTTGTATTTTGGTGG + Intergenic
922995676 1:229957454-229957476 AATGATCTTTTGTATTTCAGTGG + Intergenic
923648510 1:235848708-235848730 AATGATCTTTTGTATTTCAGTGG - Intronic
923661952 1:235965411-235965433 AATGATCTTTTGTATTTCAGTGG - Intergenic
923808387 1:237285835-237285857 AATGATCTTTTGTATTTCAGTGG + Intronic
923909880 1:238429535-238429557 AATGATCTTTTGTATTTCAGTGG + Intergenic
923917003 1:238518957-238518979 AATGATGCACTTTATTTTAGGGG + Intergenic
923975510 1:239257575-239257597 ACTGATGTTCACTATTGTACTGG + Intergenic
924435009 1:244031774-244031796 ACTACTGTTGTGTATTTTATAGG - Intergenic
1062864718 10:842360-842382 GCTAATTTTTTGTATTTTAGTGG + Intronic
1063014355 10:2060596-2060618 GCTAATGTTTTGTATTTTAGTGG - Intergenic
1063284817 10:4674981-4675003 ATTGATTTTCTAAATTTTAGCGG - Intergenic
1063795174 10:9506772-9506794 TAGGATGTTCTTTATTTTAGTGG + Intergenic
1065470683 10:26078310-26078332 AGTGATCTTTTGTATTTCAGTGG + Intronic
1065737483 10:28767329-28767351 ACTGATGTTTTGTAGTTGATTGG - Intergenic
1066706391 10:38183625-38183647 AGTGATGTTGAGCATTTTAGTGG + Intergenic
1069242435 10:66159987-66160009 AATGATCTTTTGTATTTCAGTGG + Intronic
1069269727 10:66511196-66511218 AATGATCCTCTGTATTTTTGTGG + Intronic
1069325654 10:67228655-67228677 AATGATCTTTTGTATTTCAGTGG - Intronic
1069498175 10:68925847-68925869 GCTAATTTTTTGTATTTTAGTGG - Intronic
1069859183 10:71459875-71459897 TCTGCTGTTCTTTATTCTAGAGG + Intronic
1070433793 10:76367910-76367932 AATGATCTTTTGTATTTCAGTGG + Intronic
1071484940 10:86093533-86093555 AATGATCTTTTGTATTTCAGTGG - Intronic
1071731236 10:88250543-88250565 ACTGATGGTCTGAATTGTTGAGG - Intergenic
1072164128 10:92795973-92795995 AATGATCTTTTGTATTTTAGTGG - Intergenic
1072788878 10:98303315-98303337 ACAGATGTTCAGTATCTGAGAGG + Intergenic
1073569280 10:104562833-104562855 ACTGAAGTTATGCATTTTTGGGG - Intergenic
1073637293 10:105212799-105212821 ACTGATGATAGGTATTTCAGTGG - Intronic
1074202964 10:111256194-111256216 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1074846287 10:117401469-117401491 GCTAATGTTTTGTATTTTTGTGG + Intergenic
1075694922 10:124426928-124426950 ACTGATTTTTTGTATTTTTAGGG - Intergenic
1076596761 10:131627652-131627674 ACTGATATGCTCTATTTTGGGGG + Intergenic
1077516589 11:3005774-3005796 GCTAATGTTTTGTATTTTAGTGG + Intronic
1077749098 11:4943866-4943888 AAAGATCATCTGTATTTTAGGGG - Intronic
1078592915 11:12660993-12661015 AATGATCTTTTGTATTTCAGTGG + Intergenic
1079273388 11:19010369-19010391 AATGATCTTTTGTATTTCAGTGG + Intergenic
1079791404 11:24744519-24744541 AGTGATCTTTTGTATTTCAGTGG + Intronic
1079951905 11:26816319-26816341 AATGATCTTTTGTATTTCAGTGG + Intergenic
1080282017 11:30568347-30568369 AATGAAGGTTTGTATTTTAGAGG - Intronic
1081195527 11:40155536-40155558 AATGATCTTTTGTATTTCAGTGG - Intronic
1081630708 11:44687797-44687819 ACTTAAGTTATGTATTTTGGGGG - Intergenic
1082215809 11:49567404-49567426 AAAGATGGTCAGTATTTTAGAGG + Intergenic
1083016938 11:59463904-59463926 AATGATCTTTTGTATTTCAGTGG - Intergenic
1083064304 11:59908132-59908154 AATGATCTTTTGTATTTCAGTGG + Intergenic
1083238965 11:61371721-61371743 CTTGATTTTATGTATTTTAGGGG + Intergenic
1083867807 11:65467049-65467071 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1085357031 11:75847804-75847826 GCTAATTTTTTGTATTTTAGTGG - Intronic
1087080320 11:94164182-94164204 ATTGATGTTTTGTATTTTTTTGG + Intronic
1087106111 11:94408980-94409002 AGTGATCTTTTGTATTTTGGTGG - Intergenic
1087583081 11:100083741-100083763 TCTGATCTTCTGTGTTTAAGTGG - Intronic
1088206708 11:107400396-107400418 AATGATCTTTTGTATTTCAGTGG - Intronic
1088239950 11:107763251-107763273 AATGATCTTTTGTATTTCAGTGG - Intergenic
1088431444 11:109763778-109763800 AGTGATGTTCTTTATTTTTATGG - Intergenic
1088580853 11:111314851-111314873 AATGATGTTTTGTATTTCTGTGG - Intergenic
1088987290 11:114920653-114920675 ACTGGTGTTGTGTGTTTGAGGGG - Intergenic
1089107655 11:116026973-116026995 AATGATCTTTTGTATTTTAGTGG - Intergenic
1089449924 11:118586685-118586707 TCTAATTTTTTGTATTTTAGTGG - Intronic
1089900417 11:121976941-121976963 AATGATCTTGTGTATTTCAGTGG - Intergenic
1090757575 11:129806645-129806667 AATGATCTTTTGTATTTCAGTGG - Intergenic
1091210195 11:133851183-133851205 AATGATCTTTTGTATTTCAGTGG + Intergenic
1092635899 12:10448371-10448393 ACTCCTGTTCTGTATTGAAGGGG + Intronic
1092653202 12:10656458-10656480 GCTAATTTTTTGTATTTTAGTGG - Intronic
1092837653 12:12506394-12506416 ACTGATGTTATGTCTTGTAATGG - Intronic
1093135237 12:15441684-15441706 AAGGATTTTCTGTATTTTGGTGG - Intronic
1093166170 12:15806517-15806539 ATTGATTTTCTGTATTTTTTTGG - Intronic
1093408942 12:18842049-18842071 AATGATCTTTTGTATTTCAGTGG + Intergenic
1093720849 12:22440290-22440312 AATGATCTTTTGTATTTCAGTGG - Intergenic
1094308627 12:29051909-29051931 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1094362671 12:29646987-29647009 GAAGCTGTTCTGTATTTTAGAGG - Intronic
1094762051 12:33545212-33545234 TCTGAGGGTCTGTATTCTAGGGG + Intergenic
1095282331 12:40369085-40369107 AAAGATTTTCTGTATTTTAAAGG + Exonic
1096604040 12:52752370-52752392 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1098966035 12:76789745-76789767 ACTCAAGTTATGTATTTTAAAGG - Intronic
1099460409 12:82914439-82914461 CCTGATGTACTATATTTGAGAGG + Intronic
1099751800 12:86783650-86783672 CCTGAAGTTTTGTATTTTGGAGG + Intronic
1099777155 12:87148436-87148458 AATGATCTTTTGTATTTGAGTGG + Intergenic
1100260960 12:92931763-92931785 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1100290715 12:93212048-93212070 AATGATCTTTTGTATTTCAGTGG + Intergenic
1100340335 12:93673361-93673383 ACTGAGGTTCTGAATTTTAAAGG + Intergenic
1100862277 12:98818608-98818630 ATTAATGTTCTGCTTTTTAGTGG - Intronic
1100920775 12:99483809-99483831 AATGATCTTTTGTATTTTTGTGG + Intronic
1101634994 12:106532582-106532604 AATAATCTTTTGTATTTTAGTGG + Intronic
1102909050 12:116698661-116698683 TGTGTTGTTCTTTATTTTAGAGG - Intergenic
1103126972 12:118432103-118432125 GCTGATTTTATGTATTTTAAAGG + Intergenic
1104466715 12:128996340-128996362 ACGTTTGTTCTGTTTTTTAGTGG + Intergenic
1104504224 12:129315950-129315972 AATGATTTTTTGTATTTCAGTGG + Intronic
1105063554 12:133176606-133176628 AATGATCTTTTGTATTTTTGTGG - Intronic
1107419056 13:40229297-40229319 AGTGATGTTTTGTAATTTATGGG - Intergenic
1107521195 13:41183451-41183473 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1107670393 13:42740556-42740578 ACTGTTGTTTTTTATTTTAAAGG + Intergenic
1107885232 13:44869466-44869488 GCTGATTTTTTGTATTTTTGTGG + Intergenic
1107961070 13:45559213-45559235 AATGATCTTCTGTATTTCTGTGG + Intronic
1109071636 13:57776513-57776535 ACTGCTTTTCTGTATTGTACAGG + Intergenic
1109494758 13:63154906-63154928 GTTTATGTTCTGTAGTTTAGAGG - Intergenic
1109781050 13:67110348-67110370 GCTAATTTTTTGTATTTTAGTGG - Intronic
1110870185 13:80442989-80443011 TCTGATCTTTTGTATTTTTGTGG + Intergenic
1110872440 13:80468183-80468205 ACTATTTTTCTGTATTTAAGGGG - Intergenic
1110928006 13:81180601-81180623 AATGATGTTCTGTGTGTTTGTGG - Intergenic
1111536400 13:89607470-89607492 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1111684752 13:91488215-91488237 ACTGATGTTCTGTATTTTAGGGG + Intronic
1111748041 13:92294509-92294531 AGTGATCTTCTGTATTTCTGTGG + Intronic
1111963499 13:94836668-94836690 AATGATCTTTTGTATTTCAGTGG - Intergenic
1111988694 13:95092873-95092895 AATGATCTTTTGTATTTCAGTGG - Intronic
1112250851 13:97778490-97778512 AATGATCTTCTGTATTTCTGTGG + Intergenic
1112309870 13:98308832-98308854 GCTGATTTTTTGTATTTTTGGGG + Intronic
1112738400 13:102446664-102446686 AATGATCTTTTGTATTTCAGTGG - Intergenic
1112945585 13:104922980-104923002 AATGATCTTTTGTATTTCAGTGG - Intergenic
1113296276 13:108962474-108962496 ACTGATATTCAATATTTTAAAGG + Exonic
1113487887 13:110668375-110668397 GCTGATTTTTTGTATTTTAGTGG - Intronic
1113809276 13:113128255-113128277 CTTGATTTTATGTATTTTAGGGG + Intronic
1114543342 14:23480270-23480292 GCTAATTTTTTGTATTTTAGTGG + Intronic
1114691903 14:24591034-24591056 AATGATCTTTTGTATTTCAGTGG + Intergenic
1115091803 14:29586035-29586057 CCTGATAGTCTGTATTTTAATGG + Intronic
1115296599 14:31834730-31834752 AATGATGTTCTGTATTTCACAGG - Intronic
1115401069 14:32961245-32961267 GCTAATTTTTTGTATTTTAGTGG - Intronic
1115674559 14:35656646-35656668 ACTGATATTCTTAATTTTAGTGG + Intronic
1115810791 14:37104901-37104923 ACAGATCTGCTGTATTTCAGAGG - Intronic
1115891051 14:38029465-38029487 AATGAGATTCTGTATTTAAGTGG + Intronic
1115997311 14:39207883-39207905 AATGCTCTTTTGTATTTTAGTGG - Intergenic
1116048777 14:39778278-39778300 AATGATCTTTTGTATTTCAGTGG + Intergenic
1116757808 14:48969678-48969700 ACTGCTGCCCTGTATTTTAAAGG + Intergenic
1117126279 14:52629722-52629744 GATGATGTTCTGTATTTTGGTGG + Intronic
1117509856 14:56439889-56439911 AATGATCTTTTGTATTTCAGTGG + Intergenic
1117925999 14:60779619-60779641 GCTAATTTTTTGTATTTTAGTGG - Intronic
1118162573 14:63305021-63305043 AATGATCTTTTGTATTTCAGTGG - Intergenic
1119841166 14:77794278-77794300 ACAGATGTTCTTTATCTTGGTGG - Intergenic
1120080390 14:80210071-80210093 ACTGTACATCTGTATTTTAGAGG - Intronic
1120783049 14:88503198-88503220 GCTAATTTTTTGTATTTTAGTGG + Intronic
1123183884 14:106495826-106495848 AATGATCTTTTGTATTTTTGTGG + Intergenic
1124148443 15:27154169-27154191 ACTAATGTTATTTATTATAGTGG + Intronic
1124381004 15:29165511-29165533 AATGATCTTTTGTATTTCAGTGG - Intronic
1124401264 15:29349731-29349753 GCTAATTTTTTGTATTTTAGTGG - Intronic
1125217572 15:37293885-37293907 ATTAATTTTCTGTAGTTTAGTGG + Intergenic
1125912615 15:43454893-43454915 GCTAATTTTTTGTATTTTAGTGG + Intronic
1126460505 15:48910370-48910392 AATGATCTTTTGTATTTCAGTGG + Intronic
1126488290 15:49207661-49207683 AATGATCTTTTGTATTTCAGTGG + Intronic
1126577810 15:50214142-50214164 AATGATCTTTTGTATTTCAGTGG - Intronic
1127050424 15:55077605-55077627 AATGATCTTTTGTATTTCAGTGG - Intergenic
1129097313 15:73222564-73222586 AATGATCTTTTGTATTTCAGTGG + Intronic
1129346132 15:74920811-74920833 GCTAATTTTTTGTATTTTAGTGG - Intronic
1129620964 15:77145282-77145304 GCTAATTTTTTGTATTTTAGTGG - Intronic
1130166352 15:81463392-81463414 AATGATCTTTTGTATTTTTGTGG + Intergenic
1131787290 15:95926635-95926657 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1133716503 16:8454598-8454620 AATGATCTTTTGTATTTCAGTGG - Intergenic
1134146760 16:11771221-11771243 GCCAATGTTTTGTATTTTAGTGG - Intronic
1135691802 16:24543750-24543772 AAGGATGTTTTGTTTTTTAGGGG - Intronic
1136932256 16:34429641-34429663 AATGATCTTTTGTATTTCAGTGG + Intergenic
1136972316 16:34982173-34982195 AATGATCTTTTGTATTTCAGTGG - Intergenic
1138770995 16:59663675-59663697 ACTGATGTCCTGTTTTTTTTTGG + Intergenic
