ID: 1111685882

View in Genome Browser
Species Human (GRCh38)
Location 13:91500374-91500396
Sequence GGCCATCTGATATTTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111685877_1111685882 17 Left 1111685877 13:91500334-91500356 CCAGGTAGGAGAGGAAGAATCTT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG 0: 1
1: 0
2: 1
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111685882 Original CRISPR GGCCATCTGATATTTCCTAC TGG Intronic
900733439 1:4278829-4278851 AGCTATCTGATATTGGCTACTGG - Intergenic
900834153 1:4987068-4987090 GGCCATCTCATTTTTTTTACTGG + Intergenic
905115640 1:35637742-35637764 GGCAATTTGATATTATCTACAGG - Intronic
905249464 1:36638695-36638717 GGCCATCTGGTATCCCCTGCAGG + Intergenic
907810838 1:57868209-57868231 AGCCATCTGACATTTCCTTTTGG + Intronic
917406800 1:174715676-174715698 GACCATCTGTTATTTACTAAGGG - Intronic
917739669 1:177950381-177950403 GGCCATCCGACATTTTCTGCAGG - Intronic
919528317 1:198681450-198681472 TGCAATGTGATGTTTCCTACTGG + Intronic
923417475 1:233777609-233777631 GGGAATCTGATTTTTCCAACTGG - Intergenic
924084640 1:240438293-240438315 GGCCATCTAATTTTTTCTTCAGG - Intronic
1064641086 10:17416445-17416467 GCCCATCTGACATTTCCAATTGG + Intronic
1065274752 10:24074592-24074614 GGTCATATGATATTTCCTTGAGG + Intronic
1075648517 10:124112199-124112221 GTCCATCTCATAATTCCTGCAGG + Intergenic
1075909453 10:126111612-126111634 GACCATGGGATATTTCCAACTGG + Intronic
1078643657 11:13118739-13118761 GGCAATCTGATTGTTCCTGCTGG - Intergenic
1078704799 11:13732831-13732853 AGCCATATGAAATTTCTTACAGG - Intergenic
1080190647 11:29543641-29543663 TTTCATCTGATATTTCCTTCTGG - Intergenic
1081781198 11:45714216-45714238 GGCCATGTGATACTTCCATCTGG + Intergenic
1086804812 11:91227189-91227211 GCCCATCTGGTTTCTCCTACTGG + Intergenic
1088852171 11:113714057-113714079 GGCCGACTGATACCTCCTACAGG - Intergenic
1101361875 12:104034892-104034914 GGCCAACTGATACATCATACAGG + Intronic
1106582770 13:31032057-31032079 GGCCATCTGGTATAGCCAACCGG - Intergenic
1108610747 13:52081341-52081363 AGGCATCTGATATTTCCTGAAGG - Intronic
1109676397 13:65680298-65680320 GGCAATTTGAGATTTCCCACAGG - Intergenic
1110951812 13:81502462-81502484 GGTCATGTAATATTTCCTAGAGG + Intergenic
1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG + Intronic
1119530491 14:75356991-75357013 GGCAATCAGATCTTTCCTTCTGG - Intergenic
1124440503 15:29682277-29682299 GGCCATGTGCTAGTTCCCACGGG - Intergenic
1125363444 15:38888841-38888863 AGGCTTCTGATATTTCCTGCTGG - Intergenic
1129543286 15:76369253-76369275 GGGCATCATAGATTTCCTACTGG - Intronic
1131988419 15:98067944-98067966 GGCCATGTGGGAGTTCCTACTGG - Intergenic
1133384146 16:5355233-5355255 TGCCATCTGCCATTTCCTGCTGG - Intergenic
1140383619 16:74513389-74513411 GGCCAACAGATATCTCATACAGG + Intronic
1141134721 16:81457879-81457901 GGCCAGCTGGGATTTCCTTCTGG - Intronic
1146674985 17:34767231-34767253 GTTCATCTGAAATTTCCTTCCGG - Intergenic
1147531249 17:41280263-41280285 GGTCATGTGATAGTTCCTACTGG - Intergenic
1151269719 17:72984787-72984809 AGTCATCTGACATTTCCTTCTGG + Intronic
1151394464 17:73813048-73813070 GGCCATCTGAAAGTTCCTGATGG + Intergenic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165614442 19:37187076-37187098 GTACATCTGAAAGTTCCTACAGG - Exonic
1166576726 19:43847775-43847797 CGACATCAGATATTTCATACTGG + Exonic
925747950 2:7060400-7060422 GGCCATCTGTCATTTTCTTCAGG + Intronic
929218905 2:39443347-39443369 GGGCATCTAATATTTCCTTCTGG - Intergenic
930755653 2:54969338-54969360 GGCCTTCTGATACTTCCTGGTGG + Intronic
934681760 2:96288831-96288853 GGCCAGGTGAGATTTGCTACAGG + Intronic
935291594 2:101615632-101615654 GGCCACCTGTTATTTCCTTAGGG + Intergenic
936851981 2:116910932-116910954 GGTCATCTGGTCTTACCTACTGG + Intergenic
937596310 2:123678689-123678711 GTTCAACTGAGATTTCCTACTGG + Intergenic
938023742 2:127926877-127926899 GGCCATCAGAAATCTCCTTCGGG + Intergenic
940154900 2:150645315-150645337 GGTCACCTGATAATTCCTTCAGG + Intergenic
941041397 2:160627956-160627978 GGCCAACAGATACTTCATACAGG - Intergenic
944082473 2:195803932-195803954 GCCCATCTCATTTTTTCTACTGG + Intronic
945314981 2:208361031-208361053 CGCCATCTGTTATTTCCAGCGGG - Intronic
947309893 2:228790122-228790144 GTCCATCTGATAGTTCCAAATGG + Intergenic
1171443471 20:25186243-25186265 GGCCAACTGACATCTCATACAGG - Intergenic
1184074740 22:42169169-42169191 TGCCACCTGATGTTTCCTGCAGG - Intronic
949878324 3:8641627-8641649 GCCCATCTGGTCTTTCCCACAGG - Intronic
953256954 3:41300012-41300034 GGCCATCAGATATTTTCTACAGG + Intronic
957392078 3:79588446-79588468 GGCCAGCTAATAACTCCTACAGG - Intronic
958949156 3:100398870-100398892 AGCCATATGATCTTTCCTATGGG - Intronic
961821777 3:129578941-129578963 GGCCCTCTGAAATGTCCTCCTGG - Intronic
965253611 3:166375360-166375382 GGCCATCTGCATTTTCTTACGGG + Intergenic
965523679 3:169694442-169694464 GGCCATCTAGTATTTCTTAGAGG + Intergenic
965910157 3:173764912-173764934 TGCCATCTGATATTTCTTGTTGG + Intronic
966284112 3:178272975-178272997 CGCCATCTGACAGTTCCTCCAGG + Intergenic
973589009 4:52421254-52421276 GGCCATCTGGTCTTACCTCCAGG - Intergenic
981242881 4:142499773-142499795 GGAGGTCTGATATTTTCTACTGG - Intronic
992135810 5:73743539-73743561 GGCATTCTGATATTTCCCCCTGG + Intronic
992251016 5:74876070-74876092 GGCCATCTGATTCTGCCAACTGG + Intergenic
1001525035 5:172422890-172422912 GGCCATCTTATATCTTCCACAGG + Intronic
1003383898 6:5649949-5649971 GGGCTTCTTAGATTTCCTACAGG + Intronic
1003542213 6:7027586-7027608 GGCCAACTGACACTTCATACAGG + Intergenic
1004114532 6:12753436-12753458 GCCCATCTTATATTTCTTAAAGG + Intronic
1005794015 6:29338084-29338106 TGCCATCTCCTATTTCCTTCAGG - Intergenic
1014579857 6:123123645-123123667 GCCTAGCTGAGATTTCCTACTGG - Intergenic
1014633380 6:123814742-123814764 GGTCATTGCATATTTCCTACTGG + Intronic
1014833750 6:126133570-126133592 AGCCCTCAGATATTTCCTGCTGG + Intergenic
1015080172 6:129214565-129214587 GGCCATCTGATCTTTCACAAAGG - Intronic
1021870504 7:25001664-25001686 GGCCAACAGATATCTCATACAGG - Intergenic
1024096932 7:45989468-45989490 GGTCACCTGCTATTGCCTACTGG - Intergenic
1026076831 7:67179324-67179346 GGCCATCTGCTGGTTCCTGCTGG + Intronic
1027137381 7:75634522-75634544 TGACATCTGATATTCCATACCGG - Intronic
1029252566 7:99247550-99247572 GGTCAGCTGATTTTTCCTCCTGG - Intergenic
1032689048 7:134264351-134264373 GGCTTTCTGATATATCCAACTGG + Exonic
1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG + Intergenic
1053514584 9:38719854-38719876 GCCCATCTGTTATTCCCAACTGG + Intergenic
1059842577 9:118234337-118234359 GGTCATTTGATCTTTCCTCCAGG - Intergenic
1192416897 X:70989014-70989036 TGCCATCTGCTGTTTCCTGCGGG + Intergenic
1193495673 X:82208631-82208653 GGCCATCTCATACCTCCTTCAGG + Intergenic
1200160802 X:154007642-154007664 GGCCTTCTGATTTTTCTCACAGG - Intergenic