ID: 1111707986

View in Genome Browser
Species Human (GRCh38)
Location 13:91775327-91775349
Sequence CAGTAGAAATGGTGGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111707986_1111707991 6 Left 1111707986 13:91775327-91775349 CCATTTTACCACCATTTCTACTG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 1111707991 13:91775356-91775378 GGCCTCATTTTTCCCCCCTCTGG 0: 1
1: 0
2: 3
3: 27
4: 263
1111707986_1111707992 7 Left 1111707986 13:91775327-91775349 CCATTTTACCACCATTTCTACTG 0: 1
1: 0
2: 4
3: 30
4: 295
Right 1111707992 13:91775357-91775379 GCCTCATTTTTCCCCCCTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111707986 Original CRISPR CAGTAGAAATGGTGGTAAAA TGG (reversed) Intronic
902380460 1:16050113-16050135 CAGGAGATATGGGGGTTAAATGG - Intronic
903955913 1:27025480-27025502 GAGTAGAAATGTTGGTCATAAGG + Intergenic
905061725 1:35145491-35145513 CAGCAGACATGGAGTTAAAAAGG - Intergenic
906977351 1:50589629-50589651 CACTAGCAATGGAGTTAAAAAGG - Intronic
908731395 1:67229971-67229993 CAGTAGAAAGCCTGGCAAAATGG + Intronic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909170768 1:72291694-72291716 CAAAAGAAATGGTGCTAAAATGG - Intergenic
910828736 1:91437980-91438002 AAGTAGAAAAGGAGGAAAAAGGG - Intergenic
911414837 1:97558159-97558181 CACTAGAAAGGGGGGGAAAAAGG - Intronic
912108172 1:106306755-106306777 CAGTGGCAATGATGGTAATAAGG - Intergenic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
918245081 1:182652008-182652030 CAGTGGAAAATGTGGTAAGATGG - Intronic
918487286 1:185043492-185043514 CAGGAGAATTAGTGGAAAAACGG - Intergenic
920969207 1:210728396-210728418 CAGTAGGACAGGTGATAAAAAGG + Intronic
923592135 1:235328357-235328379 CCATAGAACTGGTGGGAAAATGG - Intronic
923734135 1:236585563-236585585 GAGAAAAAATGGTGGTAAAAAGG + Intronic
924579608 1:245312522-245312544 CATTAGCAATGGTAGGAAAATGG + Intronic
1063244377 10:4203078-4203100 CAGCAGAAATGGCTGTTAAAAGG - Intergenic
1064705515 10:18069177-18069199 CAGAAGAAATAGCGGTGAAAAGG + Intergenic
1065091000 10:22233618-22233640 CAGTAAAAATGCTGATAAATTGG + Intergenic
1066468074 10:35670734-35670756 CAGAAGAAATGGTAGTAATTGGG + Intergenic
1067122875 10:43489694-43489716 AAGTAGAAATGGAAGAAAAATGG + Intergenic
1067797262 10:49329615-49329637 CAGTGCAAATGTTTGTAAAAGGG - Intergenic
1068269095 10:54696524-54696546 CAGTAGAAATGTTTTCAAAATGG - Intronic
1068482272 10:57607127-57607149 TAGTGGAAATGGTGCTCAAAAGG + Intergenic
1071177373 10:82942098-82942120 CCCTAAAAATGGTGGTACAAAGG + Intronic
1071228858 10:83562846-83562868 CAGAAGATATGATGGGAAAAGGG + Intergenic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1072148546 10:92666023-92666045 CAGTAGGAGTGGTGGCATAAGGG - Intergenic
1072973098 10:100034449-100034471 CAGGAAAAATGGGGGGAAAAAGG - Intergenic
1073846800 10:107566665-107566687 TAATAGAAATGGAGGTAAATAGG + Intergenic
1073863265 10:107771148-107771170 CAGCAGAAATGGTGGCAGTAGGG - Intergenic
1078673603 11:13388427-13388449 CTTTATAAATGGTGGTTAAATGG - Exonic
1079256898 11:18838345-18838367 CAGTAGAAATGGTCCTATATAGG - Intergenic
1079765782 11:24390412-24390434 CAATAGTAATGGTGGTAGTATGG - Intergenic
1080164192 11:29217229-29217251 AAGTAGATATGGAGATAAAAAGG - Intergenic
1081183932 11:40019174-40019196 TAGTAGAAGTGATGGTAAATTGG - Intergenic
1084776359 11:71379415-71379437 CAGTAGAAGAGGTGGTAAAAGGG - Intergenic
1085009470 11:73128059-73128081 TTGGAGAAATGGTGGTCAAAGGG - Intronic
1085550512 11:77366019-77366041 CAGAAAAAATGGAGGTCAAAAGG + Intronic
1085764931 11:79274522-79274544 CAGATGAAATCTTGGTAAAATGG + Intronic
1086636621 11:89096824-89096846 CCGTAGAAATGCTGGCATAAAGG - Intergenic
1087716158 11:101611426-101611448 AAGCAGAAATGTTGGTCAAAGGG + Intronic
1090303224 11:125666144-125666166 CAGCAAAAATAGTGCTAAAAAGG - Intronic
1090700207 11:129287735-129287757 AATTAGAAATGGCAGTAAAATGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091067456 11:132529505-132529527 CAGTAGACATGGGGATAAACAGG - Intronic
1091884645 12:4007456-4007478 CAGAGGAAAAGGTGTTAAAATGG - Intergenic
1093672433 12:21893168-21893190 AAGTAAAAATGGTGGAAAAATGG + Intronic
1095544899 12:43354803-43354825 AAGTATAGAAGGTGGTAAAATGG + Intronic
1096571421 12:52525509-52525531 CAGTACAGAAGGTGGTAATATGG + Intergenic
1096900712 12:54878104-54878126 AAGTAGATATGGTTATAAAAGGG + Intergenic
1100318838 12:93470981-93471003 AATTACAAATGGTGGTAAATAGG - Intronic
1100578856 12:95919733-95919755 CTGTTGAAATGGTGGTGTAAGGG - Intronic
1100615350 12:96227331-96227353 CAGAAGAGATGATGGGAAAAAGG - Intronic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1101000634 12:100354078-100354100 CAGTAGAACTGTTGATAATAGGG - Intergenic
1103527283 12:121577367-121577389 CAGTAAAAATGGGGGAAGAAAGG + Intronic
1107347936 13:39482930-39482952 CAGTACAGATGCAGGTAAAATGG + Intronic
1108502971 13:51084829-51084851 CAGAGGAGATGGTGGTAAGATGG + Intergenic
1109073189 13:57795868-57795890 AAGTATTAATGATGGTAAAATGG - Intergenic
1109632569 13:65070367-65070389 CAGTACAAATCTTGATAAAAGGG + Intergenic
1110743640 13:79027126-79027148 CAAAGGAAATGTTGGTAAAAGGG - Intergenic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111381831 13:87464808-87464830 AAGTAGAACTGGTGGTTAAAAGG + Intergenic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112358865 13:98698395-98698417 TAATACAAATGGTGGTGAAATGG - Intronic
1113258558 13:108534271-108534293 ATGTAGAAATGGTGGTCCAAGGG - Intergenic
1114306304 14:21426229-21426251 CAGGAGTGATGGTGCTAAAAAGG + Exonic
1114363517 14:22002460-22002482 CAGAAAATATGGTGGGAAAAAGG + Intergenic
1114802904 14:25798505-25798527 CATTGGAAATGGTGGCAAGAGGG - Intergenic
1114864100 14:26566762-26566784 CAATAAAAATTGTGGAAAAACGG + Intronic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1116918837 14:50550887-50550909 CAGAAAAAATGGTGCTAAGAGGG + Intronic
1117027046 14:51631532-51631554 AGGTAGAGAAGGTGGTAAAAGGG + Intronic
1118191326 14:63583231-63583253 TGGTAGAAAGGGTGGTGAAATGG + Intergenic
1118648292 14:67861998-67862020 AAGGAGAGATGTTGGTAAAAGGG + Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1120035806 14:79696711-79696733 CAGTATAAATGGTGTCAAAGTGG + Intronic
1120577832 14:86206052-86206074 CAGTAAAATTTATGGTAAAATGG - Intergenic
1120764094 14:88312515-88312537 CAGTAGAAATGCTGGGGAATGGG - Intronic
1122142735 14:99672544-99672566 CATTAGACATGGTGGTAAGGTGG + Intronic
1122181276 14:99956444-99956466 AAGTAGAAATGTTGGTAATAGGG - Intergenic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1126189929 15:45868683-45868705 CACTTGGAATGGTGGTAAATGGG - Intergenic
1126233730 15:46357368-46357390 CAGCTAAAATGGTGTTAAAAGGG + Intergenic
1126748808 15:51854471-51854493 CTATGGAAATGGTGGTGAAATGG + Intronic
1126865526 15:52932831-52932853 AAGGAGAAATGATGGTAAAAGGG + Intergenic
1127869797 15:63061868-63061890 CAGTAGACATTTTAGTAAAATGG + Intronic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1130473284 15:84241935-84241957 CAGTTTAAATGCTGGGAAAAAGG + Intronic
1130480699 15:84355999-84356021 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130484897 15:84393426-84393448 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130491013 15:84431760-84431782 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130502597 15:84510559-84510581 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130595570 15:85246530-85246552 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1131026709 15:89148836-89148858 CTGAAGAAATGCTGCTAAAATGG - Intronic
1131282622 15:91033506-91033528 CAGTTTAAATGGTGAGAAAAGGG - Intergenic
1131839184 15:96417541-96417563 CCGTAGAGCTGGTGGTAAAAGGG - Intergenic
1131904220 15:97124497-97124519 CAGGAGAAATGTAGGCAAAATGG + Intergenic
1134325136 16:13200633-13200655 CAGTAGAAAAGGTGTTGATAAGG - Intronic
1135523463 16:23195286-23195308 CAGCAGCAATGGTGGTAGACTGG - Intronic
1138033177 16:53577454-53577476 CACTAGGAGTGGTGGTAAAAGGG + Intergenic
1139031325 16:62884771-62884793 CAGCAGAAGTGGTTGTAACAAGG - Intergenic
1139836889 16:69846245-69846267 CAGTAAAAATGGGTGAAAAATGG + Intronic
1140820780 16:78661097-78661119 CAGCAGAAGTGGTGGAACAAAGG + Intronic
1142827038 17:2519898-2519920 CAGTAGAAATTGTGGGAAGGAGG - Intergenic
1146065352 17:29630793-29630815 TAGAAGAAATGTTTGTAAAAGGG - Exonic
1146247506 17:31302328-31302350 CAGGAAAGAAGGTGGTAAAAAGG + Intronic
1146449068 17:32957710-32957732 CTTTAAAAATTGTGGTAAAATGG + Intergenic
1147190408 17:38735139-38735161 AAGTAGAAGAGGTGGAAAAAAGG + Exonic
1150077506 17:62205302-62205324 CATTAGAAATGGTTGCAAAATGG + Intergenic
1153082149 18:1239793-1239815 TAGAAGAAATGGTGAGAAAAAGG - Intergenic
1154529324 18:15329105-15329127 CAGTAGAAATGGTGTGAACCTGG - Intergenic
1156935266 18:42697870-42697892 CAGTTGAAAAGATGGTAACATGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157015637 18:43709382-43709404 CAGTAGAAGAGGGGGGAAAATGG + Intergenic
1157434103 18:47654009-47654031 CAGAAGAAATACTGGCAAAATGG + Intergenic
1159501249 18:69273571-69273593 CAGAAGAAGTGCTTGTAAAAAGG + Intergenic
1164961997 19:32441128-32441150 GGGTAGAAATGTTGGTGAAAAGG - Intronic
1167059615 19:47135781-47135803 AAATAGAAATTGTGGTACAAAGG - Intronic
1167117540 19:47496979-47497001 CAGTGGAAACGGTGGCAAAAAGG + Intronic
1167770857 19:51516481-51516503 AAGTATTAATGGAGGTAAAAGGG - Intergenic
927741200 2:25571195-25571217 CAGTAGTAAAGGTTGTAAAAAGG - Intronic
928024324 2:27727649-27727671 CGGAAGAGAAGGTGGTAAAAAGG + Intergenic
928871527 2:35986715-35986737 CAGTAGTAATGAAGGTATAAAGG + Intergenic
929086962 2:38177613-38177635 CAGTGGTAAGGGTGGTAAAAGGG - Intergenic
