ID: 1111689636

View in Genome Browser
Species Human (GRCh38)
Location 13:91546975-91546997
Sequence TTTAGCAATGAGAAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111689632_1111689636 24 Left 1111689632 13:91546928-91546950 CCTTGGAATAAGGTAAGAATGGT 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG 0: 1
1: 0
2: 3
3: 25
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111689636 Original CRISPR TTTAGCAATGAGAAGGTAGA TGG Intronic
903321919 1:22548470-22548492 GTTGGAAATGAGATGGTAGAAGG + Intergenic
904224279 1:29002047-29002069 TTTACCAATGAGAAAACAGAAGG - Intronic
905044138 1:34983218-34983240 ATTAGAATTGAGGAGGTAGAAGG + Intronic
909199598 1:72673649-72673671 TTTGGAAATGAGGAGTTAGATGG - Intergenic
909471247 1:76030824-76030846 CTTAGCAAAGAGAAGATATAGGG + Intergenic
909828557 1:80156446-80156468 TTTTGCACTTAGAAGGTACATGG - Intergenic
910319411 1:85926970-85926992 TTTAGCAATCACCAGGTTGATGG + Intronic
910375556 1:86565946-86565968 TTCAGCAATGAGAAGACAGGTGG - Exonic
911587858 1:99711609-99711631 TATAGCAGTGTTAAGGTAGAAGG + Intronic
916799478 1:168203056-168203078 TTAAGCAAACAGAAGGTAGTTGG + Intergenic
916941083 1:169679225-169679247 TTTAGTAAAGAGAAGGTGGGTGG - Intronic
917436069 1:175022868-175022890 TTTAGCAGTGTGAAGGTTGTTGG - Intronic
917626467 1:176851336-176851358 TTTTGCCATGTGAAGGTAGAAGG - Intergenic
919145466 1:193629125-193629147 TTTGACAGTGAGAAGGCAGAGGG + Intergenic
919460187 1:197867690-197867712 TTTTGGAATGAAAAAGTAGAAGG - Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
922744356 1:228035909-228035931 TTAAGCCATGAGGAGGTAGGAGG - Intronic
923366889 1:233270547-233270569 TTTAAAAATGATGAGGTAGATGG + Intronic
923445462 1:234066607-234066629 TTTGGGAAGGAGAAGGTAGTGGG - Intronic
924349705 1:243103092-243103114 TTCAGCAATGAAAAGGAACAAGG + Intergenic
1063030268 10:2227575-2227597 TTTAGCAATTAAAAGGAATAAGG + Intergenic
1063696454 10:8340089-8340111 TTTTACAAAGAGAAGATAGAAGG - Intergenic
1064750105 10:18519827-18519849 TTTAGCAATGTGAAGGTCATGGG - Intronic
1068092654 10:52451999-52452021 TTGAGAAATGAGAGGATAGAAGG - Intergenic
1069190254 10:65478463-65478485 TTTTGCAATGAGAAGTTTGATGG + Intergenic
1073435373 10:103512986-103513008 ACCAGAAATGAGAAGGTAGAGGG - Intronic
1073873385 10:107892106-107892128 GTCAGTAATGAGAAAGTAGAAGG - Intergenic
1074599025 10:114894956-114894978 TCTAGCACTGAGAATGCAGAAGG + Intronic
1074684055 10:115942245-115942267 TTTAGCAATGGGAAGAGATAAGG - Intronic
1079572392 11:21960239-21960261 TCTAGCAATGAGAGTGAAGAAGG + Intergenic
1081679922 11:44994918-44994940 CCTAGCATTGAGAAGGTTGAGGG + Intergenic
1082943762 11:58736144-58736166 TTTAGGTATAAGAAGGTACAGGG - Intergenic
1083086801 11:60156594-60156616 TTTAGCAAGGAGGATGTATATGG - Intergenic