1139419547 16:66842063-66842085 GCTAATTTTTTGTATTTTAGTGG + Intronic
1140064249 16:71596753-71596775 AATGATCTTTTGTATTTCAGTGG - Intergenic
1140305153 16:73796133-73796155 AGTTATGCTTTGTATTTTAGAGG - Intergenic
1142544172 17:687409-687431 GCTAATTTTCTGTATTTTAGTGG - Intronic
1143991112 17:10962771-10962793 AATGATCTTTTGTATTTCAGTGG - Intergenic
1144139393 17:12333633-12333655 AATGATCTTTTGTATTTCAGTGG + Intergenic
1144275246 17:13660884-13660906 AGAGATGTTCTGTATCTTAATGG - Intergenic
1144407913 17:14970398-14970420 AATGATCTTTTGTATTTCAGTGG + Intergenic
1144512527 17:15889496-15889518 ACTGATGTTCTGATTTTTGATGG - Intergenic
1144602910 17:16634525-16634547 ACTGAAGTACTTGATTTTAGGGG - Intronic
1144700712 17:17336982-17337004 ACTGATTTCCTTTTTTTTAGGGG + Intronic
1147116586 17:38305009-38305031 GCTAATTTTTTGTATTTTAGTGG + Intronic
1148024966 17:44580680-44580702 ACTTAAGTGCTGTAGTTTAGAGG - Intergenic
1148175270 17:45558460-45558482 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1148296101 17:46504534-46504556 CCTGAAGTTCTGTGCTTTAGAGG + Intergenic
1148413093 17:47484603-47484625 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1148498342 17:48069120-48069142 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1148595094 17:48847817-48847839 ACTTATTTTTTGTATTTTAATGG + Intronic
1148662314 17:49344683-49344705 GCTGATGTTTTGTATTTTAACGG + Intronic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1148990530 17:51662507-51662529 AAAGGTGTTCTGTATTTGAGGGG + Intronic
1149022422 17:51984692-51984714 AATGATCTTTTGTATTTCAGTGG - Intronic
1149116889 17:53108286-53108308 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1149184154 17:53977668-53977690 ATTGATGGTCTGTATTGCAGAGG + Intergenic
1149410630 17:56402498-56402520 AATGATCTTTTGTATTTCAGTGG + Intronic
1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG + Intronic
1150406487 17:64905404-64905426 GCTGAAGTTCTGTGCTTTAGAGG - Intronic
1150521413 17:65870627-65870649 ACTGATTTTCTGCATTTTTCAGG - Intronic
1150772151 17:68051308-68051330 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1150785356 17:68158415-68158437 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1150821105 17:68435040-68435062 GCTAATTTTTTGTATTTTAGTGG - Intronic
1150945214 17:69738323-69738345 AATGATCTTTTGTATTTCAGTGG + Intergenic
1150991339 17:70263477-70263499 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1151563224 17:74882098-74882120 GCTAATTTTTTGTATTTTAGTGG + Intronic
1151614833 17:75202976-75202998 AATAATTTTTTGTATTTTAGTGG + Intergenic
1152202436 17:78954918-78954940 ATTCATGTTCTGAATTTTGGGGG + Intergenic
1153479598 18:5533996-5534018 GCTAATTTTTTGTATTTTAGTGG - Intronic
1153591182 18:6675502-6675524 ACTGAGATTCTGTAATTTGGTGG - Intergenic
1153629499 18:7055913-7055935 GCTAATTTTTTGTATTTTAGTGG - Intronic
1153734701 18:8053478-8053500 CCTGATGTTCTATATGATAGAGG - Intronic
1155704333 18:28789574-28789596 ACTGAAATTCTGTCTGTTAGTGG + Intergenic
1157541120 18:48508320-48508342 AATGATCTTTTGTATTTCAGTGG - Intergenic
1158331389 18:56367133-56367155 AATGATGTTTAGTATTTCAGTGG + Intergenic
1158358548 18:56647127-56647149 ACTAATGTTCTGAATTTTGATGG - Intronic
1158941213 18:62407038-62407060 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1159006200 18:63015160-63015182 AATGATGTTTTGTATTTTCAGGG + Intergenic
1159834221 18:73317216-73317238 ACTGAACTTCAGTATTTTTGGGG + Intergenic
1160714386 19:569460-569482 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1161432787 19:4243447-4243469 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1161521633 19:4727417-4727439 CCTGATTTTATGTATTTTAATGG + Intergenic
1161882537 19:6966412-6966434 CCTGAAGTTCTGTGTGTTAGGGG + Intergenic
1164287947 19:23838757-23838779 AATGATTTTTTGTATTTCAGTGG + Intergenic
1165482973 19:36076391-36076413 GCTAATTTTTTGTATTTTAGTGG - Intronic
1166553104 19:43679893-43679915 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1167400867 19:49267937-49267959 TGTGTTTTTCTGTATTTTAGAGG + Intergenic
1167719755 19:51170609-51170631 GCTAATTTTTTGTATTTTAGTGG + Intergenic
925127142 2:1466691-1466713 AATGATCTTTTGTATTTCAGTGG + Intronic
926025542 2:9540447-9540469 ACTTATTTTCTGTAATTTACTGG - Intronic
926560455 2:14411351-14411373 AATGATCTTTTGTATTTCAGTGG - Intergenic
926676358 2:15625358-15625380 AATGATGTTCTGTATCCTAATGG + Intronic
926915727 2:17890233-17890255 AATGATCTTTTGTATTTCAGTGG + Intronic
927196858 2:20553899-20553921 ACTGATGTGCTGTGGTTTTGAGG + Intergenic
927335369 2:21916618-21916640 GCTAATTTTTTGTATTTTAGTGG - Intergenic
928814191 2:35270578-35270600 GCTAATTTTTTGTATTTTAGTGG + Intergenic
928856241 2:35805975-35805997 AATGATCTTTTGTATTTCAGTGG - Intergenic
929409097 2:41676935-41676957 ACTGAGGAACTGAATTTTAGGGG - Intergenic
931157473 2:59651924-59651946 ACTTATCTTCTATAATTTAGGGG + Intergenic
931524873 2:63141944-63141966 AATGATCTTTTGTATTTCAGTGG + Intronic
931548144 2:63411710-63411732 AATGATCTTTTGTATTTCAGTGG - Intronic
931834895 2:66088596-66088618 AATGATCTTTTGTATTTTTGTGG - Intergenic
931838552 2:66125860-66125882 ACTGATGTTTGGTATTTGGGAGG - Intergenic
931993156 2:67810880-67810902 AATGATCTTTTGTATTTCAGTGG - Intergenic
932100285 2:68893065-68893087 AATGATCTTTTGTATTTCAGTGG + Intergenic
932390574 2:71387269-71387291 ACTGATGTTTTGTATGTTTTGGG - Intronic
932421749 2:71605461-71605483 ACACATGTTCTGTATCCTAGGGG - Intronic
934767510 2:96888188-96888210 TCTGATGTTCTGTACTTTGGAGG + Intronic
935467377 2:103415160-103415182 AATGATCTTTTGTATTTCAGTGG - Intergenic
935982587 2:108642205-108642227 ATTGGAGTCCTGTATTTTAGAGG + Intronic
936164718 2:110110400-110110422 AATGATCTTTTGTATTTTGGTGG - Intronic
936580852 2:113699299-113699321 AGTTATGCTCTGTTTTTTAGGGG - Intergenic
937397778 2:121553534-121553556 GCTAATTTTTTGTATTTTAGTGG - Intronic
938597980 2:132808570-132808592 ATTGATCTTTTGTATTTCAGTGG + Intronic
938790867 2:134674522-134674544 GCTAATTTTTTGTATTTTAGTGG + Intronic
939604339 2:144235249-144235271 ACTGATTTTCTGTTTATTAATGG + Intronic
939716919 2:145595528-145595550 TTTAATGTTCTGTATTCTAGCGG - Intergenic
939749059 2:146018126-146018148 TCTGATGTTATGGCTTTTAGAGG + Intergenic
940157066 2:150668659-150668681 AATGATCTTTTGTATTTCAGTGG - Intergenic
940217889 2:151319309-151319331 AATGATCTTTTGTATTTCAGTGG - Intergenic
940304938 2:152215510-152215532 ACTGAGGTTCTATATTTTTTAGG + Intergenic
940709124 2:157141132-157141154 AATGATCTTTTGTATTTCAGTGG + Intergenic
941132931 2:161676561-161676583 AATGAAGTTCTTTATTCTAGAGG + Intronic
942188138 2:173444281-173444303 ACACAGGCTCTGTATTTTAGAGG - Intergenic
942197306 2:173534058-173534080 AATGATGATTTGTATTTTTGTGG + Intergenic
943169744 2:184383158-184383180 ACTACTGTTCTGTTTTTTGGGGG - Intergenic
943803529 2:192092442-192092464 AATGATGTTCCATATTTTACAGG + Intronic
944028483 2:195201899-195201921 TCTGATATTTTCTATTTTAGTGG - Intergenic
944683510 2:202097752-202097774 GCTAATTTTTTGTATTTTAGTGG + Intronic
945076972 2:206049431-206049453 ACTCATGTTCTGTTTTTCAGTGG - Intronic
945337823 2:208613843-208613865 AATGATCTTTTGTATTTCAGTGG + Intronic
945365061 2:208942426-208942448 ACTGATGTGCTGTAGTTGACCGG + Intergenic
945545356 2:211143663-211143685 AATGATCTTTTGTATTTTTGTGG + Intergenic
946344965 2:219101888-219101910 GCTAATTTTTTGTATTTTAGCGG + Intronic
947460804 2:230303239-230303261 AGTGATCTTCTGTATTTCTGTGG - Intronic
949008354 2:241663972-241663994 GCTAATTTTTTGTATTTTAGTGG + Intronic
1169401600 20:5285853-5285875 AATGATCTTTTGTATTTCAGTGG - Intergenic
1169559107 20:6780333-6780355 TCTGAAGTTATATATTTTAGAGG + Intergenic
1169799723 20:9502577-9502599 ACTGATTTTCTCTATGTTACTGG + Intergenic
1170720760 20:18876492-18876514 AATGATCTTTTGTATTTCAGTGG + Intergenic
1171165873 20:22970394-22970416 AATGATCTTTTGTATTTCAGTGG - Intergenic
1174001432 20:47377834-47377856 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1174785262 20:53426599-53426621 AATGATGATTTTTATTTTAGCGG + Intronic
1175555274 20:59848982-59849004 ACTGATCTTTTGTACTTTGGGGG - Intergenic
1176278019 20:64285558-64285580 ACTGATGCTCTGACTTTAAGTGG + Intronic
1177249499 21:18574027-18574049 AATGATCTTTTGTATTTTTGTGG + Intergenic
1177301505 21:19251369-19251391 AATGATGTTTTGTATTTCTGTGG - Intergenic
1178012133 21:28300889-28300911 TCCCATGTCCTGTATTTTAGTGG - Intergenic
1179346302 21:40560612-40560634 TATGATGTTCAGTATGTTAGAGG - Intronic
1180834745 22:18924335-18924357 GCTAATTTTTTGTATTTTAGTGG + Intronic
1181381066 22:22504657-22504679 TCTGATGTTTGCTATTTTAGTGG + Intronic
1181827016 22:25525165-25525187 TCTGATTATCTGTATTTTATAGG - Intergenic
1182483889 22:30627751-30627773 CCTCATTTTCAGTATTTTAGTGG - Intergenic
1182529298 22:30942838-30942860 GCTAATTTTTTGTATTTTAGTGG - Intronic
1184040030 22:41937458-41937480 GCTAATTTTCTGTATTTTAGTGG + Intergenic
1203284834 22_KI270734v1_random:149634-149656 GCTAATTTTTTGTATTTTAGTGG + Intergenic
949115430 3:315558-315580 ACTCATGATGTGTATGTTAGAGG + Intronic
949814521 3:8043876-8043898 AATGATCTTTTGTATTTCAGTGG - Intergenic
950592123 3:13944981-13945003 AATGATCTTTTGTATTTCAGTGG + Intronic
951075579 3:18387474-18387496 ATTGATGTTCTGTTATTTAGGGG - Intronic
951213009 3:19996267-19996289 AATGATCTTTTGTTTTTTAGTGG - Intronic
953539732 3:43806660-43806682 AATGATCTTTTGTATTTTAGTGG - Intergenic
953866750 3:46590230-46590252 AATGATCTTCTGTATTTCAGTGG - Intronic
953996858 3:47526510-47526532 ACTGATATTCTCTATTTGATGGG - Intergenic
954356485 3:50086263-50086285 ACTAATTTTTTGTATTTTTGGGG - Intronic
955175370 3:56608435-56608457 AATGATCTTTTGTATTTCAGTGG + Intronic
955511746 3:59687993-59688015 GCTAATTTTTTGTATTTTAGTGG + Intergenic
955859834 3:63316544-63316566 AATGATCTTTTGTATTTCAGTGG + Intronic
955909839 3:63848524-63848546 GCTGATTTTATGCATTTTAGGGG - Exonic
956864095 3:73352433-73352455 GCTAATTTTTTGTATTTTAGTGG + Intergenic
956979998 3:74625378-74625400 ACTCATGTTCTATATTCTGGAGG + Intergenic
957016023 3:75065970-75065992 AATGATCTTTTGTATTTCAGGGG + Intergenic
957162395 3:76626854-76626876 GCTAATTTTTTGTATTTTAGTGG + Intronic
957331304 3:78767734-78767756 AATGATCTTTTGTATTTCAGTGG + Intronic
957363911 3:79196948-79196970 TCTGGTGTTTTGTTTTTTAGTGG + Intronic
958775370 3:98476531-98476553 AATGATGTTTTGTATTTCTGTGG + Intergenic
958969652 3:100597797-100597819 AATGATCTTTTGTATTTCAGTGG + Intergenic
959131776 3:102364951-102364973 ATTGATCTTCTGTATTTTTTAGG - Intronic
959132029 3:102368044-102368066 AATGATCTTTTGTATTTCAGCGG + Intronic
959275052 3:104268126-104268148 AGTGATCTTTTGTATTTCAGTGG + Intergenic
959436445 3:106320527-106320549 AATGATCTTTTGTATTTCAGTGG - Intergenic
959756702 3:109908082-109908104 AATGATCTTTTGTATTTCAGTGG + Intergenic
959899331 3:111642326-111642348 AATGATCTTCTGTATTTCTGTGG - Intronic