931649847 2:64457449-64457471 AAGTAGTAATGGTGTTAAAAAGG + Intronic
932663360 2:73676554-73676576 CAGTGTAAATGGAGGTAAACGGG + Intergenic
933459298 2:82560255-82560277 CCATAGAAATCATGGTAAAAAGG + Intergenic
933903134 2:86863102-86863124 AAGAAGAAATGGTGCTATAATGG - Intergenic
934088650 2:88531581-88531603 AAGTAGAATTGCTGGTAAAACGG + Intergenic
935471605 2:103466638-103466660 TATTAGAAATTGTGATAAAAAGG - Intergenic
935777380 2:106485845-106485867 AAGAAGAAATGGTGCTACAATGG + Intergenic
935812556 2:106813349-106813371 CAGTAGAAATGCTTTTTAAATGG - Intronic
937183719 2:120018953-120018975 TAGTAGAAATGCTACTAAAAAGG - Intronic
937813742 2:126227975-126227997 CAGTAGAAATCTTGGTCAATAGG - Intergenic
938828614 2:135032049-135032071 CAGCAGAAATGGTGGTATGAGGG - Intronic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939185641 2:138857439-138857461 CAGTAGTAATGGCAGAAAAATGG - Intergenic
939334113 2:140803145-140803167 CATTAGAAATGCTGATGAAAGGG - Intronic
939463029 2:142522066-142522088 CAGGTGAAATGGAGGTAAATTGG - Intergenic
941346676 2:164377570-164377592 CCACAGAAGTGGTGGTAAAAGGG + Intergenic
942423483 2:175834139-175834161 CAGTAGTACTGGTAGTAGAAAGG - Intergenic
943793000 2:191955939-191955961 CAGGAGAAAGAGTGGTAATATGG + Intronic
944028904 2:195208323-195208345 CACTAGAAATGCTGGTAAGGAGG - Intergenic
945035786 2:205702916-205702938 CAGAGGAAAGGGTGATAAAAGGG - Intronic
945141086 2:206686778-206686800 CAGGAGAGCTGGTGGTGAAAAGG - Intronic
946281099 2:218666013-218666035 CAGTGGAAGTAGTGGTAACAGGG + Exonic
946605231 2:221396980-221397002 GAGTACAAATGGTGGAAAAATGG + Intergenic
948178556 2:235962358-235962380 CAGGAGAGATGGTGGGAGAAGGG + Intronic
1169095150 20:2891160-2891182 TAGGAGAAATGGTGGAAAATAGG - Intronic
1169595217 20:7190719-7190741 CAGTAGAAGTGTTTGTAGAATGG - Intergenic
1169869739 20:10237898-10237920 CAGGAGAAATGGTGGTATGGGGG - Intronic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1178292234 21:31378603-31378625 AAGTAGAAATGGGAGTAAAATGG - Intronic
1178779896 21:35592619-35592641 CAATAGAAATGGTAGTATAGTGG - Intronic
1181138789 22:20788340-20788362 CAGTAAGAAGAGTGGTAAAAGGG + Intronic
1183049334 22:35248152-35248174 CAGTACAAAAGGTTGCAAAATGG + Intergenic
1183183079 22:36274595-36274617 CAGGAGAAATGGAGCTAAAGCGG + Intergenic
1183842035 22:40506760-40506782 CAGTGAAAATGGTGATAAATGGG - Intronic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
1184775882 22:46622475-46622497 CAGTAAAAATGGTGGTTACCGGG + Intronic
1184933667 22:47701875-47701897 CAGTATAACTTGTGGTAAAGTGG + Intergenic
950175382 3:10869851-10869873 CACCAGCAATGGCGGTAAAAAGG + Intronic
952082702 3:29779969-29779991 AAGTAATAATGGGGGTAAAAAGG + Intronic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952469163 3:33627184-33627206 CATTAGAAATGGTGCTAGAATGG - Intronic
954276770 3:49547278-49547300 CAGTAGCCAAGGTTGTAAAATGG - Intergenic
954626271 3:52023672-52023694 CAGGAGAAATGTGGGCAAAATGG - Intergenic
955559415 3:60172624-60172646 CAGAAAAAATGTTGGGAAAACGG + Intronic
957213769 3:77293820-77293842 AAGTAGAATTGATGGTTAAACGG + Intronic
957213995 3:77296034-77296056 AAGTAGAATTGATGGTTAAACGG + Intronic
957214018 3:77296245-77296267 AAGTAGAATTGATGGTTAAACGG + Intronic