1083832545 11:65241966-65241988 TGTAGAAATGAAAAGGCAGAAGG - Intergenic
1084681869 11:70671020-70671042 GTTAGCAATGAGGAGGAAAATGG - Intronic
1086369321 11:86140915-86140937 TTTAGCAATAAGAAAAAAGATGG + Intergenic
1086533357 11:87813080-87813102 TATAGCAATGAGGAGACAGAGGG + Intergenic
1086730995 11:90249928-90249950 TTTAGAAGGGAGAAGGGAGAAGG - Intergenic
1087019044 11:93584173-93584195 TGCAGAAATGAGAAGGTAGAGGG + Intergenic
1087110864 11:94465768-94465790 TTTATAAATGAGAAGTTTGAAGG - Intronic
1087179870 11:95131297-95131319 TTCAGCAGTGTGAAGGTAAATGG + Exonic
1088183294 11:107136172-107136194 TGTAGCAATAAGAAAGTAGTAGG - Intergenic
1089846587 11:121463518-121463540 TTTAGCAAAGAGAAAGGAAAGGG + Intronic
1090578239 11:128132262-128132284 TTGAGCAGTGGGAAGGTAGGAGG - Intergenic
1090638687 11:128711606-128711628 TTTTTCAATGAAAAGGTATAGGG - Intronic
1090995661 11:131863731-131863753 TTTAGGGAAGAGAAGGCAGATGG - Intronic
1091796257 12:3299001-3299023 TTTAGAAATGGGAAGTGAGACGG - Intergenic
1091866717 12:3844385-3844407 TTAAGGAATGAGAAGATAGAGGG + Intronic
1092051464 12:5473732-5473754 TTTGGGAATGAGAAGCAAGAAGG - Intronic
1093803308 12:23400383-23400405 TTTAGGTTTGAGAAGATAGAGGG - Intergenic
1096353671 12:50921217-50921239 TGTAGCATTGAAAAGCTAGAGGG - Intergenic
1096558709 12:52420303-52420325 CTTAGCATTGAAAAGGAAGAAGG - Intergenic
1097841757 12:64328346-64328368 TTTAGATATTAGAAGGAAGAGGG - Intronic
1098058301 12:66532812-66532834 TTTAGAACTGAGAAGTCAGAAGG + Intronic
1098226267 12:68328266-68328288 TTTAATACTGAGAAGGTAGATGG - Intronic
1098806265 12:75023494-75023516 TTTAGCAATGAAGAGGTAATTGG - Intergenic
1098829674 12:75345860-75345882 TTTAGTAATACGAAGGGAGAAGG - Intronic
1099986904 12:89676816-89676838 TTTAACAATGAGAATTTAGAAGG - Intronic
1100892196 12:99138174-99138196 TTTATTGATGAGAAGGTTGATGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1104566399 12:129888763-129888785 GTTACCAAAGAGAAGGTAGTGGG - Intronic
1106595271 13:31130065-31130087 TCTAACCATGAGTAGGTAGAGGG - Intergenic
1107555431 13:41513444-41513466 TGTAGCCAGGAGAAGGCAGAGGG + Intergenic
1107836512 13:44416213-44416235 TTTAGGAATGAAAGGGTGGATGG - Intergenic
1108782962 13:53858804-53858826 TTTAGCAATTAGGAGACAGATGG + Intergenic
1109211193 13:59537948-59537970 TATAGCAAGGAGAGGGAAGAGGG - Intergenic
1110396498 13:75035421-75035443 TTTAGGAATGAAAGGGTAAATGG + Intergenic
1110580179 13:77112680-77112702 TTTGGCAAGGCCAAGGTAGAAGG - Intronic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113151865 13:107272932-107272954 TTCACCAATGAGAATGTACATGG + Intronic
1113993494 14:16048215-16048237 TGTAGTGGTGAGAAGGTAGATGG + Intergenic
1114544388 14:23487671-23487693 TTTAGGGATGGGAAGGTAGGGGG + Intronic
1114621085 14:24096533-24096555 TTTAGAAATAAGTAGGGAGATGG - Intronic
1114685060 14:24521276-24521298 TTTATCAGTGAGAAAGTAGATGG + Intergenic
1116466959 14:45245182-45245204 TTTAGCAATGTGAAGGTCATTGG - Intronic
1117710127 14:58519843-58519865 TTTAGTAATAAGACGGAAGAAGG + Intronic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1118926436 14:70194192-70194214 TTGAACAATGAGAAGGCATAGGG - Intergenic
1120075964 14:80158729-80158751 GATAGAAATGAGAGGGTAGAGGG - Intergenic
1121057629 14:90873036-90873058 TTGAGAAAGGAGAAGGTATAGGG - Intronic
1122220631 14:100237383-100237405 TTTAGCAATAAGAAGGGACTAGG + Intergenic
1122448695 14:101785776-101785798 TTTAGCAATCAAAAGTTTGAAGG + Intronic
1124116458 15:26847782-26847804 TTCATCAGTGAGCAGGTAGAGGG + Intronic
1124240172 15:28021788-28021810 TGCAGCCATGAGAAGGTAGGAGG + Intronic
1127027523 15:54823896-54823918 TTGAGCAAAGAGAAGAAAGATGG - Intergenic
1128174889 15:65546545-65546567 TTTAGCAATCAATTGGTAGAAGG + Intronic
1128692819 15:69738146-69738168 TTTGGCAAAGAGAAGGTGGGTGG - Intergenic
1129164161 15:73766797-73766819 TTCAGCACTGATAAGGGAGATGG + Intergenic
1129495835 15:75979001-75979023 ATTAGTAATGAGAATGTATAAGG - Intronic
1130775492 15:86976379-86976401 TTTAGCAATTAGAAATTATATGG - Intronic
1135022617 16:18975563-18975585 TTTAGCAATCAGCAGGTACCAGG + Intergenic
1135606522 16:23830412-23830434 TTCAGCAGTTAGAAGGTAGTGGG - Intergenic
1136232351 16:28894158-28894180 TTTATCATTGACAAGGTGGATGG + Exonic
1139402570 16:66694757-66694779 GTTAGCAAAGAGAATGTAGGAGG - Intronic
1140949379 16:79801757-79801779 ATTAGCACTTAGAAGATAGATGG - Intergenic
1141171622 16:81695263-81695285 TTTAGGAAGGAGAAGGTAGAAGG - Intronic
1145745188 17:27313371-27313393 TTTAGCAATAATACAGTAGACGG - Exonic
1148375544 17:47141915-47141937 TGTAGTGGTGAGAAGGTAGATGG + Exonic
1149194076 17:54098820-54098842 TTCAGGAATGAGGAGGAAGAGGG + Intergenic
1149384653 17:56130077-56130099 ATTAGCAATGTGAAGTGAGAAGG - Intronic
1150707082 17:67496756-67496778 AATAGAAATGAGAAGGTTGAGGG + Intronic
1150758577 17:67938781-67938803 TTTAGAAATAAAAACGTAGATGG + Intronic
1151066590 17:71157917-71157939 TTTATAAATGAGAAGGTTAAAGG + Intergenic
1153469291 18:5425790-5425812 TTTAGCAGTGAGGAGTGAGATGG - Intronic
1154239879 18:12643329-12643351 TTTAGGAATGAGAACTTGGAGGG + Intronic
1155831335 18:30518126-30518148 TGTAGGAATGAAAAGGTAGGTGG + Intergenic
1155936720 18:31762393-31762415 TTTAGAAATGTGAAGGCAGATGG - Intergenic
1156571867 18:38264715-38264737 TTTCTCAATGGGAAGGTTGATGG + Intergenic
1156958846 18:42998417-42998439 TTTAGCAGTGAGAGAGTAGAGGG - Intronic
1158363897 18:56708445-56708467 TTGAGGAGTGAGAAAGTAGAAGG + Intronic
1158442075 18:57484888-57484910 TTTAGCAATGAGCAGGGACTGGG + Exonic
1158767144 18:60465491-60465513 TTTAACAATGACAAAGTAGGGGG - Intergenic
