ID: 1111703958

View in Genome Browser
Species Human (GRCh38)
Location 13:91724746-91724768
Sequence CTCTGTAAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115798
Summary {0: 2, 1: 49, 2: 1951, 3: 28559, 4: 85237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111703951_1111703958 11 Left 1111703951 13:91724712-91724734 CCAGGCATGGTGGCATGCGCCTA 0: 77
1: 1625
2: 12226
3: 41937
4: 100622
Right 1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG 0: 2
1: 49
2: 1951
3: 28559
4: 85237
1111703952_1111703958 -8 Left 1111703952 13:91724731-91724753 CCTATAGTCCAGCTACTCTGTAA 0: 1
1: 0
2: 15
3: 107
4: 699
Right 1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG 0: 2
1: 49
2: 1951
3: 28559
4: 85237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111703958 Original CRISPR CTCTGTAAGGCCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr