ID: 1111695264

View in Genome Browser
Species Human (GRCh38)
Location 13:91615310-91615332
Sequence CATACTAGTTAGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111695256_1111695264 28 Left 1111695256 13:91615259-91615281 CCTAGGTAACTGGCCTTTTGTAT 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG 0: 1
1: 1
2: 0
3: 12
4: 163
1111695258_1111695264 15 Left 1111695258 13:91615272-91615294 CCTTTTGTATATGGCACAAGATA 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG 0: 1
1: 1
2: 0
3: 12
4: 163
1111695255_1111695264 29 Left 1111695255 13:91615258-91615280 CCCTAGGTAACTGGCCTTTTGTA 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG 0: 1
1: 1
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111695264 Original CRISPR CATACTAGTTAGAAGAAGGA GGG Intronic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906222405 1:44091684-44091706 CATACTTGTTAAGAGAATGAAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
913191022 1:116413138-116413160 CATACTATCTTGAAGAGGGATGG - Intergenic
916787529 1:168097225-168097247 CATAGTAGCTAGAAAAGGGATGG + Exonic
919113933 1:193257558-193257580 CATAGGAGTGAGAAGAAAGATGG + Intergenic
919653192 1:200170875-200170897 GTTTCTAGTTAGAAAAAGGAAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
924798241 1:247308548-247308570 CATTCCAGGTAGAAGAAAGAAGG - Exonic
1063196490 10:3748341-3748363 CATACTAGATTTAAAAAGGAGGG - Intergenic
1065632260 10:27692443-27692465 TATTCCAGTTAGAAGAAGGAGGG - Intronic
1068027717 10:51668658-51668680 CATACCAGTTACAAAAATGATGG - Intronic
1068390804 10:56394120-56394142 TATCCTATTTAGAAAAAGGAAGG - Intergenic
1069466777 10:68647107-68647129 CATCTTAGTTAGAATAAGAATGG - Intronic
1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG + Intronic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1072898093 10:99384516-99384538 CACACTAGTGGGAAGAAGCACGG - Intronic
1073411010 10:103341794-103341816 CATACTAATCAAAAGAAGGCTGG - Intronic
1073978162 10:109123769-109123791 TATATTAGCTAGAAGCAGGAAGG - Intergenic
1074709998 10:116169347-116169369 AATACTAGGTAGAAGATGGTGGG + Intronic
1079597057 11:22262927-22262949 CACACTAGTCAGAAGCAAGAGGG - Exonic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1082127645 11:48452139-48452161 CATACAAGCTAGAAGAGGGTGGG - Intergenic
1085501453 11:77028667-77028689 GATACTAGATAGAGGAAGAATGG + Intergenic
1086755429 11:90556350-90556372 CATACTAGTTACAAGGTTGAAGG - Intergenic
1087707954 11:101516584-101516606 CAAACTTGGTAGAATAAGGAAGG + Intronic
1092477640 12:8832536-8832558 CTTACAAGTTAGAAGCAAGATGG + Intronic
1094307743 12:29039724-29039746 CTAACCAGTTAGAAGAAGTAAGG - Intergenic
1097668543 12:62509780-62509802 CATACTAGTTAGGAGAAGGAAGG + Intronic
1098153634 12:67574216-67574238 CATATCAGTTACAAGAAGGTTGG + Intergenic
1099322237 12:81164887-81164909 TATACTAGTTAGCAGAATCATGG - Intronic
1102838185 12:116087690-116087712 CAGACCAGTAAGAGGAAGGAAGG - Intronic
1106422740 13:29596665-29596687 CCTATAAGATAGAAGAAGGATGG - Intergenic
1106756225 13:32825709-32825731 CTTAAAAGTTAGAAGAAAGATGG - Intergenic
1106883930 13:34162178-34162200 CTTCCTAGTTTGAAGGAGGAGGG - Intergenic
1107315269 13:39124797-39124819 CCTACTAGTTAGAGGTAGGAAGG - Intergenic