1159532183 18:69669061-69669083 TTTAGCAATTGGGTGGTAGAGGG - Intronic
1164548318 19:29187144-29187166 TTTGGCAATGAGAAGGGTGAAGG - Intergenic
1165896910 19:39147137-39147159 TGTAGCTATGAGAAGGTATTAGG - Intronic
927585226 2:24297415-24297437 TTTACCAATCAGATGTTAGAGGG - Intronic
929328518 2:40648798-40648820 TTTAGCAATGATGAGGTAATTGG - Intergenic
929862804 2:45693757-45693779 TTTGGCAAGGAGAAGTGAGAAGG + Intronic
932113977 2:69028129-69028151 TTTAGCAATGAAAAGTTATTTGG - Intronic
932279430 2:70477208-70477230 TTTATCAATAAAAAGGAAGAAGG + Intronic
932439420 2:71722924-71722946 TTTGGAAATTAGAAAGTAGATGG + Intergenic
933197379 2:79407589-79407611 TCTAGCAATGAAGAGGAAGAAGG + Intronic
933274010 2:80264937-80264959 TTTATCAATGAGAAAGGATAGGG + Intronic
933516644 2:83312191-83312213 TGTAGGAAAGAGAAGGTAGTTGG + Intergenic
935086308 2:99848857-99848879 TCTAGCACTGGGAAAGTAGATGG + Intronic
936928008 2:117757818-117757840 GTCTGCAATGAGAAGGTTGAAGG + Intergenic
938538192 2:132262649-132262671 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939110735 2:138003789-138003811 TTTTGCAATAAGATGGAAGAAGG - Intronic
939183682 2:138834389-138834411 TTTTGAAAAGAGAAGGAAGAAGG + Intergenic
939260241 2:139798411-139798433 TTAAGAAAGGAAAAGGTAGAGGG + Intergenic
940268724 2:151868236-151868258 TTTAGCAAAGAGAAAGTGAATGG + Intronic
940604308 2:155900615-155900637 TATAGCAACCAAAAGGTAGAAGG - Intergenic
941091632 2:161183115-161183137 TTTATCAATTAGAAAGGAGAAGG - Intronic
941473549 2:165920564-165920586 TTTAGCAAGGAGAAGGACTAAGG + Intronic
941711312 2:168716706-168716728 CCTAGCCAGGAGAAGGTAGAAGG + Intronic
942930295 2:181484056-181484078 TTGAGAAATGAGAGGTTAGATGG - Intronic
943132710 2:183874704-183874726 TTTAGAAAAGAGAAAGCAGATGG - Intergenic
943956620 2:194200159-194200181 TTTAGAAGTTAGAAGGAAGATGG - Intergenic
945119230 2:206441812-206441834 ACAAGCAATGAGAAGGGAGAGGG - Intergenic
945184526 2:207126192-207126214 TCTAGCAATGAGATGGAATAAGG - Intronic
945335085 2:208582669-208582691 TTTAGCAAAGAGAATGAAGAGGG - Intronic
946965557 2:225033748-225033770 TTTACAAATAAGAAGGTTGATGG - Intronic
948958237 2:241311859-241311881 GTTTGCACTGAGAAGGCAGAGGG + Intronic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169689253 20:8311978-8312000 TTGAGCAGTGAGAGGGAAGAGGG - Intronic
1169963847 20:11193237-11193259 TTTAGCCAATAGAAGGGAGATGG + Intergenic
1170291738 20:14777848-14777870 TTTAGCAATGAGGAGAAAAATGG + Intronic
1170917246 20:20639090-20639112 TTTAGCAGTGACAGGGCAGAAGG + Intronic
1171811540 20:29747644-29747666 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1171867094 20:30494436-30494458 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1171994190 20:31719627-31719649 TTAAGCAAAGAGATGGAAGATGG + Intronic
1173468770 20:43305992-43306014 TTTGACAATGTGAAGGTAAAAGG - Intergenic
1174374117 20:50114048-50114070 CGTAACAATGAGGAGGTAGAGGG + Intronic
1175045597 20:56101989-56102011 TGTAGCCATGTGAAGGAAGAAGG + Intergenic
1177994292 21:28076668-28076690 TTTAGGAACGAGAAGGGAGAAGG + Intergenic
1178155326 21:29846692-29846714 TTAAAGAATGAGAAGGGAGAAGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180313775 22:11259298-11259320 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1182321640 22:29481622-29481644 TTAAGCACTGAGCAGGTAGTGGG - Intronic
1183515491 22:38263239-38263261 TTCAGCAATCAAAAGGTACATGG + Intronic
1183771661 22:39931658-39931680 TATAGGCATGAGAAAGTAGATGG + Intronic
949976974 3:9469968-9469990 TGGAGGAAGGAGAAGGTAGACGG - Intronic
950546948 3:13643878-13643900 TTTAGAAATGTGATGGTTGACGG - Intergenic
951252023 3:20404886-20404908 TTTGGCAGTGAGACTGTAGAAGG + Intergenic
951639467 3:24819852-24819874 TTTGGCAGTGAGAAGTTAAAAGG + Intergenic
951650499 3:24946400-24946422 TTTAGAAATTAGAAGGTGGTGGG + Intergenic
951698637 3:25471933-25471955 CCTGACAATGAGAAGGTAGAGGG - Intronic
952408090 3:33023275-33023297 TGTAGCAATGAACAAGTAGAAGG + Intronic
952880987 3:37986333-37986355 TTTAGCAATGAACATGTATATGG - Intergenic
955504244 3:59615013-59615035 TTTAGCTCGGAGAAGGTTGATGG - Intergenic
955605122 3:60693644-60693666 TTCAGCACTGACAAGGCAGAAGG - Intronic
956269217 3:67432117-67432139 TTTAACAATGGGAGGCTAGATGG + Intronic
956695994 3:71919923-71919945 TTTAGAGATGAGAATATAGAGGG - Intergenic
956763227 3:72461920-72461942 TTTAGCAATTAGAAGGTCACTGG + Intergenic
956928116 3:74011251-74011273 TGTAGCAATGACAAAGTACAGGG - Intergenic
957356464 3:79094325-79094347 TTTATCAGTGAGAAGGTCAATGG + Intronic
958819962 3:98962240-98962262 TGTAGCTATGAAAAGGAAGATGG - Intergenic
959591784 3:108090459-108090481 CTAAGCACTGAGAAGGGAGAGGG + Intronic
960673514 3:120173947-120173969 TTTGGCAATGGGTAGGCAGATGG - Intronic
961772066 3:129257372-129257394 CTTAGAAATGAGAAGGCTGAAGG + Intronic
963948765 3:151175563-151175585 TTTAGAAATTAGGAGGTACATGG - Intronic
965540197 3:169864262-169864284 TGTAGCAACCAGAAGGTAGAGGG - Intronic
967999851 3:195197735-195197757 TTTAGCAATGTGAAGGTCATTGG - Intronic
969044065 4:4323818-4323840 TTTAGCAATGGGGAGGTCGTGGG - Intergenic
969262535 4:6043125-6043147 CTTAGCAATGAGGAGGTCAATGG - Intronic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970978200 4:22065782-22065804 TATTGCAATGAGAAGATATAAGG - Intergenic
971598121 4:28557878-28557900 TTTAGCAATCAAAAGACAGAAGG - Intergenic
972720800 4:41695814-41695836 CTTAGGAATGAATAGGTAGAGGG + Intronic
974838073 4:67274371-67274393 TTTAGCATTCAGAAGCTATAAGG + Intergenic
975207816 4:71664568-71664590 GTTAGTAAGGAGAAGGGAGAAGG + Intergenic