959998348 3:112703067-112703089 AATGATCTTCTGTATTTCTGTGG - Intergenic
960086571 3:113597330-113597352 GCTAATATTTTGTATTTTAGTGG - Intronic
960512586 3:118568805-118568827 AATGATCTTTTGTATTTCAGTGG + Intergenic
961113478 3:124306040-124306062 ACTGATATTCTGTGTTTGATGGG - Intronic
961264458 3:125630246-125630268 AATGATCTTTTGTATTTCAGTGG + Intergenic
961407441 3:126691564-126691586 ACTGATCTTTTGTATTTCTGTGG - Intergenic
962503107 3:136015624-136015646 AATGATCTTTTGTATTTTTGTGG + Intronic
962504631 3:136033694-136033716 AATGATCTTCTGTATTTCTGTGG + Intronic
962734311 3:138310937-138310959 ATTGATCTTCTGTATTTTTTAGG - Intronic
963194358 3:142509949-142509971 ACTAATTTTTTGTATTTTAATGG - Intronic
963871742 3:150423202-150423224 ACTGATCTTTGTTATTTTAGGGG + Intronic
964976750 3:162630408-162630430 GCTAATTTTTTGTATTTTAGTGG + Intergenic
965216599 3:165871972-165871994 AATGATCTTTTGTATTTCAGTGG + Intergenic
965321658 3:167259281-167259303 AATGATCTTTTGTATTTCAGTGG + Intronic
966020574 3:175203775-175203797 AATGATCTTTTGTATTTCAGTGG - Intronic
966117416 3:176482297-176482319 AATGATCTTTTGTATTTCAGTGG + Intergenic
967257248 3:187606170-187606192 AATGATCTTTTGTATTTCAGTGG + Intergenic
967400038 3:189050267-189050289 AATGATCTTTTGTATTTCAGTGG - Intronic
967422465 3:189288995-189289017 ACCGATGTACTGTGTATTAGAGG + Intronic
967668436 3:192203182-192203204 AATGTTCTTCTGTAGTTTAGAGG + Intronic
968174483 3:196537438-196537460 ATTGATTTTCTTTTTTTTAGAGG - Intergenic
968381776 4:102608-102630 AGTGAGGTTCTGTAGTTGAGTGG - Intergenic
968724376 4:2236692-2236714 ACTTTTTTTTTGTATTTTAGTGG - Intronic
969452826 4:7284629-7284651 ACTCATGTTCTGAAGTCTAGAGG + Intronic
969947053 4:10794144-10794166 AATGATCTTTTGTATTTCAGTGG + Intergenic
970217198 4:13772014-13772036 AATAATGTTTTGTATTTCAGTGG + Intergenic
970581060 4:17474449-17474471 GCTAATTTTTTGTATTTTAGTGG - Intronic
970996384 4:22271985-22272007 AATGATCTTTTGTATTTCAGTGG - Intergenic
971583116 4:28368779-28368801 ACTGTTGTTCTGCATTTCATTGG + Intronic
972013667 4:34216557-34216579 AATGATCTTTTGTATTTCAGTGG + Intergenic
972566104 4:40270518-40270540 GCTAATTTTTTGTATTTTAGTGG - Intergenic
972884203 4:43465228-43465250 GCTAATTTTTTGTATTTTAGTGG + Intergenic
972962420 4:44470353-44470375 GCTAATTTTTTGTATTTTAGTGG + Intergenic
973031471 4:45346909-45346931 AATGTTGTTCTGTTTTTTTGAGG - Intergenic
973044193 4:45514453-45514475 AATGATCTTCTGTATTTATGTGG + Intergenic
973083639 4:46027297-46027319 AATGATCTTTTGTATTTCAGTGG - Intergenic
973782711 4:54303974-54303996 AATGATCTTTTGTATTTCAGTGG - Intergenic
973831245 4:54761664-54761686 AGTGATCTTTTGTATTTCAGTGG + Intergenic
974133202 4:57782005-57782027 AATGATCTTTTGTATTTTTGTGG + Intergenic
974517101 4:62931342-62931364 ACTGATATCTTGGATTTTAGAGG + Intergenic
974763704 4:66312048-66312070 GCTAATTTTTTGTATTTTAGTGG - Intergenic
975136440 4:70879110-70879132 GCTAATTTTTTGTATTTTAGTGG - Intergenic
975394990 4:73864254-73864276 ACTCAAGCTCTGTATTTTAGGGG - Intergenic
975517566 4:75263505-75263527 AATGATCTTTTGTATTTCAGTGG - Intergenic
975776047 4:77788561-77788583 GCTAATTTTTTGTATTTTAGTGG - Intronic
976686051 4:87816490-87816512 AATGATCTTTTGTATTTCAGTGG + Intergenic
976856743 4:89613110-89613132 AATGATCTTTTGTATTTCAGTGG - Intergenic
977019668 4:91743692-91743714 AATGATCTTTTGTATTTCAGTGG + Intergenic
977474195 4:97484393-97484415 AATGATCTTTTGTATTTCAGTGG - Intronic
977635784 4:99296641-99296663 AATGATCTTTTGTATTTTTGTGG - Intergenic
978158243 4:105514073-105514095 AATGATCTTTTGTATTTCAGTGG + Intergenic
978537826 4:109781343-109781365 AATGATCTTTTGTATTTCAGTGG - Intronic
978999169 4:115196547-115196569 AATGATCTTTTGTATTTCAGTGG + Intergenic
979020576 4:115492064-115492086 AATGATATTTTGTATTTTGGTGG - Intergenic
979435006 4:120677648-120677670 AATGATCTTTTGTATTTCAGTGG - Intergenic
979638624 4:122985592-122985614 AATGATCTTTTGTATTTCAGTGG + Intronic
980152934 4:129070568-129070590 AATGATCTTTTGTATTTCAGTGG + Intronic
980896405 4:138864863-138864885 TCTGATGTTCAGTCTTTAAGAGG - Intergenic
981400719 4:144310780-144310802 AATGATCTTTTGTATTTCAGTGG + Intergenic
981626258 4:146759160-146759182 AATGATCTTTTGTATTTCAGTGG - Intronic
981760530 4:148189848-148189870 AATGATCTTTTGTATTTCAGTGG + Intronic
982075560 4:151733300-151733322 AATGATCTTTTGTATTTCAGTGG - Intronic
982188066 4:152823226-152823248 AATGATGTTTTGTATTTGTGTGG - Intronic
982447047 4:155504266-155504288 GCTAATTTTCTGTATTTTTGTGG + Intergenic
982451333 4:155555615-155555637 AATGATGTTTTGTATTTCCGTGG - Intergenic
982925747 4:161335230-161335252 ATTGATGGTCTTTATTTTTGTGG - Intergenic
983175433 4:164582780-164582802 AATGATCTTTTGTATTTCAGTGG + Intergenic
983902906 4:173155606-173155628 GCTAATTTTTTGTATTTTAGTGG - Intergenic
984130968 4:175875746-175875768 AATGATCTTCTGTATTTTATAGG - Intronic
984474818 4:180222707-180222729 AATGATCTTTTGTATTTTTGTGG + Intergenic
984721994 4:182981595-182981617 AATGATCTTTTGTATTTCAGTGG - Intergenic
984796207 4:183662189-183662211 GCTAATTTTTTGTATTTTAGTGG - Intronic
984985545 4:185325568-185325590 ACTGATTTGCTGTATTATATTGG + Intronic
985093174 4:186384769-186384791 AATGATCTTTTGTATTTCAGTGG - Intergenic
985240491 4:187926253-187926275 AATGATCTTTTGTATTTCAGTGG + Intergenic
985420289 4:189778629-189778651 GCTGATTTTTTGTGTTTTAGTGG + Intergenic