1108600968 13:51995022-51995044 CATATTAGTAAAAAGAAGGAAGG + Intronic
1109739269 13:66530545-66530567 GATACTAGATTGATGAAGGATGG - Intronic
1110910924 13:80962087-80962109 CATATTTGGTAGAACAAGGAAGG - Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112111834 13:96309213-96309235 CATACATTTTTGAAGAAGGAGGG + Intronic
1112892443 13:104254937-104254959 TATACAAGTTAGATGAAGAATGG + Intergenic
1116377411 14:44221195-44221217 AATAGTAGAAAGAAGAAGGAAGG + Intergenic
1120244214 14:81987365-81987387 AAGACTAGTTAGCATAAGGAAGG + Intergenic
1120806077 14:88752622-88752644 AATACTGGGTAGAAGAAGGTGGG + Intronic
1123663968 15:22592038-22592060 CACTTTAGTTAGCAGAAGGAAGG + Intergenic
1124317798 15:28686479-28686501 CACTTTAGTTAGCAGAAGGAAGG + Intergenic
1124651979 15:31480732-31480754 AATACTGTTTAGAGGAAGGATGG + Exonic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1132078540 15:98844872-98844894 CATACTCTTTAACAGAAGGAGGG - Intronic
1133937013 16:10277636-10277658 CATACTAGACAGAAGAAGAGGGG - Intergenic
1134739794 16:16532462-16532484 CAAACTGGTTAGGACAAGGATGG - Intergenic
1134927704 16:18179690-18179712 CAAACTGGTTAGGACAAGGATGG + Intergenic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1137358886 16:47794002-47794024 TAAACTAGCTAGTAGAAGGAAGG - Intergenic
1141173928 16:81707115-81707137 GATGCTGGCTAGAAGAAGGAGGG - Intronic
1151335645 17:73438116-73438138 CATATCATTTGGAAGAAGGACGG - Exonic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1153126730 18:1801470-1801492 CATACAATTTAGCAGAAGAAAGG - Intergenic
1153324895 18:3808587-3808609 CATACTACTTAGAACAGAGATGG + Intronic
1155676016 18:28429816-28429838 CACACTTGTTAGAAGGAGCATGG + Intergenic
1156515705 18:37678372-37678394 TGTACAGGTTAGAAGAAGGAGGG + Intergenic
1159773631 18:72578543-72578565 CATACTTAGTAGAAAAAGGAGGG - Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1165399388 19:35588210-35588232 CAGCCTAGTGAGAAGAAGGTGGG + Intergenic
1167011925 19:46814119-46814141 AATATTTGTTAGATGAAGGAAGG - Intergenic
926223944 2:10954430-10954452 CATACAAGTTCAAAGAAGGGAGG + Intergenic
928446577 2:31338595-31338617 AATCCTAGTTTGAAGAAGGAAGG - Intronic
928494094 2:31813816-31813838 AATACTGGGTAGAAGAAGGTGGG - Intergenic
928845199 2:35663271-35663293 CATACTAATAAGCAGAAGAATGG - Intergenic
930932798 2:56908440-56908462 CATATTAGAAAGAAGAATGAAGG + Intergenic
932533923 2:72571019-72571041 CATATTAGTTTTGAGAAGGAGGG - Intronic
932971562 2:76549501-76549523 CTTTATAGTTAGGAGAAGGAAGG + Intergenic
933104593 2:78307856-78307878 CATATAATTTAGAATAAGGAAGG - Intergenic
934705334 2:96473658-96473680 CATACTAGTTTGTAGAATGGAGG - Intergenic
936046395 2:109191406-109191428 AATACTATTTAGAAGAAAGTGGG + Intronic
938962181 2:136353769-136353791 CTTACATGTCAGAAGAAGGACGG - Intergenic
939361423 2:141177177-141177199 CATAGGAGTCACAAGAAGGAAGG + Intronic
944059748 2:195559844-195559866 CATGCTGGTTCCAAGAAGGAGGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
945247515 2:207732558-207732580 CATATTAATAGGAAGAAGGAAGG + Intronic
945272145 2:207951756-207951778 TACACTTGTTAGAAGAAAGATGG - Intronic
945773501 2:214076304-214076326 CATATTAGTTAACAGAAAGAAGG + Intronic
