ID: 1111685877

View in Genome Browser
Species Human (GRCh38)
Location 13:91500334-91500356
Sequence AAGATTCTTCCTCTCCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111685877_1111685880 -4 Left 1111685877 13:91500334-91500356 CCAGGTAGGAGAGGAAGAATCTT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1111685880 13:91500353-91500375 TCTTGGTCAGCCAATGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 146
1111685877_1111685879 -8 Left 1111685877 13:91500334-91500356 CCAGGTAGGAGAGGAAGAATCTT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1111685879 13:91500349-91500371 AGAATCTTGGTCAGCCAATGTGG 0: 1
1: 0
2: 0
3: 12
4: 170
1111685877_1111685882 17 Left 1111685877 13:91500334-91500356 CCAGGTAGGAGAGGAAGAATCTT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG 0: 1
1: 0
2: 1
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111685877 Original CRISPR AAGATTCTTCCTCTCCTACC TGG (reversed) Intronic