960017631 3:112910633-112910655 CAGCAAAAATAGTGGTAAAAGGG + Intergenic
960163089 3:114371690-114371712 CAGCATAAATGGTGGGAGAAAGG + Intronic
960826316 3:121788918-121788940 CAGTAGAATTGTTAATAAAAAGG + Intronic
961753065 3:129108691-129108713 CAGTTGAAATAGGGCTAAAAGGG - Intronic
962297877 3:134209432-134209454 CATTAGGAATAGTGCTAAAATGG - Intronic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
964105818 3:153038553-153038575 CAGTAGATATGGTTATAACAGGG - Intergenic
965722788 3:171680135-171680157 CTGGAGAAATGGTAGAAAAATGG - Intronic
966403040 3:179565978-179566000 CAGTGGCAATGGTATTAAAAAGG + Intronic
967143374 3:186583512-186583534 CTGTAGAAATGCAGATAAAATGG - Intronic
970948679 4:21726746-21726768 CTGTATAAATGGTGGTGAACAGG - Intronic
973006987 4:45021011-45021033 AAGTTGAAATGGTGCTAAAAAGG - Intergenic
973282549 4:48374761-48374783 TAGTAGATATGGTAATAAAAGGG + Intronic
973676478 4:53268544-53268566 CAGTAGAAATGGTAGCAACTCGG + Intronic
974160559 4:58132802-58132824 CAGGAGTAATGGAGGTGAAAAGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977343237 4:95787134-95787156 CAGGAGAAATTCTGGAAAAACGG - Intergenic
977349252 4:95859920-95859942 CAAAAGCAATGATGGTAAAATGG - Intergenic
977746522 4:100555701-100555723 CAGTAGACATGGTGGCATGAAGG + Intronic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
978896290 4:113892029-113892051 TAGTAGAAATAATGGTCAAAAGG + Intergenic
979050698 4:115927962-115927984 CATTTGAAATGATAGTAAAATGG - Intergenic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
980336922 4:131487733-131487755 CACTAGATAAGGTCGTAAAAGGG - Intergenic
980398761 4:132251594-132251616 CAGTAAAAAGGGTGTTAACATGG + Intergenic
981202672 4:141999466-141999488 GAGTAGAATTGCTGGTAAAGAGG + Intergenic
981507578 4:145519771-145519793 CAGAGGAAATGCTGGTCAAAGGG - Intronic
982676867 4:158386421-158386443 GAGTAGCAATCATGGTAAAAAGG - Intronic
983539547 4:168894391-168894413 TACTAGAAAGGGAGGTAAAAAGG + Intronic
983756252 4:171340751-171340773 AAGTAGAAAGAGTGGGAAAATGG - Intergenic
983758929 4:171380698-171380720 CAATAGACATTGTGGTCAAATGG - Intergenic
988130630 5:27099497-27099519 AATAAGAAATGGTTGTAAAAGGG - Intronic
988414606 5:30930328-30930350 TAGTAGTTATGGTGGTTAAAGGG + Intergenic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
991937428 5:71815902-71815924 CAGTAGAAATGCTGGCCAAGGGG - Intergenic
992393066 5:76347205-76347227 AGGTACAAATGGGGGTAAAAAGG - Intronic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
994947889 5:106419811-106419833 CAGAAGTAATGGGGGAAAAAAGG - Intergenic
995912155 5:117200650-117200672 AAGAGGAAATGGTGGTAGAAAGG + Intergenic
996904815 5:128586304-128586326 CAGTAGCAATGGTTCTAATAAGG - Intronic
996941430 5:129010376-129010398 CAGTAGAAACATTGGCAAAAGGG + Intronic
1000960448 5:167595221-167595243 CAGAAGAAATGTCAGTAAAATGG + Intronic
1001265272 5:170269518-170269540 CAGTAGAAATGGCTGTGCAAAGG - Intronic
1001396279 5:171421222-171421244 CCGTAGAAATGAAGGAAAAAGGG + Intronic
1001942880 5:175753252-175753274 CAGTGGAAATGGTGGTTCTATGG - Intergenic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1004161497 6:13218145-13218167 CTTTAGAAATGATGGTGAAATGG + Intronic