947145797 2:227063684-227063706 CATTCTAGTGAGAAAAAAGAAGG - Intronic
948666192 2:239536188-239536210 CTTAATAGTTACAAGAAGGCAGG - Intergenic
1169992740 20:11521768-11521790 AATACTACTTGGAAGAAAGAAGG + Intergenic
1173248024 20:41349562-41349584 CAATCCAGTAAGAAGAAGGATGG - Intronic
1173723398 20:45279608-45279630 AATAATAGTTAAAAAAAGGAAGG - Intergenic
1175467549 20:59200819-59200841 CATACTAGTTAGCAATAAGAAGG - Intronic
1176983110 21:15405624-15405646 CAAACTAGTTGGAAGGAGCATGG + Intergenic
1177899317 21:26894227-26894249 GATAGTAATTATAAGAAGGATGG + Intergenic
1178753853 21:35329004-35329026 CATATTAGTTGAATGAAGGAGGG - Intronic
1183245763 22:36692262-36692284 CATGCTTGTTAGCCGAAGGAAGG + Intronic
1184845311 22:47079948-47079970 AATACTAGTCAGTAGAAGGCTGG + Intronic
949214637 3:1551307-1551329 CTTAAGAGTTGGAAGAAGGAAGG + Intergenic
950820337 3:15750559-15750581 CCTCCTAGTTAGGAGAAGGATGG - Intronic
951173808 3:19575773-19575795 CATAATAACTAGAAGAATGATGG - Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
953522597 3:43657260-43657282 CCTACTAGTCTGAAGAAGGCAGG + Intronic
954678663 3:52329492-52329514 CAGACTAGGTTGAGGAAGGAAGG - Intronic
956699788 3:71948695-71948717 CATGCTAGTGAAGAGAAGGAGGG + Intergenic
957612698 3:82489202-82489224 CATACTATTTGGAAACAGGAAGG - Intergenic
958761111 3:98309572-98309594 CATTCTAGGTGCAAGAAGGATGG + Intergenic
959689526 3:109183307-109183329 CATACTAGTTGGGAGAAGTCAGG - Intergenic
961583814 3:127905397-127905419 TATAATAGTTCCAAGAAGGAAGG + Intergenic
964202249 3:154130962-154130984 AATACAGGTTAGAAGAGGGAAGG - Intronic
964551955 3:157894899-157894921 CATACCAGGTAGTAGAAGGAAGG + Intergenic
966009396 3:175056286-175056308 CACACTAATGATAAGAAGGAAGG - Intronic
966121256 3:176523391-176523413 CATCCTAGTGAAAAGGAGGATGG + Intergenic
966962559 3:184954490-184954512 CATACTAGTGAGATGACTGAGGG - Intronic
967951192 3:194842081-194842103 CATATTTGTTAAATGAAGGATGG + Intergenic
971695422 4:29896041-29896063 CATGCTAGTTAGAACAAAGTAGG - Intergenic
972232828 4:37095491-37095513 CAATCTAGTTTGAATAAGGAAGG - Intergenic
975081981 4:70292194-70292216 TAAACTAGATAGAAGAAGAAAGG + Intergenic
976974344 4:91148418-91148440 AATACTAATTAAATGAAGGAGGG - Intronic
978521591 4:109621199-109621221 CTTAAAAGTTAGAAGAATGAGGG - Intronic
978549855 4:109913857-109913879 CTTACAAGTTATCAGAAGGAAGG - Intronic
981798225 4:148623890-148623912 AGTAATAGTTAGCAGAAGGAAGG + Intergenic
982126295 4:152186540-152186562 CATACTAGTTCAAAGATGGTGGG - Intergenic
982831118 4:160061844-160061866 CATACCAGTTAGAATGGGGATGG - Intergenic
982872128 4:160593641-160593663 CATAGTAGTAAGATGATGGAAGG + Intergenic
984861095 4:184239502-184239524 CATACAAATCAGAAAAAGGAGGG + Intergenic
987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG + Intergenic
989566991 5:42910675-42910697 CAAACCAGTTAGAAGGAAGATGG - Intergenic
992601460 5:78404811-78404833 TCCACTTGTTAGAAGAAGGAGGG + Intronic
993509669 5:88755920-88755942 GATAATAGTCAGAGGAAGGAAGG - Intronic
994563613 5:101410822-101410844 CATTCTAGTTAGAAAAATGTAGG - Intergenic
996755495 5:126930711-126930733 CTTATTAGTGAGAAGAAGGAAGG - Intronic
997166061 5:131660998-131661020 CAAACCAGTCAGGAGAAGGAAGG - Intronic
999970436 5:156855759-156855781 CAGAGTAGTTAGGAAAAGGAAGG + Intergenic
