ID: 1111685882

View in Genome Browser
Species Human (GRCh38)
Location 13:91500374-91500396
Sequence GGCCATCTGATATTTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111685877_1111685882 17 Left 1111685877 13:91500334-91500356 CCAGGTAGGAGAGGAAGAATCTT 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG 0: 1
1: 0
2: 1
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111685882 Original CRISPR GGCCATCTGATATTTCCTAC TGG Intronic