986503083 5:8421006-8421028 GCTAATTTTTTGTATTTTAGTGG - Intergenic
986698982 5:10386478-10386500 AATTATATTCTGTATTTTAGAGG + Intronic
987414200 5:17646079-17646101 AATGATCTTTTGTATTTCAGTGG + Intergenic
987676429 5:21078925-21078947 ACTGCACTTCTGTATTCTAGAGG - Intergenic
988850333 5:35174252-35174274 GCTAATTTTTTGTATTTTAGTGG + Intronic
989028740 5:37094764-37094786 AATGATCTTTTGTATTTTTGTGG - Intergenic
989072908 5:37530613-37530635 AATGATCTTTTGTATTTTTGTGG + Intronic
989260554 5:39414997-39415019 ACTGATGCTATGTGTTTTGGAGG + Intronic
990372501 5:55134991-55135013 CCTGATGTTATGTATTCTATGGG - Intronic
990712563 5:58601654-58601676 ACTGATCTTTTGTATTTCAGTGG + Intronic
990846489 5:60146047-60146069 GCTAATTTTTTGTATTTTAGTGG - Intronic
991123837 5:63047249-63047271 ACTGATGTTATATATCTTATTGG + Intergenic
993614028 5:90088129-90088151 AATGATGTTTTGTATTTCTGTGG - Intergenic
993917331 5:93759079-93759101 AATGATCTTTTGTATTTCAGTGG - Intronic
993942246 5:94073519-94073541 ATTGATTTTCTGGATTTTAGAGG - Intronic
993965055 5:94350110-94350132 AATGATCTTTTGTATTTCAGTGG - Intronic
994107826 5:95966193-95966215 ACTTATGTTGTGTATTTTTATGG + Intergenic
994603128 5:101933321-101933343 ACTGTGGTTATGGATTTTAGAGG - Intergenic
994875582 5:105416744-105416766 AATGATCTGCTGTATTTCAGTGG - Intergenic
994964366 5:106648962-106648984 TCTGATATTCTGTATTTAATAGG - Intergenic
995120985 5:108534967-108534989 GCTAATTTTTTGTATTTTAGTGG + Intergenic
995198698 5:109401780-109401802 ATTGATTTTCTGTGTTATAGTGG - Intronic
995472737 5:112520427-112520449 AATGATCTTCTGTATTTCAGTGG + Intergenic
995932021 5:117456864-117456886 TCTTTTGTTCTGTAATTTAGGGG + Intergenic
996123775 5:119702177-119702199 AATGATCTTTTGTATTTCAGTGG + Intergenic
996288671 5:121826258-121826280 AATGATCTTTTGTATTTCAGTGG + Intergenic
996325595 5:122269215-122269237 TCTGCAGTTCTGTATTTAAGTGG - Intergenic
996325682 5:122270387-122270409 AATGATCTTTTGTATTTCAGTGG - Intergenic
996834770 5:127778627-127778649 CCTTATCTTCTGTATTTTGGAGG + Intergenic
997036264 5:130195651-130195673 ACAGAAGTTCTGCATTTTTGTGG + Intergenic
997105698 5:131016895-131016917 AATGATGTTTTGTATTTCTGTGG + Intergenic
997754329 5:136381885-136381907 TATGATGTTCTGTATGTTAGGGG - Intronic
997765302 5:136497186-136497208 AATGATGTTTTGTATTTCTGTGG + Intergenic
998244469 5:140486227-140486249 GCTAATTTTTTGTATTTTAGTGG + Intronic
998515678 5:142751708-142751730 ACTGATTTTCTGTTATTTATAGG + Intergenic
998941153 5:147283625-147283647 AATGATCTTTTGTATTTCAGTGG - Intronic
999575175 5:152968455-152968477 AATGATCTTTTGTATTTTTGTGG - Intergenic
1000203510 5:159035047-159035069 ACTGGTTTTCTCTATTTTTGTGG + Intronic
1000227939 5:159286921-159286943 ACTGATGTTCTGTAGTTTTTAGG - Intergenic
1000757558 5:165180625-165180647 AATGATCTTTTGTATTTCAGTGG + Intergenic
1000943204 5:167388319-167388341 ACTGATCTTTTGTATTTCTGTGG + Intronic
1001005925 5:168049965-168049987 GCTAATTTTTTGTATTTTAGTGG + Intronic
1001112304 5:168907023-168907045 GCTAATGTTTTGAATTTTAGTGG + Intronic
1002754874 6:148983-149005 ACTGATGCTCTGACTTTAAGTGG - Intergenic
1002856430 6:1041950-1041972 AATGATCTTTTGTATTTCAGTGG + Intergenic
1003355724 6:5368161-5368183 AATTAAGTTCTGTATTTTAGGGG + Intronic
1003451152 6:6233279-6233301 AATGATCTTTTGTATTTCAGTGG - Intronic
1003582292 6:7351130-7351152 AATGATCTTCTGTATTTCAGTGG - Intronic
1003930098 6:10916130-10916152 AATGATCTTTTGTATTTCAGTGG + Intronic
1004555589 6:16694416-16694438 GCTAATTTTTTGTATTTTAGTGG + Intronic
1004711690 6:18177275-18177297 AATGATCTTTTGTATTTCAGTGG + Intronic
1004717104 6:18228343-18228365 AATGATGAACTATATTTTAGAGG - Intronic
1005072771 6:21877520-21877542 AATGATCTTTTGTATTTCAGTGG - Intergenic
1005209204 6:23441218-23441240 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1005933929 6:30505299-30505321 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1006153404 6:32001324-32001346 GCAGATGTTCTGTGTTTTACGGG + Exonic
1006159712 6:32034061-32034083 GCAGATGTTCTGTGTTTTACGGG + Exonic
1006687335 6:35847076-35847098 AGTCTTGTTCTGGATTTTAGAGG - Intronic
1007907389 6:45475948-45475970 TCTGGTGTTCTGTTTTTTATAGG + Intronic
1008775138 6:55029180-55029202 AATGATCTTTTGTATTTCAGTGG + Intergenic
1008973305 6:57395471-57395493 AATGATCTTTTGTATTTCAGTGG + Intronic
1009162211 6:60297011-60297033 AATGATCTTTTGTATTTCAGTGG + Intergenic
1009424051 6:63494854-63494876 ACTGATATTATCTAATTTAGTGG - Intergenic
1009453494 6:63828388-63828410 AATGATCTTTTGTATTTCAGTGG - Intronic
1009495155 6:64337311-64337333 AATGATCTTTTGTATTTCAGTGG - Intronic
1009612314 6:65962234-65962256 AATGATGTTCTGGTTTTTACAGG + Intergenic
1009624578 6:66123267-66123289 AATGATCTTTTGTATTTTTGTGG + Intergenic
1009969292 6:70609515-70609537 AATGATCTTTTGTATTTCAGTGG - Intergenic
1011619872 6:89232835-89232857 AATGATGTTTTGTATTTCTGTGG + Intergenic
1011675643 6:89730921-89730943 ACTGATCCTCTGTCTTTTAGGGG - Exonic
1011833977 6:91407375-91407397 AATGATCTTTTGTATTTCAGTGG - Intergenic
1012417778 6:99028238-99028260 ACAGAAGTTCTTTATTTTGGGGG - Intergenic
1012738096 6:102976682-102976704 AATGATCTTTTGTATTTCAGTGG - Intergenic
1013718291 6:112990413-112990435 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1013852375 6:114531749-114531771 AATGATCTTTTGTATTTCAGTGG + Intergenic
1013900730 6:115153310-115153332 AATGATCTTTTGTATTTCAGTGG + Intergenic
