ID: 1111685177

View in Genome Browser
Species Human (GRCh38)
Location 13:91492943-91492965
Sequence CAGTAGCAAGAGAAGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111685177 Original CRISPR CAGTAGCAAGAGAAGCACTG GGG (reversed) Intronic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
901771721 1:11533961-11533983 CAAGAGCAGGGGAAGCACTGAGG + Intronic
901971425 1:12912037-12912059 CCGGATCAAGAGAAGCCCTGCGG - Intronic
902013743 1:13289703-13289725 CCGGATCAAGAGAAGCCCTGCGG + Intergenic
904048582 1:27624129-27624151 CAATGGGAAGAGAAGCACTGAGG - Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
905350531 1:37343262-37343284 AAGTAGCAAGGACAGCACTGGGG + Intergenic
906151816 1:43591954-43591976 CAGCGGGCAGAGAAGCACTGAGG + Intronic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
907278970 1:53332563-53332585 CAGTACCATGTGAAGGACTGGGG - Intergenic
907448022 1:54521808-54521830 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
907936743 1:59048510-59048532 CAGGAGCAAGAGAGGGAGTGGGG - Intergenic
908961684 1:69705570-69705592 CATTAGAAAGAGAAGCATTTTGG + Intronic
909292441 1:73900919-73900941 CAGTAGTATGCTAAGCACTGAGG + Intergenic
909678406 1:78263724-78263746 CAGCAGCAATAGCAGCACAGTGG - Intergenic
909724739 1:78820848-78820870 CTGGAGCAAGAGAAACACTAAGG - Intergenic
909990421 1:82216741-82216763 CATAACCAAGAGAAGCTCTGTGG + Intergenic
910084442 1:83382654-83382676 CAGTACCAAGAGAAACATTCAGG - Intergenic
911506912 1:98764146-98764168 CAGAAGAAAGAAAAGTACTGGGG + Intergenic
913224840 1:116689793-116689815 CAGTGGTAAGACAAGCTCTGGGG + Intergenic
915073216 1:153289098-153289120 CAGGAGCTAGGGACGCACTGGGG + Intergenic
917704300 1:177616111-177616133 CAGCAGTAAGAGGGGCACTGTGG - Intergenic
918680772 1:187350343-187350365 TAGTAGCAAAAGTAGCAATGAGG + Intergenic
919438330 1:197592229-197592251 CACTAGCTAGAGAAACAGTGAGG + Intronic
919877708 1:201882652-201882674 CTGTAGGAAGAAAAGCAATGAGG + Exonic
920882520 1:209893810-209893832 GAGCAGCAAGAGAACCAGTGTGG - Intergenic
922396154 1:225202851-225202873 AAGCAGCAGGAAAAGCACTGTGG - Intronic
924104130 1:240633757-240633779 AAGAAGGAAGAGAAGCACCGGGG + Intergenic
924616184 1:245613763-245613785 GAGTAGGAAGAGAGGCACCGAGG - Intronic
1063149314 10:3322208-3322230 CAGAGGCAGGAGCAGCACTGGGG + Intergenic
1064490828 10:15854684-15854706 AAGAACTAAGAGAAGCACTGAGG + Intronic
1065398045 10:25262679-25262701 TTGTAGCAAGTGAACCACTGTGG - Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065932046 10:30488664-30488686 CACCAGGAAGAGAAGCTCTGGGG - Intergenic
1066463583 10:35633753-35633775 CAGAGACAAGAGGAGCACTGTGG - Intergenic
1067283012 10:44887157-44887179 CAGGAGCAAGATCAGCACTGGGG + Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1068434451 10:56972964-56972986 TTGTAACAAGAGCAGCACTGAGG + Intergenic