975503087 4:75109096-75109118 TTTAGAAATGAGGAGATAGAAGG - Intergenic
975659204 4:76671533-76671555 GTTAGCAAAGAGAATGAAGAGGG - Intronic
975838674 4:78451572-78451594 TTTGGTTATGAGAAAGTAGATGG + Intronic
976112798 4:81694189-81694211 TTGAGCAATGAGAATGAATAAGG + Intronic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
976222874 4:82772175-82772197 TTTAGCAATCAGATGGAAGGTGG + Intronic
977171760 4:93770936-93770958 TTTTGAAATAAGAAGGGAGAAGG + Intronic
977534300 4:98239018-98239040 TTTAGCAATGAGAAAGTCATAGG - Intergenic
978290951 4:107139628-107139650 TTAAGCAATGATAAGTTAGCTGG - Intronic
978759835 4:112344735-112344757 TTTAGAGATGAGAAAGTTGAGGG - Intronic
979252234 4:118577468-118577490 TTCAGCAATGAAAAGGAACAAGG - Intergenic
980269050 4:130560308-130560330 TTTAGCACTGTGAATGTAGATGG - Intergenic
980854161 4:138419201-138419223 TGTAGCAATAAGAAGGGAAAAGG + Intergenic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981366159 4:143905894-143905916 ATTAGAAATGAGAAGGTCTATGG - Intergenic
981376274 4:144019674-144019696 ATTAGAAATGAGAAGGTCTATGG - Intergenic
981386787 4:144141022-144141044 ATTAGAAATGAGAAGGTCCATGG - Intergenic
981471046 4:145135534-145135556 TTAAGGAATGAGAAGATAGAGGG - Exonic
981619972 4:146684588-146684610 TTAAGGAAGGAGGAGGTAGAGGG - Intergenic
984211010 4:176848475-176848497 TTGAACAATGAGAAAGGAGAAGG - Intergenic
984963285 4:185119007-185119029 TTTATCAGTGTGAAGGCAGAGGG + Intergenic
985042778 4:185908494-185908516 TTTAGCAATCAGAAGTCAGAGGG - Intronic
985225121 4:187751654-187751676 TTTAGCAAAGGGAAGGTTCAAGG + Intergenic
985331349 4:188839789-188839811 TTTACCAAAGAGCAGGTTGATGG - Intergenic
986143661 5:5056063-5056085 TTTTGCAATTAGAATTTAGAGGG - Intergenic
986973303 5:13363551-13363573 TTTAGAAATGAGAAAGAAAATGG + Intergenic
987097349 5:14561676-14561698 TGAGGCAATAAGAAGGTAGAAGG + Intergenic
989060657 5:37408163-37408185 TTTGTCAGTAAGAAGGTAGAGGG + Intronic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
990278560 5:54225857-54225879 TTTTTCAATGAGAAGGTAGATGG - Intronic
992029204 5:72703747-72703769 TTTAGAAAGGAGAAAGTAGAAGG - Intergenic
992481456 5:77156228-77156250 TGTAGCTATGGGAAGGTAGAAGG + Intergenic
992769411 5:80033576-80033598 GAGAGCAATAAGAAGGTAGAAGG - Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
993459443 5:88165180-88165202 ATTAGCAATCAGCAGGCAGATGG + Intergenic
994389752 5:99177825-99177847 TTTATCAATTAGAAGGCAGAAGG + Intergenic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
995640136 5:114246898-114246920 TTTTTAATTGAGAAGGTAGAAGG + Intergenic
997874284 5:137534626-137534648 TTTTGGTATGAGAAGTTAGAAGG + Intronic
998194627 5:140057666-140057688 TTTTGCAATGAAAAGCTATAGGG + Intergenic
999675276 5:153994432-153994454 ATTAGATTTGAGAAGGTAGATGG - Intronic
999726128 5:154439575-154439597 ATTAGGATTGAGAAGGTATATGG - Intergenic
1001114371 5:168926613-168926635 TTAAGCAATGACAAGCTAAAAGG - Intronic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1002777975 6:344664-344686 TTTATAAATGAGAAGATAAATGG + Intronic
1003366985 6:5484291-5484313 ATTACCAATCAGAAGTTAGAAGG + Intronic
1003397227 6:5763784-5763806 TTTAACATAGAGAAGGTAAAGGG + Intronic
1004815210 6:19304961-19304983 TTTAGCAATGGAAATGAAGAAGG - Intergenic
1007146057 6:39633199-39633221 TTTTGAAATGAGAGTGTAGAGGG + Intronic
1007327121 6:41071671-41071693 TTCAGCTATGAGAAGGGAAAAGG + Exonic
1007348505 6:41251240-41251262 TTCAGTGATGAGAAGGTGGAAGG - Intergenic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1009809050 6:68637281-68637303 TTATGCAATGGGAAGGAAGAGGG + Intronic
1010714066 6:79207844-79207866 CTTCCCACTGAGAAGGTAGAGGG - Intronic
1011309699 6:85968418-85968440 TTTGGAAATGGGAAGGTAGGAGG - Intergenic
1011466678 6:87665265-87665287 TTTAGCAATCAGGAAGTATAAGG + Intronic
1012228209 6:96729515-96729537 TTTAGCAATGAGAATGAAGAAGG + Intergenic
1013958129 6:115864338-115864360 TTTAACTATGAGAAGATAAAAGG - Intergenic
1015255231 6:131171733-131171755 TTTAGCTGTGAGAATGGAGAGGG + Intronic
1016324692 6:142887045-142887067 TTTAGCAATGATCAACTAGAGGG - Intronic
1016887391 6:148970816-148970838 TAGAGAAATGAGATGGTAGAAGG - Intronic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1019649998 7:2151734-2151756 TTTAGCAATGAGGGGGGAAATGG + Intronic
1020383315 7:7569239-7569261 TTTAAGAATGAGGAGGAAGAGGG - Intronic
1022034734 7:26522814-26522836 TTTGGCAATGAAAAGGAATAAGG - Intergenic
1022801466 7:33780994-33781016 TTTAGCTGGGAGAAGGGAGAAGG - Intergenic
1022939846 7:35223674-35223696 TTTAGCAATGAGGAGGTCACTGG + Intronic
1027178470 7:75920445-75920467 TGTAGTAATGAGGAGGAAGATGG + Intronic
1027401568 7:77814107-77814129 ATTAGCTACAAGAAGGTAGATGG - Intronic
1028128503 7:87143324-87143346 TTTTGCAATGAGATGATAGCTGG + Intergenic
1028411546 7:90535808-90535830 TTTATAAATGAGTAGATAGAAGG - Intronic
1029403212 7:100358092-100358114 TTTTGCAATAAGAAGCCAGATGG + Intronic
1030911689 7:115257847-115257869 TTTAGCATTCAGTAGGTAAATGG + Intergenic
1031823568 7:126534111-126534133 GTCAGCAATGAGGAGGTAAATGG - Intronic
1033024524 7:137759641-137759663 TCTATCAATAAGAATGTAGAAGG - Intronic
1033249274 7:139745090-139745112 GTTAGGAATCAAAAGGTAGAAGG + Intronic
1033610466 7:142959607-142959629 TTTAGCAAAGAGAAGAAACAGGG + Intronic
1033843688 7:145405673-145405695 TATAGGAATATGAAGGTAGAGGG - Intergenic
1033991833 7:147297424-147297446 TTTAGTAATGAGAAACTATAAGG + Intronic
1037525351 8:19719037-19719059 TTTAGCAGTCAGCAGGTGGAGGG - Intronic
1037604682 8:20427575-20427597 GTTCACAATGAGAAAGTAGACGG - Intergenic
1038139451 8:24827306-24827328 CCTAACAATGAGAAGTTAGAGGG + Intergenic
1038397357 8:27257156-27257178 TGGAGCAGTGAGAAGGCAGAGGG - Intronic
1039408462 8:37332286-37332308 TTTAGCAATGAGCTGAGAGATGG - Intergenic
1041912461 8:63103393-63103415 TCTACCAATGAGAAGATAGTGGG - Intergenic
1042474840 8:69235507-69235529 TTAAGGAGTGAGAAGGTAGAGGG - Intergenic
1045496915 8:102716893-102716915 TTTAGCCATGTGAGAGTAGAAGG + Intergenic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047532117 8:125686221-125686243 TTTTGCAATGAGAATTTAAAAGG + Intergenic
1047876483 8:129143690-129143712 GTTACCAGTGAGAAGGGAGAAGG - Intergenic
1048422178 8:134288020-134288042 TGAAACAATGGGAAGGTAGATGG + Intergenic
1048550177 8:135426771-135426793 TTTAGGAATAAGAAGGAAGGAGG + Intergenic
1048736742 8:137510410-137510432 TTTATAAATGAGGAGGTTGATGG - Intergenic
1049967338 9:791531-791553 TGTAGCAATGAGAAAGGAAAAGG + Intergenic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1051250108 9:15150904-15150926 TGTAGGCATGTGAAGGTAGATGG - Intergenic
1051388005 9:16530943-16530965 TTTAGCAATGAGCCGGGAGGGGG + Intronic
1052375924 9:27717426-27717448 TTTATGAATGAGGAGGTTGAAGG - Intergenic
1052411762 9:28130342-28130364 TCTAGCTATGAGACTGTAGAAGG + Intronic
1058322594 9:103651940-103651962 TTCAGGAATGATAGGGTAGAAGG + Intergenic
1058391805 9:104503995-104504017 TTTGGCAATGTGAGGGTAGGAGG - Intergenic
1058404474 9:104656497-104656519 GTTAGCCATGAGAAGGAAGGTGG + Intergenic
1058405697 9:104671357-104671379 TTTAGCATGGAGAATGAAGAAGG + Intergenic
1059343209 9:113611345-113611367 ATTAGAAATGAGAAGGGTGAGGG + Intergenic
1059715821 9:116912410-116912432 CTTAGCACTGAGAATGAAGAAGG - Intronic
1059875842 9:118633871-118633893 TTTAGAAGTGAGAAGATAAAAGG + Intergenic
1059937296 9:119323723-119323745 TGGAGAAGTGAGAAGGTAGAAGG - Intronic
1203362161 Un_KI270442v1:225509-225531 TATAGTGGTGAGAAGGTAGATGG - Intergenic
1186307092 X:8273499-8273521 TTTAGGAATGAGAAGGTTTAAGG - Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1187030901 X:15487095-15487117 GATAACAATGAGAAGGCAGAAGG + Intronic
1188023945 X:25188766-25188788 TTTAACAATGAGAGTGTGGAGGG + Intergenic
1189960560 X:46320827-46320849 TATAGAGATGAGAAGGTAAAAGG + Intergenic
1190289683 X:48983948-48983970 TTTACCAGGGAGAAGGGAGATGG - Intronic
1195707139 X:107745445-107745467 TTTACCTATGAGAAGATACAAGG + Intronic
1195889259 X:109673586-109673608 TTTTGCAATTAGAAGCTAAAAGG + Intronic
1195957512 X:110347756-110347778 CTTAGCAATTAGAAAGTACAGGG - Intronic
1196040889 X:111202483-111202505 TTTGGCAAAGAGAAGGAACAAGG - Intronic
1199232122 X:145448292-145448314 GTTAGCACTGGGAAGGTAAAAGG + Intergenic
1201076154 Y:10190813-10190835 TGTAGTGGTGAGAAGGTAGATGG + Intergenic