1000871908 5:166587773-166587795 CAAACAAGTAAGAAGAGGGAAGG + Intergenic
1003811506 6:9788058-9788080 CATACTAGACAGAAGAAACATGG + Intronic
1005152531 6:22768656-22768678 AACAGTGGTTAGAAGAAGGAAGG - Intergenic
1010099784 6:72090385-72090407 CAAAATAGTTGGAAGAGGGATGG - Intronic
1011791902 6:90907623-90907645 CCTCCTAGTAAGCAGAAGGAAGG + Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1013023136 6:106240186-106240208 CATACTACTAAGAAAAAGAAGGG + Intronic
1013910532 6:115271308-115271330 CAAACTACTTAAAAGCAGGATGG - Intergenic
1022633474 7:32108671-32108693 CACACTTATTAGAACAAGGAAGG - Intronic
1026112136 7:67466569-67466591 AATACCAGAGAGAAGAAGGAAGG - Intergenic
1028478309 7:91275713-91275735 AGTCCTAGTTAGAAGAAAGAAGG + Intergenic
1028880976 7:95879791-95879813 CATACAAGTTAGAAGTTTGAGGG - Intronic
1030003718 7:105094291-105094313 AATACTAGGTAGAATAAAGATGG + Intronic
1030150466 7:106399318-106399340 CACACAAGTTAAAAGAATGAAGG - Intergenic
1032593003 7:133210228-133210250 CAGAGTAGTTACAATAAGGATGG - Intergenic
1033006981 7:137576495-137576517 TAAACAAGTTAAAAGAAGGAAGG - Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034470172 7:151250610-151250632 CATACAAGTAGGACGAAGGAAGG - Intronic
1035051327 7:156000608-156000630 CCAACCAGATAGAAGAAGGAAGG - Intergenic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1038795247 8:30703835-30703857 GAAAGAAGTTAGAAGAAGGAAGG + Intronic
1040783024 8:51133509-51133531 CATACTAAGTAAAAGAAGGCAGG + Intergenic
1040868306 8:52072919-52072941 TAAACCAGTTAGGAGAAGGAAGG + Intergenic
1040941649 8:52840048-52840070 TAGACTAGTTAGAAAAAGAAGGG - Intergenic
1042057390 8:64780281-64780303 AATATTTGTTAGAAGAATGAAGG - Intronic
1042908242 8:73796757-73796779 CATCCTATTTAGAAAAAGGATGG - Intronic
1043018416 8:74969921-74969943 CAAAGTAGTTGGAAGAAAGAGGG + Intergenic
1043653522 8:82631334-82631356 CAAACCAGTTGGAAGAAAGAAGG - Intergenic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1050882338 9:10718369-10718391 CATATTAGATAGAAGAACTAAGG + Intergenic
1055406191 9:75976142-75976164 AATACAAGTTAGAAAATGGAAGG + Intronic
1056114770 9:83431209-83431231 GAGACTAGTTAGATGAGGGAAGG - Intronic
1057125929 9:92616128-92616150 CATACTAGTTGAAAGAAGAAAGG - Exonic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058594835 9:106604585-106604607 CACAATTGTTGGAAGAAGGATGG + Intergenic
1060286118 9:122254129-122254151 CATTCTGCTTAGAAGCAGGAAGG + Intronic
1186716275 X:12255269-12255291 CACACAAGGTAGAAAAAGGAAGG + Intronic
1188177729 X:27013827-27013849 ACTACTAGATAGGAGAAGGAGGG - Intergenic
1188421477 X:29995043-29995065 CATACTTTTAAGAAGAAGGAGGG - Intergenic
1190524246 X:51311887-51311909 AATATTAGTAATAAGAAGGAAGG + Intergenic
1191925143 X:66300904-66300926 TATACTAGTTTGTAGATGGATGG + Intergenic
1193818874 X:86137693-86137715 CATTCTAGTTGGCAAAAGGAGGG + Intergenic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1194562358 X:95438314-95438336 TATCCTTGTTAGAAGAAGGGAGG + Intergenic
1194589576 X:95782426-95782448 CATACTAATCAGAAGAAAGTTGG + Intergenic
1195501586 X:105607674-105607696 CATTCCAGTTAGAAGAAACATGG + Intronic
1201688609 Y:16736432-16736454 CATACAAGCTAGAAGAAAGTGGG - Intergenic