ID: 1111692258 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:91579194-91579216 |
Sequence | AGAGCCATACAGGTTTCCCT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 168 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 150} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1111692253_1111692258 | 20 | Left | 1111692253 | 13:91579151-91579173 | CCATGATAATTGTCATGTACTGT | 0: 1 1: 0 2: 1 3: 11 4: 165 |
||
Right | 1111692258 | 13:91579194-91579216 | AGAGCCATACAGGTTTCCCTCGG | 0: 1 1: 0 2: 1 3: 16 4: 150 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1111692258 | Original CRISPR | AGAGCCATACAGGTTTCCCT CGG | Intronic | ||