1013940783 6:115659065-115659087 AATGATCTTTTGTATTTCAGTGG + Intergenic
1014261042 6:119217444-119217466 GCTAATTTTTTGTATTTTAGTGG + Intronic
1014285315 6:119490489-119490511 AATGATCTTTTGTATTTCAGTGG - Intergenic
1014307625 6:119761763-119761785 TCTAGTGTTCTGTATATTAGAGG + Intergenic
1014635937 6:123846523-123846545 GTTGATGTTTTGCATTTTAGAGG + Intronic
1015316153 6:131818766-131818788 ACTGAAGTACTGTTTTCTAGAGG + Intronic
1015565848 6:134570209-134570231 ACTGATCTTTTGCATTTCAGTGG - Intergenic
1015877701 6:137840170-137840192 AATGATCTTTTGTATTTCAGTGG + Intergenic
1016176144 6:141080041-141080063 ACTGATCTTTTGTATTTCTGTGG - Intergenic
1016197182 6:141358618-141358640 AATGATCTTTTGTATTTCAGTGG + Intergenic
1016895315 6:149045655-149045677 AGAGATGTTCTGTATATGAGAGG - Intronic
1017121255 6:151026092-151026114 ATTGAAGTCCTGTTTTTTAGTGG - Intronic
1017539932 6:155390721-155390743 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1017677043 6:156825027-156825049 GCTAATTTTTTGTATTTTAGTGG + Intronic
1018897094 6:168027286-168027308 GCTAATTTTTTGTATTTTAGTGG - Intronic
1020446251 7:8271469-8271491 ACTTATGTTCTGTTTTTTTTTGG + Intergenic
1020861063 7:13492434-13492456 AATGATCTTTTGTATTTCAGTGG - Intergenic
1021204570 7:17764721-17764743 AATGATCTTTTGTATTTCAGTGG - Intergenic
1022192521 7:28030628-28030650 ACTCATGTACTTTTTTTTAGTGG - Intronic
1024122434 7:46258118-46258140 ATTAATGTTATGAATTTTAGAGG - Intergenic
1024545777 7:50516760-50516782 AATGATCTTTTGTATTTCAGTGG - Intronic
1024740468 7:52348535-52348557 ACTCCTGTTCTTTATTTTAGGGG - Intergenic
1025801049 7:64786316-64786338 AATAATCTTCTGTATTTTTGCGG - Intergenic
1025833554 7:65075425-65075447 GCTGATTTTTTGTATTTTTGTGG - Intergenic
1026055647 7:66981405-66981427 GCTGATTTTTTGTGTTTTAGTGG + Intergenic
1026232918 7:68500991-68501013 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1026722047 7:72840403-72840425 GCTGATTTTTTGTGTTTTAGTGG - Intergenic
1027295698 7:76767366-76767388 AATGATCTTTTGTATTTCAGTGG - Intergenic
1027350135 7:77303294-77303316 AATGATCTTTTGTATTTCAGTGG + Intronic
1027709970 7:81587932-81587954 TTTGATGTGCTGTATGTTAGAGG - Intergenic
1028961952 7:96758958-96758980 AATGATCTTTTGTATTTCAGTGG + Intergenic
1029033333 7:97491477-97491499 ACTGATTATCTGGAATTTAGAGG - Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1029933748 7:104400529-104400551 ACTGAGGTTCTTTAATTTATTGG + Intronic
1031486926 7:122338230-122338252 GCTAATGTTTTGTACTTTAGTGG - Intronic
1031879493 7:127180182-127180204 AATGATCTTTTGTATTTCAGTGG - Intronic
1032920235 7:136537205-136537227 ACTGATAGTCTGTATTTCTGTGG - Intergenic
1033259934 7:139834651-139834673 AATGATCTTTTGTATTTTAGTGG - Intronic
1033528288 7:142238839-142238861 ACTGAGGTTATGCATTTTTGAGG + Intergenic
1034159896 7:148985749-148985771 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1035550249 8:517678-517700 CCTGATTTTCTACATTTTAGGGG - Intronic
1035747059 8:1969876-1969898 GCTAATGTTTTGTATTTTTGTGG + Intergenic
1036089009 8:5644830-5644852 ACAGATGTTTTGTCTTTTCGTGG - Intergenic
1037155856 8:15697089-15697111 AATGATCTTTTGTATTTCAGTGG + Intronic
1037560374 8:20068312-20068334 AATGATCTTTTGTATTTCAGTGG + Intergenic
1037713336 8:21373666-21373688 AATGATATTTTGTATTTCAGTGG + Intergenic
1037944676 8:22981425-22981447 ACTGCTCTTCTGTACTTCAGTGG + Intronic
1038531735 8:28323681-28323703 GATGATGTTCTGTATTTAAATGG - Intronic
1039638917 8:39197150-39197172 AATGATTTTTTGTATTTTTGTGG + Intronic
1040664497 8:49617153-49617175 TATGATATTATGTATTTTAGTGG + Intergenic
1040714496 8:50232736-50232758 AATGTTGATCTGTATTTTTGTGG - Intronic
1041293392 8:56330011-56330033 ACTGATCTTTTGTATTTCAGTGG + Intergenic
1041637392 8:60159411-60159433 AATGATCTTTTGTATTTTAGTGG - Intergenic
1042995774 8:74696650-74696672 AATGATGTTTTGTATTTTTGTGG - Intronic
1043071390 8:75640403-75640425 ACTGATCTTTTGTATTTCTGTGG + Intergenic
1044035712 8:87301030-87301052 AGTGATCTTCTGTATTTCAGTGG - Intronic
1044483331 8:92719154-92719176 ACTGAAGTTCTTTAGTGTAGTGG + Intergenic
1045780099 8:105852729-105852751 AATGATCTTTTGTATTTCAGTGG - Intergenic
1045881196 8:107042697-107042719 AATGATCTTTTGTATTTCAGTGG + Intergenic
1045982623 8:108209204-108209226 TCTGATGTTCTGTCTTTTGAGGG - Intronic
1046033659 8:108814623-108814645 AATGATCTTTTGTATTTTTGTGG + Intergenic
1046199084 8:110898597-110898619 ACTGATGTTCTGTTTATTTCTGG + Intergenic
1046225602 8:111275088-111275110 AATGATCTTTTGTGTTTTAGTGG - Intergenic
1047091468 8:121580068-121580090 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1047576445 8:126160967-126160989 GCTAATTTTCTGTATTTTAGTGG - Intergenic
1047901567 8:129428155-129428177 AATGATCTTTTGTATTTTTGTGG + Intergenic
1048120171 8:131571431-131571453 AATGATCTTTTGTATTTTTGTGG + Intergenic
1049295705 8:141835177-141835199 AATGATCTTTTGTATTTCAGTGG + Intergenic
1049579222 8:143403636-143403658 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1050179782 9:2908828-2908850 ACTCAAGTTCTGGATTTTATTGG + Intergenic
1050754604 9:8986373-8986395 ACTCTTGATTTGTATTTTAGTGG - Intronic
1051429538 9:16967785-16967807 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1051563248 9:18466845-18466867 AGTGATCTGTTGTATTTTAGGGG + Intergenic
1052065616 9:24015900-24015922 GCTAATTTTGTGTATTTTAGTGG - Intergenic
1052441472 9:28501652-28501674 ACCTATGTTCTGTTTTTAAGAGG + Intronic
1052683896 9:31730248-31730270 ACTGATCTTTTGTGTTTTTGTGG + Intergenic
1052817936 9:33116087-33116109 CCTTATGTTCAGTATTTTGGAGG - Exonic
1054799671 9:69334922-69334944 GCTAATTTTTTGTATTTTAGTGG + Intronic
1055346724 9:75347166-75347188 AATGATCTTTTGTATTTCAGTGG + Intergenic
1055799312 9:80015599-80015621 ACAGATGTTTTGTATTTTGAGGG + Intergenic
1056322458 9:85449194-85449216 AGTGATCTTTTGTATTTCAGTGG + Intergenic
1056547204 9:87622744-87622766 GCTGATTTTTTGTATTTTAGTGG - Intronic
1056968811 9:91186025-91186047 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1057004095 9:91540879-91540901 AGTGATCTTTTGTATTTCAGTGG - Intergenic
1057119189 9:92555699-92555721 AATGATCTTTTGTATTTCAGTGG + Intronic
1057771618 9:97973105-97973127 TCTCATGTTCTTTATTTTAATGG - Intergenic
1058084769 9:100736878-100736900 AATGATCTTTTGTATTTCAGTGG + Intergenic
1058156458 9:101521521-101521543 AATGATCTTTTGTATTTCAGTGG + Intronic
1058410737 9:104728282-104728304 AATGATCTTTTGTATTTCAGTGG - Intergenic
1059738184 9:117123111-117123133 CCTGATGATCTGTGTTTTAACGG - Intronic
1061136469 9:128736977-128736999 ACTAATTTTTTGTACTTTAGTGG - Intronic
1061931878 9:133837372-133837394 ACTGTTGTGCCTTATTTTAGTGG - Intronic
1062603895 9:137334164-137334186 GCTAATTTTTTGTATTTTAGTGG + Intronic
1186215695 X:7298183-7298205 AGTGATGTGCTGTCTTTTGGGGG - Intronic
1187335791 X:18380348-18380370 ACTGATCTTCAGTATTGTGGTGG + Intergenic
1187451926 X:19405349-19405371 ACTGATGTTATGTATTTGGCAGG - Intronic
1187681658 X:21773489-21773511 ATTGATCTTTTGTATTTCAGTGG - Intergenic
1187748976 X:22440751-22440773 AATGATCTTTTGTATTTCAGTGG - Intergenic
1188077833 X:25800845-25800867 TGTCATGTTCTGTATCTTAGGGG + Intergenic
1188271191 X:28142939-28142961 ACTGATTTTCTGTGATTTTGAGG - Intergenic
1188514423 X:30969666-30969688 ACTGGGATTCTGTATGTTAGTGG - Intronic
1188586206 X:31778733-31778755 ACTAATTTTTTGTACTTTAGTGG + Intronic
1189074122 X:37897931-37897953 GTTGATTTTTTGTATTTTAGTGG - Intronic
1189218447 X:39347946-39347968 AATGATGTTTTGTATTTCAGTGG - Intergenic
1189413995 X:40798262-40798284 GCTAATTTTTTGTATTTTAGTGG - Intergenic
1189932028 X:46022718-46022740 AATGATGTTTTGTATTTTAGTGG - Intergenic
1190234727 X:48606564-48606586 AGTGATGTTAAGTATTTGAGGGG + Exonic
1190369710 X:49728911-49728933 ATTGATGTTCTGTATTTGATAGG + Intergenic
1190449204 X:50561056-50561078 AATGATCTTTTGTATTTCAGTGG - Intergenic
1190895192 X:54611158-54611180 AATGATCTTTTGTATTTCAGTGG + Intergenic
1190897007 X:54630065-54630087 AATGATCTTTTGTATTTTTGTGG + Intergenic
1191067438 X:56365242-56365264 AATGATGTTCTATATTTCAGTGG + Intergenic
1191151555 X:57224951-57224973 AATGATCTTTTGTATTTCAGTGG + Intergenic
1191828469 X:65391161-65391183 ACAGATGTTCTGTAACTTGGAGG - Intronic
1191888642 X:65917362-65917384 AATGATGTTTTGTATTTCTGTGG + Intergenic
1191994344 X:67075132-67075154 AATGATCTTTTGTATTTCAGTGG - Intergenic
1192064391 X:67865301-67865323 ACTGGTTTTATGTCTTTTAGAGG + Intergenic
1192609287 X:72551887-72551909 ACAAATGTTCTGTATTTTCTTGG + Intronic
1192944083 X:75946152-75946174 AATGATCTTTTGTATTTCAGTGG + Intergenic
1192978529 X:76313804-76313826 AATGATCTTCCGTATTTCAGTGG + Intergenic
1193077279 X:77367878-77367900 AATGATCTTTTGTATTTCAGTGG - Intergenic
1193154983 X:78162515-78162537 AATGATCTTTTGTATTTTGGTGG - Intergenic
1193157168 X:78186492-78186514 AATGATCTTTTGTATTTCAGTGG - Intergenic
1193253129 X:79316581-79316603 AATGATCTTTTGTATTTCAGTGG + Intergenic
1193307740 X:79969653-79969675 AATAATCTTTTGTATTTTAGTGG + Intergenic
1193421088 X:81283000-81283022 AATGATCTTATGTATTTCAGTGG - Intronic
1194926400 X:99830217-99830239 AATGATCTTTTGTATTTCAGTGG + Intergenic
1195151478 X:102074615-102074637 ATTGATGTTCTGTTTTTGGGTGG - Intergenic
1195393849 X:104390179-104390201 GCTAATTTTTTGTATTTTAGTGG + Intergenic
1195465430 X:105173895-105173917 GCTAATTTTTTGTATTTTAGTGG + Intronic
1195818292 X:108912846-108912868 AATGATCTTTTGTATTTTTGTGG - Intergenic
1196161586 X:112490349-112490371 AATGATCTTTTGTATTTCAGTGG - Intergenic
1196219166 X:113091236-113091258 AATGATCTTTTGTATTTCAGTGG - Intergenic
1196224909 X:113155033-113155055 AATGATCTTTTGTATTTCAGTGG + Intergenic
1196531006 X:116786200-116786222 AATGATCTTTTGTATTTCAGTGG - Intergenic
1196737827 X:118995671-118995693 ACTAATCTTTTGTATTTCAGTGG - Intronic
1197065965 X:122234489-122234511 AATGATCTTTTGTATTTCAGTGG + Intergenic
1197115216 X:122824064-122824086 ACTGTTCTACTGTATTTTAGCGG - Intergenic
1197132724 X:123023319-123023341 AATGATCTTTTGTATTTCAGTGG - Intergenic
1197459906 X:126727982-126728004 AATGATCTTTTGTATTTTTGTGG - Intergenic
1197519196 X:127476053-127476075 AATGATCTTGTGTATTTCAGTGG - Intergenic
1197589166 X:128387122-128387144 AATGATCTTTTGTATTTCAGTGG - Intergenic
1197953965 X:131926752-131926774 AATGATCTTTTGTATTTCAGTGG - Intergenic
1198200825 X:134416866-134416888 AATGATGTTGTATATCTTAGTGG - Intronic
1199062943 X:143380370-143380392 AGTGATTTTCTGTCTTATAGTGG + Intergenic
1199521222 X:148738428-148738450 AATGATCTTCTGTATTTCAGTGG + Intronic
1199821448 X:151452756-151452778 AATGATCTTTTGTATTTCAGTGG + Intergenic
1199926597 X:152473201-152473223 AATGATCTTTTGTATTTCAGTGG - Intergenic
1201490258 Y:14533490-14533512 AGTGATGTTATCTATTTTAAAGG - Intronic
1202043891 Y:20717264-20717286 AATGATCTTTTGTATTTCAGTGG - Intergenic