1070945280 10:80385790-80385812 CAGTAACAAGCCAGGCACTGTGG - Intergenic
1071603282 10:86969286-86969308 CAGTCTCAAGGGAAGAACTGTGG - Intronic
1072919200 10:99561346-99561368 CAGCAGGAAGAGAAGCAGTGGGG - Intergenic
1074107514 10:110399588-110399610 CAGTCCCAAGAGCAGAACTGGGG + Intergenic
1074421608 10:113314156-113314178 CAGCAGCCAGGGAAGAACTGAGG + Intergenic
1075112652 10:119599893-119599915 CAGCACCAAGAGAAGCCCAGTGG + Intergenic
1075157215 10:119988368-119988390 CAGTAGGAATAGAAGGAATGGGG + Intergenic
1075744933 10:124720365-124720387 CGGAAGCAAGAGAATCACTTAGG + Intronic
1075909466 10:126111780-126111802 CATAATAAAGAGAAGCACTGGGG + Intronic
1077815936 11:5685350-5685372 CAGGAGCAAGAGGAGCACATTGG - Intronic
1078179060 11:8995151-8995173 AACTAGCAAGAGAACCACTGTGG - Intronic
1078346737 11:10556458-10556480 CATTTGCAAGAGAAGCACTGTGG + Intergenic
1078348645 11:10574031-10574053 CAGTAGCTAGAAAATGACTGAGG - Exonic
1078653862 11:13220367-13220389 CAGCACCAGGACAAGCACTGGGG - Intergenic
1079435075 11:20439113-20439135 CAGTAGCCACACAGGCACTGGGG + Intronic
1079613703 11:22464757-22464779 CAGTAGGTAGAGAAGAAGTGAGG + Intergenic
1081551116 11:44113521-44113543 AAACTGCAAGAGAAGCACTGAGG + Intronic
1081691614 11:45082057-45082079 CAGTGTCTTGAGAAGCACTGGGG + Intergenic
1083448842 11:62728790-62728812 AAGGAGCAAGTGAAGCTCTGGGG - Exonic
1084654856 11:70509218-70509240 CAGCAGACAGAGATGCACTGTGG - Intronic
1087629254 11:100631401-100631423 GAGTAGAGAGAGGAGCACTGGGG - Intergenic
1090024598 11:123156972-123156994 CATTAGGAACAGAAACACTGAGG + Intronic
1090795141 11:130128955-130128977 CACTGACAGGAGAAGCACTGGGG + Intronic
1092211098 12:6646996-6647018 CAGAGGCAGGAGCAGCACTGCGG + Exonic
1094325395 12:29232424-29232446 TAGCAGGAAGAGAAGCAATGGGG - Intronic
1098500515 12:71187023-71187045 AAGCAGCAGGAGAAGCCCTGTGG + Intronic
1099467879 12:83009345-83009367 CAGGAGAAAGAGAAACCCTGAGG - Intronic
1099854782 12:88150231-88150253 CAGGAGCAAGAGGAGTACGGTGG + Intronic
1099904913 12:88760711-88760733 CAGTAGCATGCTAAGCACTGGGG + Intergenic
1100064302 12:90622686-90622708 CAGTAGCATGAGAAACAGTCGGG + Intergenic
1100599973 12:96104665-96104687 CTGTAGAATGAGAAGTACTGGGG + Intergenic
1100646469 12:96537296-96537318 TAGTAACTAGAGAAGCAATGGGG - Intronic
1100796700 12:98189496-98189518 CAGTAGCCAGAGAACACCTGAGG + Intergenic
1100873424 12:98937426-98937448 AAGTAGAAGGAGAAGCAATGGGG - Intronic
1103198664 12:119068662-119068684 CAGGAGCAATAGAAGCTCTGTGG - Intronic
1103285329 12:119796299-119796321 CAGAGGCAAGGGAATCACTGAGG + Intronic
1103635733 12:122303684-122303706 CAGAAGCAGTAGGAGCACTGTGG - Intronic
1106601473 13:31191116-31191138 CAGTAGCAAGCCCAGCAATGGGG - Intergenic
1106707809 13:32300446-32300468 CAGCTGCATTAGAAGCACTGGGG + Intergenic
1108700956 13:52943796-52943818 CAGTAGCAAGTTCAGCACTGTGG + Intergenic
1110812905 13:79830145-79830167 AAGTAGGAAGAGAAGAAATGTGG + Intergenic
1111685177 13:91492943-91492965 CAGTAGCAAGAGAAGCACTGGGG - Intronic
1111749204 13:92306382-92306404 TAGTAAAAAGAGGAGCACTGGGG + Intronic
1113861146 13:113488290-113488312 AAGGAGCAAGAGAAGCTTTGGGG + Intronic
1115351149 14:32397147-32397169 CAGTAGCAACAGCACCATTGTGG - Intronic
1115457361 14:33618913-33618935 ATGTAGAAAGAGAAGCAGTGAGG + Intronic
1117278516 14:54214069-54214091 CAGTAGCAAGAGAATGCCTTAGG - Intergenic
1117823037 14:59671345-59671367 CAGTTGCAAAAGAAGTAATGAGG - Intronic
1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG + Intergenic
1119992714 14:79217305-79217327 CAGGAGCAAGAGGAGTAGTGGGG + Intronic
1121782303 14:96629744-96629766 CAGGGGCAAGAGGAGCTCTGGGG + Intergenic
1123779869 15:23615579-23615601 CAGAGGTAAGAGAAGCACCGAGG - Intronic
1124065604 15:26340918-26340940 CCGTGGCAGGAGAAGCACAGTGG + Intergenic
1124069185 15:26375700-26375722 GAGTTGCAAGGGAAGCTCTGTGG + Intergenic
1124824738 15:33082584-33082606 CAGAGACTAGAGAAGCACTGGGG - Intronic
1124964420 15:34422802-34422824 CAGGAGCAGGAAGAGCACTGTGG - Intronic
1124981039 15:34569028-34569050 CAGGAGCAGGAAGAGCACTGTGG - Intronic
1125087999 15:35753758-35753780 CAGTACCATGAGAAGCAGAGAGG - Intergenic
1126179792 15:45773958-45773980 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1126182135 15:45795732-45795754 CAGAAGCAAGAGATGAAATGAGG + Intergenic
1127635987 15:60870220-60870242 AAGTAGCATGCTAAGCACTGTGG + Intronic
1128000073 15:64182943-64182965 AAGAAGCAAATGAAGCACTGAGG - Intronic
1132065219 15:98725481-98725503 CAGGAGTTGGAGAAGCACTGTGG - Intronic
1133598190 16:7313043-7313065 CAGAAGGAAGAGCAGCAGTGGGG - Intronic
1133646908 16:7773266-7773288 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG + Exonic
1134477101 16:14583866-14583888 GAGTAGAAACAGCAGCACTGAGG - Intronic
1134911647 16:18032429-18032451 CAGTGGCAAGAGAAAAAATGAGG + Intergenic
1135572884 16:23562836-23562858 CAGAAGCAAGCAAAGCACAGTGG - Intronic
1135869104 16:26132669-26132691 CAGTGCAAAGAGAAGCATTGAGG + Intronic
1136026394 16:27471667-27471689 GAGGAGCAAAGGAAGCACTGTGG - Intronic
1136630028 16:31484681-31484703 CAGAACCAACAGAGGCACTGTGG + Exonic
1139249707 16:65482998-65483020 CAGCAGGACGAGCAGCACTGTGG + Intergenic
1141565424 16:84898453-84898475 CAGCAGCTACAAAAGCACTGAGG - Intronic
1142023217 16:87797169-87797191 CAGCAGCATCAGGAGCACTGTGG + Intergenic
1144499763 17:15775760-15775782 CAGGAGCAAGAGATGCACAGGGG - Intergenic
1147238549 17:39075438-39075460 CAGCACCAAGAGAGGCAGTGGGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148480277 17:47955535-47955557 AAGTAGCAAGAGAAGCTGAGGGG + Intronic