1004396959 6:15253995-15254017 GAGAAGAAAAGGTTGTAAAAGGG + Intronic
1005296607 6:24433464-24433486 AAGTAGAAATGAGGGTATAAGGG - Intronic
1005993473 6:30917832-30917854 CAGGAAAAATGGAGGTAAACGGG - Intronic
1006960581 6:37926058-37926080 CAGTAGCAAAGGTGGCTAAATGG + Intronic
1008017489 6:46537640-46537662 AAGAAGAAATGTTGGTCAAAGGG + Intergenic
1008535042 6:52501125-52501147 CAGCAGAAACGTTGGTAAAAGGG - Exonic
1009458165 6:63880848-63880870 CAGTTGACATGATGTTAAAATGG + Intronic
1010922358 6:81698766-81698788 GAGTGGAAATGCTGGTGAAAGGG + Intronic
1011313877 6:86010194-86010216 CAGTAGAAATGAGAGTAAACAGG - Intergenic
1011337345 6:86275860-86275882 CAGTTGTAATGGTGGTAAGGTGG + Intergenic
1011674913 6:89723100-89723122 GAGAAGAAATGGGGGCAAAAAGG - Exonic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012752634 6:103183485-103183507 CAATAGAAATTGAGGTAAACAGG - Intergenic
1013923738 6:115442380-115442402 AACTAGAAATGGTAGTTAAAAGG + Intergenic
1014184034 6:118415014-118415036 AAGAAGAAATGTTGGTCAAAGGG + Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1015184518 6:130399355-130399377 CAGTAGAAAGGATGGGAAACAGG - Intronic
1015268559 6:131315356-131315378 AAGAACAAATGGTGTTAAAATGG - Intergenic
1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG + Intergenic
1016152631 6:140761548-140761570 CCTTACAAATGGTGGCAAAAGGG + Intergenic
1016624604 6:146151742-146151764 CACTGAAAATGGGGGTAAAATGG - Intronic
1017574482 6:155786924-155786946 GAATAGAAATGGGGGTAAATAGG - Intergenic
1017781980 6:157722325-157722347 CAAAAGAAATGGTGGTTAGAGGG - Intronic
1018081273 6:160261330-160261352 CCGTAGAAAGGGTGGTACACTGG - Intronic
1021541630 7:21765781-21765803 CAGTATGTATGGTGGAAAAAAGG - Intronic
1022982477 7:35617538-35617560 CAGAAGAGAAGGTGGAAAAATGG + Intergenic
1023924591 7:44657224-44657246 AAGTAGATATGGTCATAAAAGGG - Intronic
1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG + Intronic
1030604402 7:111623965-111623987 AAGTAGAAATGCTGGTTTAAAGG - Intergenic
1030689485 7:112517747-112517769 CAGCAGCAGTGGTGGTAAAGGGG + Intergenic
1030996412 7:116364092-116364114 AAATAAAAATTGTGGTAAAATGG - Intronic
1031832860 7:126648861-126648883 CAGTAAATATGGTGGGAATATGG - Intronic
1031913500 7:127541512-127541534 CAGTACATATGGAGGTAGAAGGG - Intergenic
1032261890 7:130345027-130345049 CAGTAGCAATGGAGATAAAAGGG - Exonic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033066839 7:138164133-138164155 CATTAAAAATGTTGTTAAAAGGG - Intergenic
1034178201 7:149116960-149116982 CAGTAGAAATGGTTTTAATGAGG + Intronic
1037359850 8:18061686-18061708 CAGTATAAATGGTGGTTATCTGG - Exonic
1037521564 8:19684948-19684970 CAGTAGAAAGTGTGGGAACAGGG - Intronic
1037762373 8:21750456-21750478 CAGCAGAAAGGGTGTCAAAAAGG - Intronic
1037974069 8:23197085-23197107 CAGCAGAAATGGTGGGAATAGGG - Intronic
1039485473 8:37906394-37906416 AACTAGAAATGGTGGTACAAAGG - Intergenic
1040848150 8:51867831-51867853 AAGGAGAAATGCTGGTCAAAGGG + Intronic
1041009851 8:53530963-53530985 CAGCAGAAATGTTGGAGAAATGG - Intergenic
1041512349 8:58665863-58665885 AGGAAGAAATGGTGGTAGAAAGG - Intergenic
1042405939 8:68405599-68405621 CATGTGAAATGGTGATAAAATGG - Intronic
