ID: 1111692258

View in Genome Browser
Species Human (GRCh38)
Location 13:91579194-91579216
Sequence AGAGCCATACAGGTTTCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111692253_1111692258 20 Left 1111692253 13:91579151-91579173 CCATGATAATTGTCATGTACTGT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1111692258 13:91579194-91579216 AGAGCCATACAGGTTTCCCTCGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111692258 Original CRISPR AGAGCCATACAGGTTTCCCT CGG Intronic