1149110655 17:53025416-53025438 CAGAAGAAAGAGAAGAAATGGGG - Intergenic
1149484113 17:57028610-57028632 CAGGAGCAAGAGAGAGACTGAGG - Intergenic
1150180692 17:63117472-63117494 TTGTATCCAGAGAAGCACTGTGG - Intronic
1151765303 17:76130663-76130685 CAGGAGCAAGAGGAGCAGAGAGG - Intergenic
1152601399 17:81264045-81264067 CAGTGGCAGGACAAGCACGGGGG - Intronic
1156674011 18:39505812-39505834 CATTACCAAGAGTACCACTGTGG - Intergenic
1158707723 18:59808395-59808417 CAGAAGCAAGAGCATCACTTGGG + Intergenic
1158843474 18:61414308-61414330 CAGAAACAAGAGAAGCACAAGGG + Intronic
1159192694 18:65068097-65068119 GAATAGCCAGAGATGCACTGAGG + Intergenic
1160586531 18:79916326-79916348 CAAGAGCTACAGAAGCACTGTGG - Intronic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1161056428 19:2192932-2192954 CAGTGGGAAGAGAAGCACACAGG - Intronic
1161797256 19:6394172-6394194 AAGGAGCAGGAGAAGCACAGCGG + Intergenic
1162306766 19:9879465-9879487 CAGGAGCAAGAGAGAGACTGGGG - Intronic
1163859680 19:19735439-19735461 CAGAGGCAGGAGAATCACTGGGG + Intergenic
1164487866 19:28676591-28676613 CAGTATCAAGAGAACTCCTGAGG + Intergenic
1164596149 19:29531598-29531620 CAATAGCCTGAGACGCACTGAGG - Intronic
1165231443 19:34389692-34389714 CATGACCCAGAGAAGCACTGAGG - Intronic
925042026 2:739892-739914 CAGCCGCAAGCCAAGCACTGCGG + Intergenic
926222688 2:10946585-10946607 CATTTGCAAGAAAAGCAGTGAGG - Intergenic
926560837 2:14415670-14415692 CAGGAGCAAGAGAAAGAGTGGGG - Intergenic
926748824 2:16181992-16182014 CAGCAGCAAGTGACACACTGGGG + Intergenic
927284768 2:21345210-21345232 CTGGAGAAAGAGAAGCAGTGTGG - Intergenic
929095946 2:38263425-38263447 CAGAAGCAAGAGAAGGACGTGGG + Intergenic
932818334 2:74879147-74879169 CAGCAGCCAGAGGAGCTCTGCGG - Intronic
936612254 2:114012664-114012686 CAGAAGCAAGAGAACCAGTAGGG + Intergenic
937572396 2:123380498-123380520 AAGCAGCAAGAAAAGCCCTGTGG + Intergenic
940691822 2:156927878-156927900 CAGAAGCAAGAGAAAGAGTGGGG + Intergenic
941291042 2:163675426-163675448 CAGCAGCAACAGCATCACTGGGG + Intronic
941477981 2:165971711-165971733 CAGTAGCCAAGGAAGCCCTGAGG + Intergenic
942982911 2:182103921-182103943 CAGTAACAGGAGAATCACTGAGG + Intronic
943871829 2:193009285-193009307 CAGCAGCAAGAGAAAAATTGAGG + Intergenic
944407312 2:199399713-199399735 CAGGAGCAAGAGAAGCGGAGAGG + Intronic
944602030 2:201313040-201313062 AAGTAGCAGGAAAAGCCCTGTGG + Intronic
944950636 2:204744928-204744950 CAGATGCAACAGAAGGACTGAGG + Intronic
945137541 2:206644394-206644416 CATTTCCAGGAGAAGCACTGAGG - Intergenic
945570556 2:211462255-211462277 CACTATCATGAGCAGCACTGAGG + Intronic
945668355 2:212770439-212770461 CAGAAGCAAGAGAGGCAGGGTGG - Intergenic
945862333 2:215138352-215138374 CAGCAGAAACAGAAGAACTGTGG - Exonic
947009125 2:225546653-225546675 GAGTACCAAGTGAACCACTGGGG - Intronic