1042729498 8:71916018-71916040 CAATAGAAATGGTGCTGAAAAGG - Intronic
1042974214 8:74447356-74447378 CAGTAGAAAAAATGGAAAAATGG - Intronic
1044496519 8:92893261-92893283 AACTAGAAATGGTAGTCAAATGG + Intronic
1046241098 8:111494657-111494679 CAGTAAAAATGATGTTAATAGGG + Intergenic
1046789824 8:118309138-118309160 CAGGAGAAAGGGTGGAAAGAGGG - Intronic
1047317158 8:123745363-123745385 AAGAAGAAATGGTGGCCAAAAGG + Intergenic
1048047887 8:130790673-130790695 CAGCATAGATGGGGGTAAAATGG - Intronic
1048128536 8:131665005-131665027 CAGAAAACATGGTGGCAAAAAGG + Intergenic
1048138409 8:131769129-131769151 GAGTAGAAATGGTGCTAAACTGG - Intergenic
1048776594 8:137953560-137953582 TAGTAAAAATGATGGTAAGAAGG + Intergenic
1050926728 9:11273187-11273209 GAGTAGAAATTATGGTAAAGGGG + Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053578544 9:39378772-39378794 CAGTAGAAAAGGTATTGAAATGG + Intergenic
1053843069 9:42206851-42206873 CAGTAGAAAAGGTATTGAAATGG + Intergenic
1054100128 9:60937577-60937599 CAGTAGAAAAGGTATTGAAATGG + Intergenic
1054121525 9:61213204-61213226 CAGTAGAAAAGGTATTGAAATGG + Intergenic
1054586217 9:66969308-66969330 CAGTAGAAAAGGTATTGAAATGG - Intergenic
1055560683 9:77518537-77518559 CAGTAGAAGTGGTTGAAAGATGG - Intronic
1057708979 9:97419822-97419844 CAGTAGACAGGGTGATATAATGG + Intronic
1058511383 9:105722332-105722354 CAGTTGACATGCTGGTGAAAGGG + Intronic
1058808628 9:108617499-108617521 CAGGAGAACTGGTTGTTAAAAGG + Intergenic
1059875443 9:118629265-118629287 CAGCAGCAGTGGTGGAAAAAGGG + Intergenic
1060124132 9:121025213-121025235 CAGTAGAAGTGGAGGTAATAGGG + Intronic
1060332832 9:122690636-122690658 CAGTAAAAGTGGTGCTAAGAGGG + Intergenic
1185944801 X:4363057-4363079 CCGGAGAACTGGTGGTGAAATGG + Intergenic
1186544086 X:10430640-10430662 CAGATGAAATGGGGGTAAACTGG + Intergenic
1188314566 X:28657422-28657444 CAGTAGATAAGCTGGTAACAGGG + Intronic
1189044840 X:37579460-37579482 GAGTAGATATGCTGGAAAAAGGG + Intronic
1189135710 X:38547220-38547242 CAGCAGAAATGGTGGTATGTTGG + Intronic
1189156200 X:38759166-38759188 AAATAGAAATTGTGGTGAAAGGG + Intergenic
1189658764 X:43276520-43276542 AATTAGAAATGTTGGAAAAAGGG - Intergenic
1190396685 X:49992273-49992295 AAGCAGTAATGGTGGGAAAATGG - Intronic
1191913572 X:66177868-66177890 CAGCAAAAGTGGTGCTAAAAGGG - Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1192829173 X:74732234-74732256 CAGTGGTAATGGTGATAGAAAGG + Intergenic
1194816126 X:98444023-98444045 CAGTAGCAGTGGTTGTAAAAGGG - Intergenic
1194909775 X:99627661-99627683 CAGTAAAAATAGTGCTTAAATGG + Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1197607790 X:128605800-128605822 CAAGTGAAATGGTAGTAAAAGGG - Intergenic
1198645661 X:138803174-138803196 GACTAGAAATGGTGGCAGAAAGG - Intronic
1199298239 X:146183308-146183330 TAGTAGTAATTGTGGTACAAAGG + Intergenic
1199453567 X:148001068-148001090 CACTAGAAAATGTGGTGAAATGG + Intronic
1199474316 X:148229080-148229102 CAGTAGTAAAGGTGGGACAAAGG - Intergenic
1201731370 Y:17207351-17207373 CCAGAGAACTGGTGGTAAAATGG + Intergenic
1202367225 Y:24173827-24173849 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1202503556 Y:25496296-25496318 CAGTTTAAATGCTGGGAAAAAGG - Intergenic