947592141 2:231391900-231391922 CACTACCCAGACAAGCACTGGGG - Intergenic
947811955 2:233010427-233010449 CAGGAGGAGGAGAAGAACTGGGG - Intronic
948742008 2:240054337-240054359 CAGGAGCAAGAGAGGCAGTGAGG - Intergenic
1169952369 20:11059364-11059386 CAGTAGCAAGAAGAGAACAGTGG + Intergenic
1170063599 20:12286601-12286623 TGGTAGCAAGAGAAGCCCTCAGG + Intergenic
1171007927 20:21485971-21485993 CAGTGGCCAGATAAGCACTGTGG + Intergenic
1171146983 20:22793335-22793357 CAGGAGCAAGAGAGCCAGTGGGG - Intergenic
1171751442 20:29053715-29053737 CTGTAGAAAGAAAAACACTGTGG - Intergenic
1171790888 20:29524162-29524184 CTGTAGAAAGAAAAACACTGTGG + Intergenic
1171856819 20:30352671-30352693 CTGTAGAAAGAAAAACACTGTGG - Intergenic
1172239664 20:33404206-33404228 TAGTAAGAAGAGAAGCTCTGTGG - Intergenic
1173953272 20:47010305-47010327 CAGCAGCATGAGAGGGACTGTGG - Intronic
1175361975 20:58419381-58419403 CAGACTCAAGAGAAGCACAGGGG - Intronic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1176235600 20:64052146-64052168 CAGTGGCCAGAGAAGCCTTGGGG - Intronic
1176313337 21:5217229-5217251 CTGTAGAAAGAAAAACACTGTGG + Intergenic
1176386626 21:6141237-6141259 CAGTGGCCAGGGAAGCTCTGGGG + Intergenic
1176937117 21:14880280-14880302 GTGTAGGAAGAGAAGCACTGAGG - Intergenic
1177997002 21:28112564-28112586 CAGTAGCAACTGAAGAACTGAGG - Intergenic
1178174786 21:30083973-30083995 CTGAAGCAAGAGAAACACTGTGG + Intergenic
1178179391 21:30142806-30142828 GAGTAACAAGAGAAAAACTGAGG + Intergenic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1179736847 21:43397015-43397037 CAGTGGCCAGGGAAGCTCTGGGG - Intergenic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1182080636 22:27526442-27526464 CAGTAGCTAGGGAAGGACTGGGG + Intergenic
1182161557 22:28127462-28127484 TATTATCTAGAGAAGCACTGAGG - Intronic
1182921650 22:34085580-34085602 AAGTAGCAGGAGCAGCACTCAGG - Intergenic
1183982551 22:41550220-41550242 CAATAGGTAGAGAAGCTCTGTGG - Intergenic
951573014 3:24085142-24085164 CAGTGTCAAGAGAAGCACCATGG + Intergenic
951678124 3:25265410-25265432 TAGTAGCAAGGGAAACAGTGAGG - Intronic
952044878 3:29306375-29306397 AAGGAGCAAGAGAAGGTCTGAGG - Intronic
953072247 3:39532502-39532524 CTGTAGAAAAAGAAACACTGTGG + Intergenic
953187622 3:40653236-40653258 CAGAACCAAGAGAGGCTCTGAGG - Intergenic
953822672 3:46221948-46221970 CAGTGGCAAGAGAGGGGCTGGGG - Intronic
955247538 3:57240994-57241016 CAGTAGCAAGAAACTCAGTGTGG + Intronic
959037318 3:101383225-101383247 CAGGAGCAAGAGAAAGAGTGGGG - Intronic
959715829 3:109431623-109431645 CAGCAGCAGGAAAAGCCCTGTGG - Intergenic
960210949 3:114965047-114965069 CAGTAGAAAGAGAAGCTGTTAGG + Intronic
960517188 3:118615396-118615418 AAGTAGGCAGAGAAGCAGTGTGG - Intergenic
960707712 3:120496329-120496351 CATAGGAAAGAGAAGCACTGAGG - Intergenic
961365757 3:126398259-126398281 CAGTTCCAGGAGAGGCACTGGGG + Intronic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
964206330 3:154178936-154178958 AAGTAACAAGAGAACCACTAGGG - Intronic
964761449 3:160138199-160138221 CAGAAGCAAGAACAGGACTGTGG + Intergenic
964836307 3:160941561-160941583 CAGTGGCAAGAGAAAAAATGAGG - Intronic
965997288 3:174899506-174899528 CAGAAGCAAGAGAGAGACTGTGG - Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
967365918 3:188686380-188686402 GAGTTGCAAGAGAAGCTGTGGGG - Intronic
967406964 3:189127279-189127301 CAGTAGCCAGAATAGCATTGAGG + Intronic
968081187 3:195847827-195847849 GATGAGCAGGAGAAGCACTGGGG - Intergenic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
969175211 4:5393594-5393616 CAGGAGCAAGAGAGACAGTGGGG + Intronic
969552983 4:7884112-7884134 CAGGAGCAAGAGAGGGAGTGGGG - Intronic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970864927 4:20747496-20747518 CATTAGCAAAAGAAACATTGTGG + Intronic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972214664 4:36882512-36882534 AATTAGCAAAAGAAGTACTGGGG - Intergenic
974012901 4:56623718-56623740 CAGTGGCAAGAGAAAAAATGAGG - Intergenic
974036941 4:56825743-56825765 CAGGAGCAAGAGAAAAAATGAGG - Intergenic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
975528371 4:75375611-75375633 CTGTAGACAGAGAAGCCCTGAGG - Intergenic
976826617 4:89267628-89267650 CAGAAGCCAGAGATGGACTGGGG - Intronic
979140800 4:117171600-117171622 CAGGAGCAAGAGAAAGAGTGAGG - Intergenic
980007654 4:127559817-127559839 CAGTTGCAAGACAAGAACTCAGG + Intergenic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982166495 4:152618111-152618133 CATGAGCAAGAGAAGCAGGGTGG - Intergenic
982874695 4:160631796-160631818 CAATAGCATGAAAAGCATTGAGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
984658301 4:182343892-182343914 CAATAGAATGTGAAGCACTGAGG + Intronic
985168397 4:187122503-187122525 CAGTAGTAAATTAAGCACTGAGG + Intergenic
985802390 5:2013285-2013307 CATTAACAAGACAAGCAGTGGGG - Intergenic
986048274 5:4062276-4062298 CATTAGCAACAGAGGCACTCTGG - Intergenic
987779031 5:22408482-22408504 CAGGAGCAACAGAAGCAATCTGG + Intronic
989814584 5:45720928-45720950 CAGGAGCAAGAGAAAGTCTGAGG + Intergenic
993733619 5:91450306-91450328 CAGAAGAAAGAGAATCCCTGGGG + Intergenic
994026229 5:95087699-95087721 CAGTAGCCACTGAAACACTGGGG + Intronic
994050268 5:95354554-95354576 CAGTAAGAAAAGAAGGACTGTGG - Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
996192388 5:120561816-120561838 CAGTGGCAAGAGAAAGAATGAGG - Intronic
998264968 5:140660937-140660959 CAGTAGAAACAGCAGCATTGAGG + Intronic
999743902 5:154577042-154577064 CATTTGCAAAATAAGCACTGGGG + Intergenic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1003435043 6:6080447-6080469 CAGGAGGCAGAGAATCACTGAGG + Intergenic
1004722160 6:18277292-18277314 CAGCAGCCAGAGAGGCTCTGAGG + Intergenic
1004809644 6:19246474-19246496 AAGTAGGAAGAGCATCACTGAGG + Intergenic
1004831019 6:19476661-19476683 CAGCAGCAAGAGAAAAAGTGAGG + Intergenic
1010396877 6:75403140-75403162 CAGGAGAAAGATAAGCATTGGGG + Intronic
1010643708 6:78361779-78361801 TAGGAGCAAGTGAGGCACTGAGG - Intergenic
1010688324 6:78877873-78877895 TAGCAGCAAGAGAGGCTCTGTGG - Intronic
1012476781 6:99622241-99622263 CAGCAGCAAGAGAAAAAATGAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1014416177 6:121187589-121187611 CAGTAGGAAGAGATGTACGGAGG - Intronic
1014824317 6:126031592-126031614 CAGAAGCATGAGAGGCATTGTGG + Intronic
1015826365 6:137316849-137316871 ATGTTGCAAGAGAAGCAATGTGG - Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1020142502 7:5620433-5620455 CATTGGGGAGAGAAGCACTGGGG - Intronic
1020739346 7:11993722-11993744 GAGAAGCAAGAGCAGAACTGAGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021159026 7:17248678-17248700 CACTAGCAAGTAAAGTACTGGGG + Intergenic
1021314639 7:19132353-19132375 CAATGACAAGAGCAGCACTGAGG - Intergenic
1022300252 7:29096179-29096201 CTGTAGCCAGAGAACTACTGGGG + Exonic
1022354476 7:29599846-29599868 CAGTCCCCATAGAAGCACTGTGG + Intergenic
1022521425 7:31009937-31009959 CAGGAGCAAGAGAGACAGTGGGG + Intergenic
1023334460 7:39153806-39153828 CAGTACCATGAGAAGCCTTGCGG + Intronic
1023932865 7:44717038-44717060 CCGTAGAAAGAGCAGCCCTGAGG + Intergenic
1024169985 7:46774886-46774908 CAGTAGAAAGAGTAGCACAAAGG - Intergenic
1024471114 7:49769616-49769638 CAGGAGGAAGAGAAGAATTGAGG - Intergenic
1024708161 7:51984632-51984654 CAGGAGCAAGAGAGTGACTGTGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1027301264 7:76838773-76838795 CAGTACCAAGAGAAACATTCAGG - Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027667782 7:81060318-81060340 GAGTAGCCAGAGAAGCAGTGAGG + Intergenic
1027933016 7:84564184-84564206 CTGTAGAAAGAGGATCACTGAGG - Intergenic
1028270039 7:88777134-88777156 CAGTAGCACCAGCAGGACTGTGG - Intronic
1029510021 7:100988343-100988365 CAGGAGCAAGAGAGGCAAAGAGG - Intronic
1031150154 7:118044915-118044937 CAGCAGCAAGAGCAGCACCTGGG - Intergenic
1031612846 7:123846806-123846828 AAGCAGCAAGAAAAGCCCTGTGG - Intronic
1031642188 7:124178849-124178871 AAGTAGCAAGAGTAGCATGGAGG - Intergenic
1033441000 7:141378754-141378776 CAGTAGCAATGAAAGCTCTGTGG - Intronic
1033727354 7:144132948-144132970 CAGAAGCAAAAGCAGCCCTGGGG + Intergenic
1034365047 7:150539173-150539195 CAGTAGCAAGAGAGAGAGTGGGG + Intergenic
1035168875 7:157006964-157006986 CAGAGGCAAGAGGAGAACTGAGG + Intronic
1038140262 8:24837566-24837588 CAGTAGAACTTGAAGCACTGAGG - Intergenic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1039814261 8:41078851-41078873 CACCAGCAACAGGAGCACTGTGG - Intergenic
1040517067 8:48144038-48144060 GAGAAGCAAGAGAAGCAGTCAGG + Intergenic
1041204580 8:55485697-55485719 CAGTAGAAAAAGAAACACTTAGG - Intronic
1042665024 8:71195169-71195191 CAGGAGCAAGAGAAGAAATGGGG - Intergenic
1043053870 8:75413087-75413109 TAGTAGCAAGAGATGAAGTGGGG + Intronic
1043638529 8:82418272-82418294 CAGAAGAAAGAGAAACACAGTGG + Intergenic
1047489929 8:125365998-125366020 CAGTAGCAAGTGCAGTGCTGAGG - Intronic
1047607595 8:126490459-126490481 GTGTGGCAGGAGAAGCACTGTGG - Intergenic
1048265461 8:132981641-132981663 CAGCAGCAACAGCAGCGCTGGGG + Intronic
1048337980 8:133517186-133517208 CAGAATCCAGAGAAGGACTGGGG - Intronic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1055745005 9:79433882-79433904 CAATAGCCAGAGAGGAACTGAGG - Intergenic
1055834452 9:80421725-80421747 CAGTAGCTGGAGATGCACTAGGG - Intergenic
1056117537 9:83455486-83455508 CAGTGGCAAGAGAAAAAATGAGG - Intronic
1056528632 9:87467547-87467569 CTGAGGCAAGAGAATCACTGAGG + Intergenic
1056759953 9:89407305-89407327 CAGCAGGAAGAGAAGGACTGAGG - Intronic
1057969998 9:99545558-99545580 CAGTTTCAAGGGAAGGACTGAGG - Intergenic
1058044317 9:100339568-100339590 CATTAGCTAGAGAATCATTGAGG - Intronic
1058758934 9:108110668-108110690 CAGGAGCAGGAAAAACACTGAGG - Intergenic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1203452233 Un_GL000219v1:129774-129796 CTGTAGAAAGAAAAACACTGTGG + Intergenic
1185938323 X:4284315-4284337 CAGAAGCAAGAGACACAATGGGG - Intergenic
1186355897 X:8789392-8789414 CAGAGGCAAAAGAAGCACTGCGG - Intergenic
1187200441 X:17129144-17129166 GAGGAGGAAGAGAACCACTGAGG + Intronic
1187204487 X:17169375-17169397 CAGTAGGTAAAGAAGCACTGTGG + Intergenic
1188765573 X:34087639-34087661 CAGAAGAAAGAGTAGCACTTGGG + Intergenic
1189400951 X:40667972-40667994 CTGTGGGAAGAGGAGCACTGGGG + Intronic
1190233635 X:48600415-48600437 CCGTAGCACGCGAAGCACTGTGG - Exonic
1190738252 X:53269886-53269908 CAGTAGGAGGAAAAGCAGTGGGG - Intronic
1191018970 X:55840278-55840300 AAGCAGCGAGAGAAGCCCTGTGG - Intergenic
1192193287 X:69010487-69010509 CAGCAGCCAGAGAGGAACTGAGG - Intergenic
1193011752 X:76683455-76683477 CAGTAACATGAGTAGTACTGGGG - Intergenic
1193042585 X:77019256-77019278 CAGAATCAAGAGAATCACAGAGG + Intergenic
1194280073 X:91940162-91940184 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195277721 X:103298767-103298789 CAGTAGGACTAGCAGCACTGTGG - Intergenic
1195648356 X:107258482-107258504 CAGGAGCAAGAGAGCCAGTGGGG + Intergenic
1197998941 X:132411933-132411955 AAATAGCAAGAGAAGCACTTAGG - Intronic
1200137686 X:153883014-153883036 CAGCAGCCAGACGAGCACTGGGG - Intronic
1200157248 X:153983738-153983760 CCGCAGCCAGAGAGGCACTGAGG + Intergenic
1200597548 Y:5163663-5163685 CAGGAGCAAGAGAGGCATGGGGG - Intronic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic