ID: 1111714350

View in Genome Browser
Species Human (GRCh38)
Location 13:91860790-91860812
Sequence TATGGTATACAGGCCGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 0, 2: 16, 3: 101, 4: 654}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111714350_1111714355 5 Left 1111714350 13:91860790-91860812 CCGTGCCCGGCCTGTATACCATA 0: 1
1: 0
2: 16
3: 101
4: 654
Right 1111714355 13:91860818-91860840 TTTATCCACTCATCTGTTGTTGG 0: 6
1: 156
2: 1568
3: 3671
4: 7402
1111714350_1111714357 14 Left 1111714350 13:91860790-91860812 CCGTGCCCGGCCTGTATACCATA 0: 1
1: 0
2: 16
3: 101
4: 654
Right 1111714357 13:91860827-91860849 TCATCTGTTGTTGGACCCTTAGG 0: 1
1: 53
2: 1019
3: 2333
4: 4002

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111714350 Original CRISPR TATGGTATACAGGCCGGGCA CGG (reversed) Intronic
900006794 1:62149-62171 AAAGTTTTACAGGCCGGGCATGG - Intergenic
900278531 1:1849689-1849711 TATTTCATACAGGCCAGGCATGG - Intronic
900283163 1:1884971-1884993 ATTGGAATACTGGCCGGGCACGG - Intronic
900969122 1:5979802-5979824 TAGAAAATACAGGCCGGGCATGG - Intronic
901355965 1:8649437-8649459 TATGGAATACAGGCTGGGCGCGG + Intronic
901408052 1:9063339-9063361 TAAAGTATACAGGCTGGGCATGG - Intronic
901805126 1:11733898-11733920 AATGAAAAACAGGCCGGGCACGG - Intergenic
902074378 1:13771439-13771461 TTAGGTATGTAGGCCGGGCACGG + Intronic
902421746 1:16286157-16286179 GATGGTATAAAGGCCAGGCATGG - Intronic
902440306 1:16425200-16425222 TCTTGTTTCCAGGCCGGGCATGG - Intronic
902601768 1:17544583-17544605 TATAATTTACAGGCTGGGCATGG - Intronic
902879972 1:19365538-19365560 GATGGAAACCAGGCCGGGCATGG + Intronic
903089744 1:20902350-20902372 TATAGTCTAGAGGCTGGGCATGG - Intronic
903172333 1:21561955-21561977 AAGTGTATACAGGCCAGGCACGG - Intronic
903234945 1:21944096-21944118 TATTGTGTGCAGGCCGGGCGCGG - Intergenic
903535728 1:24065015-24065037 TGTAGCATACAGGCAGGGCAAGG - Intronic
904015876 1:27420195-27420217 TATAGGTTACAAGCCGGGCATGG - Intronic
904153283 1:28461147-28461169 TATTGTATACTGGCCAGGCATGG + Intronic
904164642 1:28545998-28546020 AATGAGATACTGGCCGGGCATGG - Intergenic
904210059 1:28881207-28881229 TTAAGAATACAGGCCGGGCACGG - Intergenic
904367160 1:30020501-30020523 GAAGATATACAGGCCAGGCACGG - Intergenic
904689706 1:32284658-32284680 TATAGTGCACAGGCCAGGCATGG - Intronic
904736907 1:32641621-32641643 TACTTTATACAGGCCGGGCACGG + Intronic
904760816 1:32803420-32803442 TATGCTAAATAGGCCGGGCATGG - Intronic
905495078 1:38378478-38378500 AAGAGTATACAGGCAGGGCACGG + Intergenic
905611859 1:39359678-39359700 TATCGTATACAGGCCGGGCGTGG + Intronic
905619738 1:39433787-39433809 AATGGTATATTGGCCAGGCACGG + Intronic
905626922 1:39495399-39495421 TATGGATGACAGGCCAGGCAGGG - Intronic
905670014 1:39785372-39785394 TATGGATGACAGGCCAGGCAGGG + Intronic
906361197 1:45161112-45161134 TGTGGTATATAGGCCAGGCACGG - Intronic
906411124 1:45580352-45580374 TGAGGAAAACAGGCCGGGCATGG + Intergenic
906424188 1:45695957-45695979 AAAAATATACAGGCCGGGCACGG - Intronic
906496157 1:46305418-46305440 TAGGGTATTCTGGCCGGGCGCGG + Intronic
907147223 1:52246218-52246240 TACGGCATAAAGGCCAGGCATGG - Intronic
907359343 1:53902243-53902265 TATTTTAGACAGGCGGGGCAGGG - Intronic
907512290 1:54970643-54970665 AAAGGTATACCGGCCGGGCGTGG - Intergenic
908240432 1:62184502-62184524 TATGGTTTAGAAGCCGGGCACGG - Intergenic
908295467 1:62708383-62708405 TATGTAAGACAGGCCGGGCATGG + Intergenic
908352371 1:63298920-63298942 TGTGATAAAGAGGCCGGGCATGG - Intergenic
909009233 1:70314946-70314968 AAGAATATACAGGCCGGGCACGG + Intronic
909235528 1:73148482-73148504 TATGTTAAGCCGGCCGGGCATGG + Intergenic
911317057 1:96368411-96368433 GATGGTATATTGGCCGGGCATGG - Intergenic
911334243 1:96561769-96561791 TACGGCATCCAGGCCGGGCATGG - Intergenic
912275233 1:108250810-108250832 TAGTAAATACAGGCCGGGCATGG + Intergenic
912292990 1:108443539-108443561 TAGTAAATACAGGCCGGGCATGG - Intronic
912314366 1:108653304-108653326 TGTGGTATTTAGGCTGGGCATGG - Intronic
912661374 1:111533842-111533864 TATGCTGTACTGGCCGGACATGG - Intronic
914194674 1:145439568-145439590 AATGGTAAACCGGCCGGGCGCGG - Intergenic
914867314 1:151442417-151442439 TTAGGGTTACAGGCCGGGCATGG + Intronic
915514274 1:156403708-156403730 AAAGGGATTCAGGCCGGGCACGG - Intergenic
916159877 1:161898836-161898858 TACAGAATACAGGCCTGGCACGG - Intronic
916219319 1:162427985-162428007 TATATAATACAGGCCGGGCATGG + Intergenic
916413722 1:164573774-164573796 TATGCTATAAATGCTGGGCACGG - Intronic
916649863 1:166824643-166824665 AAGGGCATGCAGGCCGGGCACGG - Intergenic
916686799 1:167154936-167154958 AATGCTATACAAGCCGTGCAAGG + Intergenic
917025681 1:170638869-170638891 AATGGTATGTAGGCCAGGCACGG - Intergenic
917056015 1:170982597-170982619 TATGTTATATGGGCTGGGCATGG + Intronic
917100828 1:171443405-171443427 TAAGAAATTCAGGCCGGGCATGG - Intergenic
917415699 1:174807075-174807097 TATGCTTTACAGGCCAGGCATGG - Intronic
918862336 1:189846773-189846795 TAAGGCATATAGGCCAGGCACGG + Intergenic
920120634 1:203654272-203654294 TTTGGTAAACTGGCCGGGCACGG - Intronic
920136034 1:203770125-203770147 TAAGTTTCACAGGCCGGGCACGG + Intronic
920618587 1:207521265-207521287 AAGGCTATACAGGCCTGGCACGG - Intronic
921026020 1:211282787-211282809 TATGCAATTGAGGCCGGGCACGG - Intronic
921217231 1:212948248-212948270 TGTAGTATATAGGCCGGGCGTGG - Intergenic
921362946 1:214346740-214346762 TAAGATATACAGGCCAAGCATGG + Intergenic
921876521 1:220202650-220202672 AAGGGAATTCAGGCCGGGCATGG + Intronic
922052063 1:222001344-222001366 TAAGGTAGTAAGGCCGGGCACGG + Intergenic
923111098 1:230890823-230890845 TGTGGAAAACAGGCTGGGCATGG + Intergenic
923177111 1:231477502-231477524 TATGAGATAGAGGCCGGGCATGG + Intergenic
923532537 1:234822801-234822823 TATGGTTTCAAGGCCAGGCACGG + Intergenic
923688457 1:236170683-236170705 TTGCATATACAGGCCGGGCACGG + Intronic
924073958 1:240313675-240313697 TAGTGTATACTGCCCGGGCACGG + Intronic
924281006 1:242437404-242437426 TTTAGTTTACAGGCTGGGCATGG + Intronic
924482004 1:244444223-244444245 GATGAAATACAGGCCGGGCGCGG + Intronic
1063315850 10:5005390-5005412 CAAGGCATACAGGCCAGGCACGG + Intronic
1063682937 10:8207733-8207755 AATGGGATACAGGCTGGGCACGG - Intergenic
1064129432 10:12695786-12695808 AAAGGAATACTGGCCGGGCATGG + Intronic
1064355169 10:14610051-14610073 TATGGCATCTAGGCCGGGCACGG + Intronic
1064411761 10:15111218-15111240 AATAGTATGCAGGCCGGGCGTGG + Intronic
1064627693 10:17278287-17278309 TCTGGCACACAGGCCGGGCATGG + Intergenic
1064971064 10:21067688-21067710 AATGGAATACAGGCTAGGCACGG + Intronic
1065007085 10:21389950-21389972 TAGTGTATATAGGCCGGGCGTGG - Intergenic
1065463918 10:25999186-25999208 TATCATATAAAGGCCAGGCACGG - Intronic
1065541781 10:26777487-26777509 TTTGGTATGTGGGCCGGGCATGG + Intronic
1065778551 10:29145025-29145047 AATTGTGTAGAGGCCGGGCACGG - Intergenic
1065950974 10:30650686-30650708 TATGGGATCTTGGCCGGGCACGG - Intergenic
1065977352 10:30854027-30854049 TATCACATATAGGCCGGGCACGG + Intronic
1066165358 10:32782516-32782538 TATTGTCTTCTGGCCGGGCACGG - Intronic
1066365531 10:34772499-34772521 TGAGGAATACACGCCGGGCATGG + Intronic
1067217237 10:44313473-44313495 TATGGGATCCAGTCCGGGCGCGG + Intergenic
1067974050 10:51004171-51004193 AAATGTATACTGGCCGGGCACGG + Intronic
1068941835 10:62688228-62688250 TATAGTTTGCAGGCCAGGCACGG + Intergenic
1068947115 10:62740632-62740654 TATGCCATGCAGGCAGGGCATGG + Intergenic
1069409012 10:68133313-68133335 TCAGGTCTATAGGCCGGGCATGG - Intronic
1070252767 10:74787433-74787455 TAATATACACAGGCCGGGCATGG - Intergenic
1071348586 10:84716585-84716607 TATATTATGCAGGCCGGGCGCGG - Intergenic
1072062063 10:91822846-91822868 TATGGTATCCAGGCTGGGCATGG - Intronic
1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG + Intronic
1072583472 10:96760748-96760770 TAATGTATTCAGGCCAGGCATGG + Intergenic
1074311908 10:112329526-112329548 TATGGGATAAGGGCCAGGCACGG + Intergenic
1074597869 10:114883868-114883890 TCTTGTATATCGGCCGGGCATGG - Intronic
1076473114 10:130734040-130734062 TATGGAAAAGAGGCTGGGCACGG + Intergenic
1076659657 10:132047188-132047210 TAAGGTAAAAAGGCGGGGCAGGG + Intergenic
1077027827 11:449356-449378 TATGCTAGGCAGGCCGGGCGCGG - Intronic
1077088732 11:768139-768161 TACTGTAAACTGGCCGGGCACGG - Exonic
1077653012 11:3991459-3991481 AATGTGATACAGGCCAGGCACGG - Intronic
1077683756 11:4271722-4271744 TATGATTTTCAGGCCGGGCATGG + Intergenic
1077686286 11:4295042-4295064 TATGATTTTCAGGCCGGGCATGG - Intergenic
1077691436 11:4346229-4346251 TATGATTTTCAGGCCGGGCATGG - Intergenic
1077816129 11:5687219-5687241 TAAGGTTTACAGGCTGGGCGCGG + Intronic
1078498878 11:11849191-11849213 TGATGTATACAGGCTGGGCATGG - Intronic
1079053980 11:17189322-17189344 TCTGGTATACATGCCAGGTACGG + Intronic
1079065453 11:17287379-17287401 TATGGTATTAAGGCCGGGCGTGG + Intronic
1079505424 11:21147540-21147562 TATGAGATATAGGCTGGGCATGG + Intronic
1080375868 11:31710332-31710354 TATGAAATAAGGGCCGGGCATGG + Intronic
1080762746 11:35268384-35268406 TATAGTTTATAGGCTGGGCATGG + Intronic
1080964779 11:37201930-37201952 TAAGATTTACAGGCCGGGCACGG - Intergenic
1081143120 11:39528577-39528599 TATTTAATACAGGCCAGGCATGG + Intergenic
1081631548 11:44693102-44693124 TATGGCTTCCAGACCGGGCATGG + Intergenic
1083041265 11:59689680-59689702 AATGGTCTAGAGGCTGGGCACGG + Intergenic
1083920330 11:65778893-65778915 GGTGGTGTCCAGGCCGGGCAGGG - Exonic
1085000681 11:73031185-73031207 TAGAGAATAAAGGCCGGGCACGG + Intronic
1085051932 11:73384363-73384385 TCTGGTATACAGGCGGTGCTGGG - Intronic
1085370965 11:76005051-76005073 AATGCTAGACTGGCCGGGCATGG + Intronic
1085412676 11:76300930-76300952 GATGGTAGTGAGGCCGGGCATGG - Intergenic
1085573385 11:77579873-77579895 TATGTTAATCTGGCCGGGCATGG - Intronic
1086092295 11:83017046-83017068 TAAGGTATAGAAGCTGGGCACGG + Intronic
1086466994 11:87064590-87064612 AATGTTATAGAGGCCAGGCACGG + Intronic
1087121238 11:94576422-94576444 AATGATATAGAGGCTGGGCACGG - Intronic
1087273203 11:96133701-96133723 AATGGTTTATAGGCCAGGCATGG + Intronic
1088323842 11:108582171-108582193 AATAGTATACAGGCTGGGCGTGG + Intronic
1088332032 11:108664429-108664451 TAGGTAATAGAGGCCGGGCACGG - Intergenic
1088464349 11:110118504-110118526 TAAGAAATACAAGCCGGGCACGG + Intronic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1088977485 11:114828761-114828783 TAAAGTATAAAGGCCAGGCATGG + Intergenic
1089563634 11:119358604-119358626 GATGCTGTGCAGGCCGGGCATGG - Intronic
1090030929 11:123205479-123205501 TAAGGAATGCAGGCCGGGCACGG - Intergenic
1090542921 11:127728757-127728779 AATGATATCCAGGCCGGGCGCGG + Intergenic
1090798469 11:130155541-130155563 TATGATATGCTGGCCGGGCGTGG + Intergenic
1090800621 11:130169383-130169405 TATGTTATATAGGCCAGGCGTGG - Intronic
1090812867 11:130262427-130262449 GCTGGTTCACAGGCCGGGCATGG - Intronic
1090993176 11:131839250-131839272 TAAAATATACAGGCCAGGCATGG - Intronic
1091423191 12:361482-361504 TGGGGACTACAGGCCGGGCATGG - Intronic
1091490748 12:930674-930696 AATGGTGTAAAGGCTGGGCATGG + Intronic
1092089017 12:5788847-5788869 TATGTAATTCAGGCTGGGCATGG - Intronic
1092381087 12:7997651-7997673 TCTGACATACAGGCCGGGCGTGG - Intergenic
1092867958 12:12780872-12780894 TATAAAATTCAGGCCGGGCATGG - Intronic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1093723953 12:22481093-22481115 TTTGATACATAGGCCGGGCATGG - Intronic
1094031338 12:26014913-26014935 TATTCCATACAGGCTGGGCATGG + Intronic
1094587200 12:31788453-31788475 TATGTAATGCTGGCCGGGCACGG - Intergenic
1095091504 12:38111675-38111697 AATAGAATACAGGCCGGGCATGG - Intergenic
1096248254 12:50008984-50009006 TATAAAATTCAGGCCGGGCACGG + Intronic
1096339928 12:50789352-50789374 AATAGTAAACAGGCCAGGCATGG - Intronic
1096632430 12:52937078-52937100 AAAGAGATACAGGCCGGGCATGG + Intronic
1097240326 12:57570673-57570695 TTACATATACAGGCCGGGCACGG - Intronic
1097512277 12:60558631-60558653 TATGTTTTTCCGGCCGGGCATGG - Intergenic
1097890740 12:64774800-64774822 TATGGAAAGAAGGCCGGGCATGG + Intergenic
1098110364 12:67115204-67115226 TAAGGTATATACGCTGGGCATGG + Intergenic
1098288288 12:68931452-68931474 AATGGTATCTCGGCCGGGCACGG + Intronic
1098348471 12:69531037-69531059 TATGGTAGACAGGCTGGGCATGG + Intronic
1099205812 12:79725293-79725315 ACTGGTAAACAGGCCAGGCATGG + Intergenic
1099727027 12:86443882-86443904 TTTTGTAGACAGGCCGGGCATGG - Intronic
1100264142 12:92959718-92959740 TATGTAGTAGAGGCCGGGCACGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100377511 12:94031165-94031187 TATGGTTTAATGGCCGGGGATGG - Intergenic
1101348736 12:103908401-103908423 TATGTCATAGAGGCCAGGCATGG + Intergenic
1101597056 12:106177222-106177244 GATGGGAGACAGGCGGGGCACGG - Intergenic
1102296051 12:111737475-111737497 TATTGTAAAGAGGCTGGGCATGG - Intronic
1102345209 12:112155588-112155610 ACTGGTAAACTGGCCGGGCACGG - Intergenic
1102526895 12:113519097-113519119 TTTGGTTTCCAGGCCAGGCACGG - Intergenic
1102807390 12:115793991-115794013 AATGGTGGAAAGGCCGGGCATGG + Intergenic
1103361192 12:120355113-120355135 TATTGTATCAAGGCCGGGCGCGG + Intronic
1103457663 12:121079246-121079268 GATGATACACGGGCCGGGCAGGG + Intergenic
1103534443 12:121625224-121625246 TATAATATTCGGGCCGGGCATGG + Intergenic
1103697097 12:122824792-122824814 TGTGGTATATGGGCCAGGCATGG + Intronic
1103761457 12:123253326-123253348 TGTGAAATTCAGGCCGGGCATGG - Intronic
1104121288 12:125802627-125802649 AAAGTTAAACAGGCCGGGCACGG - Intergenic
1105526583 13:21183526-21183548 GATGGAGTAAAGGCCGGGCACGG + Intergenic
1105630129 13:22155540-22155562 TATGTAATATTGGCCGGGCACGG + Intergenic
1106223588 13:27768180-27768202 TATTGTTTCCAGGCCGGGCATGG - Intergenic
1106506210 13:30372839-30372861 TATGCTGTAGAGGCCGGGCGCGG + Intergenic
1106941985 13:34789943-34789965 TAGGGTATACTGGCTGGGCTGGG + Intergenic
1107456636 13:40561676-40561698 TATAGAATATAGGCCAGGCATGG + Intronic
1107605430 13:42050697-42050719 AATTGTATAGGGGCCGGGCATGG + Intronic
1107707906 13:43125158-43125180 TATGGTACATAGGCCAGGCATGG + Intergenic
1107867051 13:44713265-44713287 TACGGTACACAGGCTGGGCACGG + Intergenic
1107993968 13:45842636-45842658 TACGATGTACAGGCCAGGCACGG - Intronic
1108639873 13:52373004-52373026 TATGGAAGACAGGCCAGGCGCGG - Intergenic
1108833386 13:54507493-54507515 AATGCAATAAAGGCCGGGCACGG - Intergenic
1109217510 13:59606404-59606426 TAAGATATACTGGCCGGGCATGG + Intergenic
1109356467 13:61235596-61235618 AAAGGTAAAAAGGCCGGGCATGG + Intergenic
1109488053 13:63054606-63054628 TCTGATATACAGGCCAGGCGCGG - Intergenic
1110050171 13:70887079-70887101 TATGCTAAATAGGCCGGGCGCGG + Intergenic
1111579761 13:90207749-90207771 TAAATTATACAGGCCGGGCGCGG - Intergenic
1111714350 13:91860790-91860812 TATGGTATACAGGCCGGGCACGG - Intronic
1111818019 13:93178975-93178997 AATTGTCCACAGGCCGGGCATGG - Intergenic
1112271520 13:97974598-97974620 TAAGAATTACAGGCCGGGCAAGG - Intronic
1112408063 13:99138260-99138282 TTTGGTCTCCAGGCCGGGCGCGG - Intergenic
1114077515 14:19168973-19168995 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1114213472 14:20636421-20636443 TGTGCTATATTGGCCGGGCATGG + Intergenic
1114826079 14:26081650-26081672 GATAATATACAGGCCGGGCACGG - Intergenic
1114862030 14:26535665-26535687 TGTGGTACATAGGCCGGGCGTGG + Intronic
1114955945 14:27819497-27819519 AATGGAATACAGGCCAGGCGTGG + Intergenic
1115424900 14:33246700-33246722 AATAGTAGGCAGGCCGGGCATGG + Intronic
1115487627 14:33927447-33927469 CAGCGTAGACAGGCCGGGCATGG - Intronic
1116267215 14:42708117-42708139 TATTATATAATGGCCGGGCACGG - Intergenic
1116418195 14:44703861-44703883 TATGATATAAAGGCCTGGAAGGG - Intergenic
1116455778 14:45119277-45119299 TATGGTAGACTAGCCGGGCAAGG + Intronic
1116722990 14:48524649-48524671 TAAAATATACAGGCTGGGCATGG - Intergenic
1116824969 14:49664056-49664078 TATATAATTCAGGCCGGGCATGG + Intronic
1117770413 14:59128419-59128441 TATTGGCTACTGGCCGGGCACGG - Intergenic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118593349 14:67418034-67418056 CATTTTATCCAGGCCGGGCATGG - Intergenic
1119801037 14:77445247-77445269 TATGAGATACTGGCTGGGCATGG - Intronic
1119874361 14:78044920-78044942 AATGGAATATTGGCCGGGCATGG + Intergenic
1120639467 14:86992646-86992668 TTCGGTATACAGGCAGGGCATGG - Intergenic
1120883841 14:89436129-89436151 TTTGATCTACAGGCCGGGCGCGG - Intronic
1120886380 14:89455196-89455218 GATGGCATATCGGCCGGGCAGGG - Intronic
1121365118 14:93301984-93302006 TAAGGTATGCAGGCTGGGCTGGG + Intronic
1123020235 14:105394500-105394522 TAGGGTGGGCAGGCCGGGCAGGG + Intronic
1123736136 15:23185160-23185182 TGTGGTATATAGGCCGGGCACGG - Intergenic
1123786379 15:23678931-23678953 GATGGTTTCCAGGCCGGGCGCGG + Intergenic
1123906001 15:24921906-24921928 AATGCCATACAGACCGGGCACGG + Intronic
1124295857 15:28503503-28503525 TGTGGTATATAGGCCGGGCACGG + Intergenic
1125478813 15:40066098-40066120 TAGGGAATACAGGCCGGGCACGG + Intergenic
1125552926 15:40561182-40561204 AGTGGTATATTGGCCGGGCACGG + Intronic
1125582869 15:40799360-40799382 TAGAGGATACAGGCAGGGCATGG - Intronic
1125705561 15:41732436-41732458 TAAGGATAACAGGCCGGGCACGG - Intronic
1125837128 15:42762425-42762447 TGTGGTATAGCGGCCGGGCACGG + Intronic
1126715010 15:51506357-51506379 TAAGAAATACAGGCTGGGCATGG - Intronic
1127343269 15:58067806-58067828 AAAGGTATAGAGGCTGGGCACGG + Intronic
1127432361 15:58923064-58923086 CATGGAAAACAGGTCGGGCATGG + Intronic
1128173980 15:65537498-65537520 TATGTTAAATCGGCCGGGCATGG + Intronic
1128365850 15:67002074-67002096 TATGGGATACAGGCCGGGCGTGG - Intergenic
1128478476 15:68017369-68017391 TAAGGTATGCAGGCTGGGCTGGG + Intergenic
1129016968 15:72476650-72476672 CATCTTCTACAGGCCGGGCACGG - Intronic
1129535737 15:76312227-76312249 TAGGGCATACTGGCCGGGCGCGG - Intergenic
1129855736 15:78823550-78823572 AATAGAATACAGGCCAGGCACGG + Intronic
1130027785 15:80284762-80284784 TAGGGAAAACAGGCCGGGCGAGG - Intergenic
1130321074 15:82842602-82842624 TATATTGTGCAGGCCGGGCATGG - Intronic
1130391630 15:83460792-83460814 TACGGTACACAGGCCGGGTGCGG + Intronic
1130396510 15:83507296-83507318 AAGTGTACACAGGCCGGGCACGG - Intronic
1130661853 15:85837087-85837109 AATGAGATGCAGGCCGGGCACGG - Intergenic
1131170578 15:90175265-90175287 TAGGACAAACAGGCCGGGCACGG - Intronic
1131551833 15:93364014-93364036 TAAGTAATACAGACCGGGCACGG + Intergenic
1131597094 15:93809052-93809074 TACAGTATATAGGCCGGGCGTGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132446668 15:101928489-101928511 AAAGTTTTACAGGCCGGGCATGG + Intergenic
1132476565 16:142031-142053 AATGTTATGCAGGCCGGGCACGG - Intergenic
1133066506 16:3211348-3211370 AACAGTCTACAGGCCGGGCATGG + Intergenic
1133178291 16:4032799-4032821 TATATGATACAGGCTGGGCACGG - Intronic
1133541248 16:6756679-6756701 GAAGATATACAGGCCGGGCCTGG + Intronic
1134097719 16:11429762-11429784 TATTGCTTACAGGCCAGGCATGG - Intronic
1134483891 16:14641569-14641591 TATACTATAGAGGCCGGACATGG + Intronic
1134486083 16:14659532-14659554 TATACTATAGAGGCCGGACATGG - Intronic
1134505504 16:14802730-14802752 TGTGATCTTCAGGCCGGGCACGG + Intronic
1134667215 16:16027520-16027542 AATGGTATATAGGTTGGGCACGG + Intronic
1134727369 16:16430312-16430334 TGTGATCTTCAGGCCGGGCACGG + Intergenic
1134940065 16:18281543-18281565 TGTGATCTTCAGGCCGGGCACGG - Intergenic
1135300071 16:21319008-21319030 TAATATATACAGGCTGGGCACGG - Intergenic
1135406246 16:22200080-22200102 TTTGTAATATAGGCCGGGCACGG + Intergenic
1135518077 16:23151777-23151799 TATTGTTTAGAGGCCGGGCGCGG - Intergenic
1135761336 16:25140646-25140668 TAAGGTATGCAGGCTGGGCTGGG + Intronic
1136113519 16:28079854-28079876 TATCTTCTTCAGGCCGGGCACGG + Intergenic
1136427021 16:30175554-30175576 AAATGTCTACAGGCCGGGCATGG + Intergenic
1136460008 16:30404388-30404410 TATTGTATCCAGGCCGGGCGCGG + Intergenic
1136460056 16:30404695-30404717 TATTGTATCCAGGCTGGGCATGG + Intergenic
1136480456 16:30538554-30538576 TAAGAAATACAGGCCGGGCGTGG - Intronic
1137631307 16:49947694-49947716 TATATTATAGAGGCCAGGCATGG - Intergenic
1137722733 16:50637274-50637296 GAGGTTATACTGGCCGGGCACGG + Exonic
1137976007 16:53032728-53032750 GATGCTATATAGGCCAGGCACGG + Intergenic
1138252910 16:55519208-55519230 AATGGTAAAGAGGCCGGGCACGG + Intronic
1138359912 16:56419311-56419333 TAAGGGGTACAGGCCTGGCATGG - Intronic
1138811428 16:60154944-60154966 TAAGGTATTTAGGCTGGGCATGG - Intergenic
1139556464 16:67714187-67714209 TATGGTCCAGAGGCCAGGCAGGG + Intronic
1139619592 16:68126922-68126944 AATTTAATACAGGCCGGGCACGG + Intronic
1140260803 16:73377741-73377763 TATCTTATACAGGCCAGGCGCGG + Intergenic
1140614625 16:76647007-76647029 TAGGGTGTCTAGGCCGGGCATGG - Intergenic
1140725773 16:77810507-77810529 GATGATATAGAGGCCGGGCACGG + Intronic
1141124549 16:81391866-81391888 AAAGGGCTACAGGCCGGGCATGG - Intergenic
1141321998 16:83019784-83019806 AAAGGTTTACTGGCCGGGCATGG - Intronic
1141613879 16:85199245-85199267 TAAAATATACAGGCGGGGCACGG - Intergenic
1141710137 16:85694011-85694033 AATGGGGTACAGGCTGGGCATGG - Intronic
1142350838 16:89578998-89579020 TAAAATTTACAGGCCGGGCACGG + Intronic
1143222353 17:5273230-5273252 TATGGTCTGCAGGCTGGGCATGG + Intergenic
1143813291 17:9489976-9489998 TAAGCTTTATAGGCCGGGCACGG - Intronic
1143877985 17:10007332-10007354 AATGGTTTCTAGGCCGGGCACGG + Intronic
1144698944 17:17324163-17324185 TATGGAATCCAGGCCAGGCACGG - Intronic
1144929515 17:18848094-18848116 AATAAAATACAGGCCGGGCACGG - Intronic
1145254369 17:21314582-21314604 GATGGCATCCAGGCTGGGCAAGG - Exonic
1145322227 17:21773380-21773402 GATGGCATCCAGGCTGGGCAAGG + Intergenic
1145354758 17:22132559-22132581 TTTGATATACAGGCCAGGCGCGG + Intergenic
1145950822 17:28815502-28815524 GATGTAATAAAGGCCGGGCACGG - Intronic
1146138419 17:30343619-30343641 GATGGTATACAGGCAGGGCACGG - Intergenic
1146568346 17:33932411-33932433 TATAGTATAAAAGCCAGGCATGG + Intronic
1146700395 17:34953618-34953640 TATGTTATATAGGCTGGGCATGG - Intronic
1146852808 17:36238099-36238121 TATCTAATACAGGCCGGGCACGG + Intronic
1146917694 17:36688665-36688687 AAAGGTAAACAGGCCGGGCATGG - Intergenic
1147071593 17:37962615-37962637 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147083119 17:38042139-38042161 TATCTAATACAGGCCGGGCGCGG + Intronic
1147099062 17:38166112-38166134 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147198268 17:38782188-38782210 TATGGTAGAGAGGCCAGGCTGGG - Intronic
1147240929 17:39090087-39090109 AATGAGATACAGGCCAGGCATGG - Intronic
1147497438 17:40930473-40930495 TAAAATAAACAGGCCGGGCACGG + Intronic
1147525541 17:41218747-41218769 AATGGGAGACTGGCCGGGCATGG + Intronic
1147875920 17:43620344-43620366 GATGGTATTCAGGCCGGGCGTGG - Intergenic
1148116625 17:45179153-45179175 ATGGCTATACAGGCCGGGCATGG + Intergenic
1148600134 17:48887989-48888011 AATGGAATGCAGGCTGGGCACGG + Intergenic
1148941174 17:51213016-51213038 TATGCTCTTCAGGCCAGGCACGG - Intronic
1149120876 17:53162348-53162370 AATGGAAAAGAGGCCGGGCACGG - Intergenic
1149602430 17:57901881-57901903 TATGATGCACTGGCCGGGCATGG + Intronic
1149767465 17:59291247-59291269 TAATTCATACAGGCCGGGCATGG - Intergenic
1149767652 17:59292907-59292929 TATGGCTTTCTGGCCGGGCATGG - Intergenic
1149968137 17:61188818-61188840 AATGGCATACTTGCCGGGCATGG + Intronic
1150080599 17:62235155-62235177 TATCTAATACAGGCCGGGCGCGG + Intergenic
1150547424 17:66174216-66174238 AAAGATAAACAGGCCGGGCATGG - Intronic
1150554356 17:66240368-66240390 TACAGCATAGAGGCCGGGCACGG + Intronic
1150575256 17:66425050-66425072 AACAGTATACAGGCTGGGCACGG - Intronic
1150763511 17:67984916-67984938 TATGGTTTTCAGGCCAGGCGTGG - Intergenic
1151927289 17:77207740-77207762 AATGTTATCCAGGCCAGGCATGG - Intronic
1152195465 17:78915809-78915831 GATGGTTTTTAGGCCGGGCACGG - Intronic
1153033394 18:735878-735900 TAAAGATTACAGGCCGGGCATGG + Intronic
1153723370 18:7930358-7930380 TATTGTAAATAGGTCGGGCATGG - Intronic
1153865390 18:9263084-9263106 TAAGATACACTGGCCGGGCATGG - Intronic
1154051798 18:10967305-10967327 TGTGATATATAGGCCGGGCATGG - Intronic
1154167910 18:12029709-12029731 TATGGAATGGAGGCCGGGCATGG - Intronic
1154952271 18:21221943-21221965 TATGATATGAGGGCCGGGCACGG - Intergenic
1155168712 18:23251160-23251182 TATGGCATGTAGGCCGGGCACGG + Intronic
1155296200 18:24386667-24386689 AATGAAGTACAGGCCGGGCATGG + Intronic
1156549953 18:38004924-38004946 GATAGGATACAGGCCAGGCATGG - Intergenic
1158415285 18:57244909-57244931 TATGGTATCCAGGCTGGCCTCGG + Intergenic
1158611989 18:58949406-58949428 TACATTATACAGGCTGGGCACGG + Intronic
1158717551 18:59894215-59894237 TAAGGAATGCAGGCCGGACACGG + Intergenic
1158757569 18:60345049-60345071 TAAGGAATTCTGGCCGGGCATGG - Intergenic
1158977648 18:62726872-62726894 TATAAAATACTGGCCGGGCATGG - Intronic
1159030088 18:63221988-63222010 TATAGAAAAGAGGCCGGGCATGG + Intronic
1159250338 18:65867323-65867345 TTTAGAATACAGGCCGGGCACGG - Intronic
1159981232 18:74782891-74782913 TAAGGGAAATAGGCCGGGCACGG - Intronic
1160203947 18:76817719-76817741 TAAAATATACTGGCCGGGCACGG - Intronic
1160638551 19:103727-103749 AAAGTTTTACAGGCCGGGCATGG - Intergenic
1160964782 19:1742435-1742457 AATCGTTTATAGGCCGGGCACGG + Intergenic
1161921110 19:7266673-7266695 GATGATTTCCAGGCCGGGCACGG - Intronic
1161959910 19:7517432-7517454 ACAGGTATACTGGCCGGGCATGG + Intronic
1162250398 19:9437873-9437895 TATGATTTTTAGGCCGGGCATGG - Intergenic
1162264528 19:9560161-9560183 TATGTAAAACAGGCCAGGCATGG - Intergenic
1162347946 19:10131780-10131802 TAGGCTACAAAGGCCGGGCACGG + Intergenic
1162433033 19:10640793-10640815 TAGGCTCTAGAGGCCGGGCATGG + Intronic
1162499651 19:11045028-11045050 AAGGGCATACTGGCCGGGCACGG + Intronic
1163084606 19:14970419-14970441 TATAGTATAATGGCCGGGCGGGG + Intronic
1163089395 19:15008691-15008713 TATGGTATACAAGCTGGGTGCGG + Intronic
1163197158 19:15730363-15730385 AATGATATACTGGCTGGGCACGG - Intergenic
1163495537 19:17644481-17644503 AATGGAATCCAGGCTGGGCATGG - Intronic
1163515440 19:17760339-17760361 AATGGTAATCAGGCCGGGCGCGG - Intronic
1163891706 19:20022375-20022397 AATAGTTTAAAGGCCGGGCATGG + Intronic
1164177373 19:22787191-22787213 CATAGAATACTGGCCGGGCATGG + Intergenic
1164659935 19:29955252-29955274 TATGATAAGGAGGCCGGGCACGG - Intronic
1165002264 19:32774688-32774710 TATGATATACTGGCCAGGCATGG + Intronic
1165589494 19:36955106-36955128 AAAGGTTTACAGGCTGGGCATGG - Intronic
1166574543 19:43825623-43825645 AATAGTCTCCAGGCCGGGCATGG - Intronic
1166908608 19:46134028-46134050 TAGGGTATGCAGGCTGGGCTGGG + Intergenic
1167115185 19:47484988-47485010 TATGAACTATAGGCCGGGCAAGG - Intergenic
1167278993 19:48555380-48555402 TAGAGTAGATAGGCCGGGCACGG - Intronic
1167500941 19:49847461-49847483 TGTTTTATACTGGCCGGGCACGG - Intergenic
1168470314 19:56634810-56634832 TATTATTTACTGGCCGGGCACGG - Intergenic
925525873 2:4801352-4801374 GATGATATATTGGCCGGGCATGG + Intergenic
925982320 2:9186949-9186971 TATGAAATATAGGCTGGGCACGG + Intergenic
926137858 2:10349415-10349437 AATGATATAGACGCCGGGCACGG + Intronic
926716015 2:15924260-15924282 TAAGAAATAAAGGCCGGGCACGG + Intergenic
927264406 2:21128610-21128632 AAAAGAATACAGGCCGGGCATGG - Intronic
927367289 2:22313350-22313372 TATGCTTTACAGGCCTGGCTAGG + Intergenic
927573851 2:24184087-24184109 TATAGTTTACAGGCCGGGCACGG + Intronic
927595790 2:24395820-24395842 TATAGTAATCAGGCCGGGCGTGG - Intergenic
927677868 2:25120062-25120084 TAAGCTATAAAGGCTGGGCACGG + Intronic
928131372 2:28653738-28653760 TTAGGCATTCAGGCCGGGCACGG - Intergenic
928791313 2:34957922-34957944 TACAGAAAACAGGCCGGGCATGG - Intergenic
929163606 2:38858350-38858372 TGTGGTTTACTGGCCGGGCACGG - Intronic
929696240 2:44118256-44118278 AATGGAAAATAGGCCGGGCACGG - Intergenic
929850530 2:45584858-45584880 TATGGGAAAAAGGCTGGGCATGG + Intronic
929975777 2:46633126-46633148 TATGACAAACAGGCCAGGCATGG + Intergenic
930211563 2:48643987-48644009 AATTTTGTACAGGCCGGGCACGG - Intronic
930291460 2:49498497-49498519 TGGGGTGGACAGGCCGGGCACGG - Intergenic
930587009 2:53279099-53279121 TAAGACATACAGGCCAGGCACGG + Intergenic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
931192456 2:60017828-60017850 TATAGAAAACCGGCCGGGCACGG - Intergenic
931277082 2:60753562-60753584 AATAAAATACAGGCCGGGCACGG + Intergenic
931348196 2:61466132-61466154 TATATGATACAAGCCGGGCATGG + Intronic
931436188 2:62249141-62249163 TATGGTTTGCAGGCTGGGCATGG - Intergenic
931519664 2:63081991-63082013 TAAAAAATACAGGCCGGGCACGG - Intergenic
932282301 2:70504121-70504143 AAATGTATACAGGCTGGGCACGG + Intronic
932328866 2:70885614-70885636 TAGTGTATTTAGGCCGGGCACGG - Intergenic
932393984 2:71425943-71425965 TAAGAAATACAGGCCGGGCGTGG - Intronic
932677022 2:73790655-73790677 TATGTTTTAGAGGCCGGGCACGG + Intronic
932677607 2:73795552-73795574 TATGTTTTAGAGGCCGGGCACGG + Intronic
932678193 2:73800450-73800472 TATGTTTTAGAGGCCGGGCACGG + Intronic
932678779 2:73805350-73805372 TATGTTTTAGAGGCCGGGCACGG + Intronic
933125028 2:78593748-78593770 TATGGAATTTAGGGCGGGCATGG - Intergenic
933263760 2:80158617-80158639 AATGTCATACAGGCCGGGCATGG + Intronic
933358748 2:81249939-81249961 AAAGGTATTGAGGCCGGGCACGG + Intergenic
933382410 2:81566558-81566580 TATAATATGCAGGCCGGGCGCGG + Intergenic
934075683 2:88426927-88426949 GATAGAACACAGGCCGGGCATGG + Intergenic
934788243 2:97032436-97032458 CATGCAATAGAGGCCGGGCACGG + Intergenic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
935987769 2:108691126-108691148 ACTTGTATACAGGCCAGGCATGG - Intergenic
936114230 2:109689195-109689217 AATGTCATCCAGGCCGGGCACGG - Intergenic
936407867 2:112223849-112223871 TAAGGAATAAAGGCCAGGCACGG + Intronic
936704230 2:115052659-115052681 AATGGAAAACAGGCCGGGCGTGG + Intronic
937174657 2:119917441-119917463 GATGGTATACAGGCCAGGTGCGG + Intronic
938491965 2:131765777-131765799 TCTGGTAACCAGGCCAGGCACGG + Intronic
938495601 2:131796565-131796587 TCTGGTAACCAGGCCAGGCACGG - Intronic
938837497 2:135121800-135121822 AATATAATACAGGCCGGGCACGG + Intronic
939534780 2:143414641-143414663 TATGAAAAACAGGCAGGGCATGG + Intronic
940211300 2:151258850-151258872 TATGGAATGCAGGCCGGGCACGG + Intronic
940483518 2:154267347-154267369 TGTGCTTTTCAGGCCGGGCATGG + Intronic
941893534 2:170606728-170606750 AATAAAATACAGGCCGGGCACGG + Intronic
941999869 2:171635291-171635313 TATTCTATATAGGCCAGGCATGG + Intergenic
942288998 2:174451017-174451039 TATTGTGTACAAGCCAGGCACGG + Intronic
942650915 2:178166570-178166592 TACTGTATTCTGGCCGGGCACGG + Intergenic
943287182 2:186016805-186016827 TAAGGGATTCAGGCCAGGCACGG + Intergenic
943336102 2:186616566-186616588 TAAGGTATATCGGCCGGGCGCGG - Intronic
944055844 2:195521091-195521113 TAAGGTATGCAGGCTGGGCTGGG - Intergenic
944232171 2:197407312-197407334 TATGATAAAAAGGCCAGGCACGG + Intronic
944236894 2:197449097-197449119 TATGGTAGAGAGGCTGGGCACGG - Intergenic
944547514 2:200812262-200812284 TTTGTTAGCCAGGCCGGGCACGG - Intronic
945236678 2:207637857-207637879 TAGTGGATAGAGGCCGGGCATGG - Intergenic
945596497 2:211801967-211801989 ACTGGAATACAGGCCGGGCACGG + Intronic
945670623 2:212798583-212798605 TAAGAAATGCAGGCCGGGCACGG + Intergenic
946113545 2:217441328-217441350 TAAGAAATACAGGCCGGGCATGG - Intronic
946737312 2:222766841-222766863 ATTGGTTGACAGGCCGGGCATGG + Intergenic
946764313 2:223025816-223025838 TATGGGCTCCAGGCCGGGCGTGG + Intergenic
946954370 2:224912733-224912755 TATGGGCATCAGGCCGGGCATGG + Intronic
947082363 2:226412819-226412841 TAAGATATTCAGGCCGGGCGCGG + Intergenic
947179674 2:227401006-227401028 TATAGGCTTCAGGCCGGGCACGG + Intergenic
947222764 2:227809877-227809899 TGTGTTAAATAGGCCGGGCATGG + Intergenic
947652058 2:231795207-231795229 TAAGTTAAAAAGGCCGGGCACGG - Intronic
947662746 2:231882218-231882240 TTTGAAATTCAGGCCGGGCATGG - Intergenic
948475861 2:238218916-238218938 TATGGTATTGAGACTGGGCATGG + Intergenic
1169059124 20:2648386-2648408 TAAGATATACAGGCCAGGCATGG + Intergenic
1169095627 20:2896082-2896104 TATGGTCTATAGGCTGGGCACGG + Intronic
1170964233 20:21052275-21052297 TGTGGTGGACAGGCCGGGCAGGG + Intergenic
1171442345 20:25175499-25175521 TAAGATATATTGGCCGGGCATGG + Intergenic
1172069869 20:32248731-32248753 TCTGGGGTAGAGGCCGGGCATGG + Intergenic
1172347252 20:34211351-34211373 TATGGCAATGAGGCCGGGCACGG - Intronic
1172378623 20:34468498-34468520 AAAGAAATACAGGCCGGGCATGG + Intronic
1172529852 20:35622806-35622828 AATGATATATAGGCCAGGCATGG + Intergenic
1172796333 20:37541588-37541610 TTTAATATGCAGGCCGGGCATGG + Intergenic
1173371513 20:42440765-42440787 TAACTAATACAGGCCGGGCATGG - Intronic
1173758031 20:45535278-45535300 TGTGGTATGGAGGCCAGGCAGGG + Intronic
1174369076 20:50074094-50074116 AATGGTGTCTAGGCCGGGCACGG - Intergenic
1174464361 20:50705823-50705845 TATGAACTACTGGCCGGGCACGG + Intergenic
1174644619 20:52074857-52074879 TATACAATACAGGCTGGGCACGG - Intronic
1175079020 20:56402644-56402666 ATTGTTAAACAGGCCGGGCATGG + Intronic
1175269896 20:57726336-57726358 TATGGAATTCAGTCCAGGCACGG + Intergenic
1176160843 20:63647324-63647346 AGTGGTATGGAGGCCGGGCATGG + Intronic
1176615923 21:9028397-9028419 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1176709227 21:10135331-10135353 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1177392250 21:20490970-20490992 TAAGAGAAACAGGCCGGGCACGG - Intergenic
1177494240 21:21868427-21868449 GAAGGCATACTGGCCGGGCACGG - Intergenic
1177625390 21:23653324-23653346 TATTATGTACAGGCCGGGCGAGG + Intergenic
1178233959 21:30820693-30820715 TATGGCCTGCAGGCTGGGCATGG - Intergenic
1178674935 21:34623011-34623033 TATGGCAGATAGGCCGGGCACGG - Intergenic
1178866133 21:36329000-36329022 GAAAGTTTACAGGCCGGGCAGGG + Intronic
1178970815 21:37175295-37175317 TAGCATATACAGGCCGGGCACGG + Intronic
1179326251 21:40348849-40348871 TAAGAGATACAGGCCAGGCATGG + Intronic
1180281592 22:10701073-10701095 GAATGTATATAGGCCGGGCACGG + Intergenic
1180673121 22:17568849-17568871 TACTTTATACAGGCCGGGCACGG - Intronic
1181642725 22:24212534-24212556 TATAGGATGCCGGCCGGGCACGG + Intergenic
1182044202 22:27261659-27261681 AATAGTATACGGGCCGGGCATGG + Intergenic
1182339994 22:29612625-29612647 AATGTTTTACAGGCCAGGCACGG - Intronic
1182708600 22:32306173-32306195 TACTGTATATAGGCCGGGCGCGG + Intergenic
1183157647 22:36087421-36087443 TATGATTTTGAGGCCGGGCACGG + Intergenic
1183682618 22:39342219-39342241 TATAATATACAGGCCAGGCACGG - Intergenic
1183766306 22:39879170-39879192 GAAGATATACAGGCCGGGCACGG + Intronic
1183981363 22:41542372-41542394 GAAGGAATACAGGCCGGGCGTGG - Intronic
1184447804 22:44561574-44561596 AATGGTGATCAGGCCGGGCACGG + Intergenic
1184659067 22:45957391-45957413 TACAGAAAACAGGCCGGGCACGG + Intronic
1184825081 22:46944686-46944708 AATGGAGTACAGGCTGGGCACGG - Intronic
1203238834 22_KI270732v1_random:33210-33232 GAATGTATATAGGCCGGGCACGG + Intergenic
949143406 3:664119-664141 TATGATATTCTGGCCGGGCGTGG + Intergenic
949531939 3:4964816-4964838 AATGTTATATAGGCCAGGCATGG - Intergenic
949694729 3:6681226-6681248 TACTGAAAACAGGCCGGGCATGG - Intergenic
949864820 3:8538796-8538818 TACGGTTTACAGGACAGGCAGGG - Intronic
950088267 3:10276875-10276897 GATAGTGTATAGGCCGGGCACGG - Intronic
951066483 3:18272805-18272827 TATGATAACTAGGCCGGGCACGG + Intronic
952654159 3:35763871-35763893 TATTATTTTCAGGCCGGGCATGG + Intronic
953313764 3:41906702-41906724 TATGTTAAAAAGGCCGGGCACGG + Intronic
954555362 3:51513398-51513420 TACAGTATATAGGCCGGGCTTGG - Intergenic
955142278 3:56281145-56281167 TATAGAGGACAGGCCGGGCACGG + Intronic
956111128 3:65870790-65870812 AAAGATATTCAGGCCGGGCATGG + Intronic
958104010 3:89049719-89049741 TAAGGTGTTCAGGCCGGGCGCGG + Intergenic
958570126 3:95869389-95869411 TTTAGTTTACAGGCTGGGCACGG - Intergenic
960306070 3:116062216-116062238 TGTGAAATCCAGGCCGGGCATGG + Intronic
960904847 3:122590174-122590196 TATGCTTTACAGGCCGGGTGCGG - Intronic
961058756 3:123810777-123810799 TTTGGGAGACAGGCAGGGCATGG - Intronic
961260502 3:125597767-125597789 TGTGGTATGTAGGCCAGGCACGG + Intergenic
962227350 3:133625253-133625275 TATTGAATAGCGGCCGGGCACGG - Intronic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
962668146 3:137677274-137677296 TATGGGATACAGGCTGGGTGCGG + Intergenic
962856110 3:139346319-139346341 TATGGTATACAGGAGAGGTACGG - Intronic
964311983 3:155403686-155403708 GAAGGAATACAGGCCAGGCATGG - Intronic
964764505 3:160166699-160166721 AATGAAATAAAGGCCGGGCATGG + Intergenic
964815865 3:160717610-160717632 TATAGGATGCAGGCCGGACATGG + Intergenic
965120876 3:164554654-164554676 TATGGTATAGAGTACGGGCCAGG - Intergenic
965306441 3:167069935-167069957 TATACTAAGCAGGCCGGGCATGG + Intergenic
965543628 3:169893810-169893832 TGCAGTATACAGGCTGGGCACGG - Intergenic
965966760 3:174501010-174501032 TATCCAATACAGGCCGGGCATGG - Intronic
966145686 3:176809199-176809221 TAATCTGTACAGGCCGGGCAAGG - Intergenic
966521987 3:180883672-180883694 TATGAGATTCAGGCTGGGCACGG + Intronic
966604988 3:181812809-181812831 AATGGTAAACAGGCTGGGCATGG - Intergenic
966740961 3:183233058-183233080 TATGGTACATGGGCCGGGCATGG + Intronic
966905258 3:184519481-184519503 TATATTATTTAGGCCGGGCACGG + Intronic
967275112 3:187766713-187766735 AGTGGTATAAAGGCCGGGCATGG - Intergenic
967860995 3:194151570-194151592 TACAGTCTGCAGGCCGGGCACGG + Intergenic
968004333 3:195229100-195229122 TAAGAGATACAGGCCGGGCGCGG - Intronic
968915347 4:3494835-3494857 TAGGGGAGACAGGCAGGGCAGGG - Intronic
969383985 4:6830695-6830717 TAAAGAAAACAGGCCGGGCATGG - Intronic
969628735 4:8322919-8322941 TATGGAATGCAGGCCGTACAGGG + Intergenic
969648136 4:8445632-8445654 TATGGAATACAGGGTGGCCAGGG - Intronic
969925197 4:10578860-10578882 TAAGGTAAACTGGCTGGGCATGG - Intronic
970564116 4:17314700-17314722 TATACCATAGAGGCCGGGCATGG - Intergenic
970745370 4:19288414-19288436 TAAGGCATCTAGGCCGGGCATGG + Intergenic
971316962 4:25575535-25575557 TATGGTTAAGAGGCTGGGCACGG - Intergenic
971407460 4:26335468-26335490 TAATGGATGCAGGCCGGGCACGG - Intronic
971473016 4:27047441-27047463 GATGGTGCACAGGCCGGGCATGG + Intergenic
971864741 4:32154851-32154873 AATGGCATGCTGGCCGGGCACGG - Intergenic
972493341 4:39609268-39609290 TGTACAATACAGGCCGGGCACGG - Intronic
974000190 4:56504873-56504895 AGTGAAATACAGGCCGGGCACGG + Intergenic
974121441 4:57643504-57643526 TCTTGTATTCAGGCCGGGCACGG - Intergenic
974670371 4:65022442-65022464 TAAGATATATAGGCCGGGCACGG + Intergenic
975772609 4:77743890-77743912 TGTGTGTTACAGGCCGGGCATGG - Intronic
975777039 4:77798692-77798714 AAAGGTAAACAGGCCAGGCACGG + Intronic
976347150 4:84017254-84017276 TATGGTATAAAGGTAGGGCTGGG - Intergenic
977791408 4:101108473-101108495 TATGGGAATCACGCCGGGCATGG + Intronic
978340091 4:107713467-107713489 TATGAAAGACAGGCCAGGCATGG + Intronic
978564099 4:110063785-110063807 TATACCATACAGGCTGGGCACGG + Intronic
978895079 4:113876823-113876845 TCTGGTAATCAGGCCGGGCGTGG - Intergenic
979132633 4:117067345-117067367 TATAGTAGATAGGCAGGGCATGG + Intergenic
979164098 4:117504412-117504434 TATGGTAGATAGGCTGGGCGCGG + Intergenic
980058606 4:128104091-128104113 TAATGTATAAAGGCCAGGCACGG - Intronic
980237645 4:130130123-130130145 TATTGTTAACAGGCCGGGCACGG - Intergenic
980599709 4:135006385-135006407 ACTGCTATACAGGCCGGGCGCGG + Intergenic
980678022 4:136115567-136115589 TAGGGTTTCTAGGCCGGGCATGG - Intergenic
980897646 4:138875239-138875261 GATGGTCTGGAGGCCGGGCACGG + Intergenic
981025362 4:140072378-140072400 TAAAGTATACAGGCCAGGCGTGG + Intronic
982388144 4:154835457-154835479 AGTTGTAAACAGGCCGGGCATGG + Intergenic
982793328 4:159617156-159617178 TAAGGTATACAGGCTGGGCTGGG + Intergenic
983335805 4:166390664-166390686 TTTGGAAAACAGGCCGGGCGCGG + Intergenic
984270518 4:177543437-177543459 TATGTTATAAAGGCCAGGCCAGG + Intergenic
984691458 4:182731213-182731235 TAGGTTATAGAGTCCGGGCACGG + Intronic
985252684 4:188040001-188040023 TATCATATTCAGGCCGGGCGCGG - Intergenic
985316398 4:188662593-188662615 TGAGGGATACAGGCCGGGCATGG - Intergenic
986542415 5:8860392-8860414 AATAGTATAGAGGCCAGGCACGG + Intergenic
986956622 5:13158435-13158457 TATGTTATTCAGGCCGGGTGCGG - Intergenic
987405008 5:17516102-17516124 AATGTTTTACTGGCCGGGCATGG - Intergenic
987412608 5:17629834-17629856 AATGTTTTACTGGCCGGGCATGG - Intergenic
988001326 5:25353601-25353623 GAAAATATACAGGCCGGGCACGG + Intergenic
988050877 5:26029704-26029726 TATGTTATTATGGCCGGGCATGG - Intergenic
988240482 5:28601615-28601637 TACAGTATATAGGCCGGGCGCGG + Intergenic
988487633 5:31679799-31679821 TCTGATATTCAGGCCAGGCATGG - Intronic
989790406 5:45392544-45392566 TATCATATATAGGCCAGGCACGG + Intronic
990032372 5:51277604-51277626 AATGGGATATAGGCCGGGCGCGG + Intergenic
990587566 5:57227027-57227049 AAAAGAATACAGGCCGGGCACGG - Intronic
991093350 5:62713794-62713816 AATGTCAAACAGGCCGGGCATGG - Intergenic
991305648 5:65173732-65173754 TATGTAATTCAGGCCAGGCACGG + Intronic
992055323 5:72983202-72983224 TATTTTAAAAAGGCCGGGCATGG - Intronic
992802397 5:80305330-80305352 TATGAAATACAGGCCGGGCACGG - Intergenic
992810272 5:80380562-80380584 TTTTGTTTGCAGGCCGGGCATGG + Intergenic
993091074 5:83427229-83427251 AATGTTAAACAGGCCGGGCATGG + Intergenic
993338621 5:86693207-86693229 TACAGTGTACAGGCCGGGCGTGG - Intergenic
993354016 5:86883515-86883537 AATGTTAATCAGGCCGGGCATGG - Intergenic
993760443 5:91789574-91789596 TAAAGTATTCAGGCTGGGCAGGG + Intergenic
993947477 5:94132816-94132838 TGTGGCACATAGGCCGGGCATGG - Intergenic
995567293 5:113444133-113444155 AATGCTGTACAGGCCGGGCACGG - Intronic
996138076 5:119869597-119869619 TATCAAATATAGGCCGGGCACGG - Intergenic
996357425 5:122612296-122612318 GAAAGTTTACAGGCCGGGCACGG + Intergenic
996576179 5:124978630-124978652 TATGGAATATAGGTGGGGCACGG + Intergenic
997488594 5:134253357-134253379 AATGTTATATAGGCTGGGCATGG + Intergenic
997983329 5:138484278-138484300 TAAAGTGTACAGGCCGGGCGCGG + Intergenic
998301927 5:141030521-141030543 AATCAAATACAGGCCGGGCACGG - Intergenic
999397085 5:151236513-151236535 AATTGTATTCAGGCTGGGCACGG + Intronic
999420118 5:151433579-151433601 TATGTTATTCAGGCCGGGCGTGG - Intergenic
1000569395 5:162893872-162893894 CAGGATATACGGGCCGGGCACGG + Intergenic
1000945081 5:167412368-167412390 TAGGGTTAGCAGGCCGGGCAAGG + Intronic
1001582277 5:172806936-172806958 TACAGAATACAGGCCGGGCGCGG - Intergenic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1003579772 6:7329221-7329243 TATAGGATACAGGCTGGGCGCGG - Intronic
1003673021 6:8177352-8177374 TATAGAACACAGGCCAGGCATGG - Intergenic
1004420490 6:15465161-15465183 TATCGTCTATGGGCCGGGCATGG + Intronic
1004506052 6:16247663-16247685 TAAGAGATACAGGCCGGGCATGG - Intronic
1004617306 6:17303034-17303056 AATGCTATTCAGGCCGGGCACGG + Intergenic
1004657663 6:17680012-17680034 TAAGGTATGCAGGCTGGGCTGGG - Intronic
1004838587 6:19556873-19556895 TGGGATATACAGGCCGGGCGCGG + Intergenic
1004956551 6:20733856-20733878 GATTTTGTACAGGCCGGGCATGG + Intronic
1005628555 6:27686227-27686249 AAAGATGTACAGGCCGGGCACGG + Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005833523 6:29690157-29690179 AATGGTACAGAGGCCGGGCGCGG - Intergenic
1006016068 6:31081890-31081912 AATGGTTTGGAGGCCGGGCATGG + Intergenic
1006612634 6:35303704-35303726 TAAGGTGATCAGGCCGGGCAGGG + Intronic
1006704596 6:36008137-36008159 AATGGTGTTGAGGCCGGGCATGG + Intronic
1007089617 6:39174132-39174154 AATAGTAAACAGGCTGGGCATGG + Intergenic
1007463212 6:42033159-42033181 TATAATATATTGGCCGGGCATGG + Intronic
1007648540 6:43401413-43401435 AATTGTATATAGGCCAGGCACGG + Intergenic
1008607781 6:53157027-53157049 AATGGCATATTGGCCGGGCATGG + Intergenic
1008608550 6:53164860-53164882 GAAGACATACAGGCCGGGCATGG + Intergenic
1008945880 6:57096474-57096496 TAAGATAAACAGGCTGGGCACGG - Intronic
1009294745 6:61932508-61932530 GAAGTCATACAGGCCGGGCACGG + Intronic
1009612611 6:65965534-65965556 AATGGCATACAGGCCAGGCGCGG + Intergenic
1009721729 6:67480581-67480603 GATGGCTTACCGGCCGGGCATGG + Intergenic
1010241753 6:73622578-73622600 TAGAGAATTCAGGCCGGGCACGG - Intronic
1010617859 6:78034785-78034807 TATGCTGTACAGGCTGGGCGTGG - Intergenic
1010699416 6:79024512-79024534 TATGGTATAGAGGCTGGGCACGG + Intronic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011419903 6:87160076-87160098 TACTGTATACAGGCTAGGCAAGG + Intronic
1011697525 6:89925533-89925555 CATGGTATCCGGGCAGGGCAGGG - Intergenic
1012088715 6:94863963-94863985 GAAGATATACAGGCCGGGCGCGG + Intergenic
1012302943 6:97612525-97612547 TGTAGTATCCAGGCTGGGCAGGG + Intergenic
1012994518 6:105960138-105960160 TAGTGTGTACAGGCCGGGCGCGG - Intergenic
1013128229 6:107206360-107206382 TATTAGAAACAGGCCGGGCATGG - Intronic
1013223190 6:108098449-108098471 TATGTGGTATAGGCCGGGCACGG + Intronic
1014862678 6:126488716-126488738 TATGCTATATAGGCCGGGCGCGG - Intergenic
1014966370 6:127757771-127757793 TGTGATATATGGGCCGGGCATGG - Intronic
1016449292 6:144164985-144165007 TAAGCTATATAGGCTGGGCATGG - Intronic
1016920750 6:149290551-149290573 TGTGGTATTTAGGCTGGGCATGG + Intronic
1017117760 6:150995223-150995245 TATGCTTACCAGGCCGGGCACGG + Intronic
1017208921 6:151833687-151833709 TATGGTATACAGGTAAGGCAGGG + Intronic
1017454404 6:154587535-154587557 AAGGGGATACAGGCTGGGCACGG + Intergenic
1018334037 6:162765032-162765054 TTTGGTTTCCAGGCCGGGCACGG - Intronic
1019674990 7:2305652-2305674 AATACAATACAGGCCGGGCATGG - Intronic
1020018580 7:4847028-4847050 AAAGGTAAACAGGCCAGGCATGG + Intronic
1020036545 7:4966744-4966766 ACTGGTAAACAGGCCGGCCATGG + Intergenic
1020164813 7:5799538-5799560 ACTGGTAAACAGGCCGGCCATGG - Intergenic
1020192495 7:6010737-6010759 TATTGTTTAGGGGCCGGGCACGG - Intronic
1020906423 7:14069183-14069205 TATAGCATGTAGGCCGGGCACGG + Intergenic
1020955389 7:14734327-14734349 GTTGGTATAGAGGCCGGACACGG - Intronic
1021107518 7:16654827-16654849 TATAGTATACAGGCTGGGCACGG - Intronic
1021972336 7:25977783-25977805 TACCATAAACAGGCCGGGCATGG - Intergenic
1022006582 7:26271352-26271374 TAAGAAATACTGGCCGGGCATGG - Intergenic
1022402778 7:30056231-30056253 TATGTTTTGCAGGCCGGGCGTGG - Intronic
1022726712 7:32987887-32987909 TAGAGTGTACAGGCTGGGCACGG + Intronic
1023482162 7:40645668-40645690 TTTGGTATAGAAGCCTGGCAAGG + Intronic
1023786108 7:43709314-43709336 TATAGGAGATAGGCCGGGCATGG - Intronic
1023823434 7:43992926-43992948 TGTATTATACAGGCCGGACATGG - Intergenic
1025046876 7:55699746-55699768 TAGAGTGTACAGGCTGGGCACGG - Intergenic
1025665471 7:63580817-63580839 TATGGGACACAGGGCGGGTATGG + Intergenic
1025792082 7:64697968-64697990 TATGTTTTACCGGCCGGGCGCGG - Intronic
1025802377 7:64798499-64798521 TAGGGAATTCTGGCCGGGCATGG + Intronic
1026292658 7:69022189-69022211 AATGGAATACAGGCCGGGCACGG - Intergenic
1026332307 7:69363291-69363313 AATGGTTTCCAGGCCGGGCACGG - Intergenic
1026602943 7:71791717-71791739 AATGGCATTGAGGCCGGGCACGG + Intronic
1026687625 7:72524886-72524908 TAAAGAATATAGGCCGGGCATGG - Intergenic
1026722847 7:72846730-72846752 TAAAGAATATAGGCCGGGCATGG - Intergenic
1027058724 7:75068393-75068415 TCTGATATATAGGTCGGGCATGG + Intronic
1027216583 7:76187656-76187678 TATGAATTACAGGCCAGGCACGG + Intergenic
1028463531 7:91123035-91123057 AGTAGTATACAGGCCAGGCAAGG - Intronic
1028572757 7:92309634-92309656 TATTTTAAATAGGCCGGGCACGG + Intronic
1028733649 7:94181670-94181692 TATATTCTACAGGCCAGGCATGG + Intergenic
1029224851 7:99018163-99018185 TATAGAAGACGGGCCGGGCATGG - Intergenic
1029300060 7:99575246-99575268 GAAGATACACAGGCCGGGCATGG + Exonic
1029662010 7:101968711-101968733 TAGGCTCTTCAGGCCGGGCATGG - Intronic
1029724547 7:102393756-102393778 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1029751697 7:102546378-102546400 TGTATTATACAGGCCGGACATGG - Intronic
1029769650 7:102645469-102645491 TGTATTATACAGGCCGGACATGG - Intronic
1030069687 7:105688188-105688210 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1030258712 7:107540858-107540880 TATATTTTATAGGCCGGGCACGG + Intronic
1030313253 7:108088989-108089011 TATGGAATACAGGCCATACAGGG + Intronic
1030861979 7:114643099-114643121 TAAAGAATATAGGCCGGGCACGG - Intronic
1031407710 7:121406196-121406218 TATGGAAAACCGGCCAGGCACGG + Intergenic
1031512036 7:122662661-122662683 AATGGGATAAAGGCCAGGCATGG - Intronic
1032527053 7:132586458-132586480 TATGGCACTCAGGCCGGGCATGG + Intronic
1032592676 7:133206528-133206550 TTTCGTGTACAGGCCAGGCATGG - Intergenic
1032885669 7:136135759-136135781 TACGGTATTCAGGCCGGGAGCGG + Intergenic
1032941911 7:136803662-136803684 GAAGATATACAGGCCCGGCACGG + Intergenic
1033298031 7:140159053-140159075 TAAAGGATACAGGCCGGGCTTGG + Intronic
1036401808 8:8415517-8415539 TAAGGTAACCAGGCCGGGCAAGG - Intergenic
1037187997 8:16087948-16087970 TACAGTACAAAGGCCGGGCACGG - Intergenic
1038726168 8:30084242-30084264 TAGGGTTTCCAGGCCGGGCGTGG + Intergenic
1038899355 8:31825099-31825121 TATTTTATACTGGCTGGGCATGG + Intronic
1038963179 8:32544811-32544833 AGTGATAGACAGGCCGGGCATGG - Intronic
1040008024 8:42637172-42637194 TATTGTATTCAGGCTGGGCGCGG + Intergenic
1041370358 8:57153102-57153124 TATATGATACAGGCCGGGCGCGG - Intergenic
1041479335 8:58300399-58300421 TAAGGTATGCAGGCTGGGCTGGG - Intergenic
1041511164 8:58656534-58656556 TTTAGTATAAGGGCCGGGCACGG + Intronic
1042006396 8:64184454-64184476 TATGTTTTGCAGGCTGGGCATGG - Intergenic
1043056110 8:75441533-75441555 TGTGTTATAAAGGCCGGGCATGG - Intronic
1043962941 8:86438088-86438110 TACAGTATACAGGCCGGGTGTGG - Intronic
1044234459 8:89814462-89814484 TATATTATAAAGGCCAGGCATGG + Intergenic
1044663508 8:94613656-94613678 AATGGAATACTGGCCGGGCACGG + Intergenic
1044886853 8:96788448-96788470 AATGGAGTCCAGGCCGGGCATGG - Intronic
1044975073 8:97656589-97656611 TATGCTTAATAGGCCGGGCACGG - Intronic
1045001340 8:97880871-97880893 TAAGATTTTCAGGCCGGGCATGG - Intronic
1045127599 8:99109667-99109689 TAAGCTATTCAGGCCAGGCATGG - Intronic
1045317407 8:101055039-101055061 TTTAATATACAGGCCAGGCATGG + Intergenic
1045352029 8:101350665-101350687 GATGGGACCCAGGCCGGGCATGG + Intergenic
1045970530 8:108075188-108075210 TATGGGTTACCAGCCGGGCACGG + Intronic
1046659308 8:116932019-116932041 AATGCTATGCAGGCCGGGCGTGG - Intergenic
1046834735 8:118787898-118787920 TATGGTATTGAGGCAGGCCAGGG - Intergenic
1047006021 8:120621248-120621270 GAGGGAATAAAGGCCGGGCATGG - Intronic
1047136560 8:122085483-122085505 TAGCACATACAGGCCGGGCATGG + Intergenic
1047254538 8:123205852-123205874 TCTGGGAAACAGGCCGGGCGCGG + Intronic
1047320899 8:123781773-123781795 AATAGGATGCAGGCCGGGCATGG - Intronic
1047768702 8:128012770-128012792 TATGGTATACAGCCAGGACTAGG - Intergenic
1047948844 8:129910946-129910968 AATGGGAGAGAGGCCGGGCAAGG - Intronic
1049176993 8:141199450-141199472 TATGGGATGCAGGCCACGCATGG + Intergenic
1049737242 8:144215579-144215601 AATGAAACACAGGCCGGGCATGG + Intronic
1050520908 9:6498736-6498758 TAGGGTATACAGGCAGTGAAGGG - Intronic
1050591839 9:7168772-7168794 AAGAGTAAACAGGCCGGGCATGG + Intergenic
1050719078 9:8564406-8564428 GTTGATATTCAGGCCGGGCACGG + Intronic
1051071477 9:13173410-13173432 ATTGGTAAGCAGGCCGGGCAGGG + Intronic
1051676849 9:19567254-19567276 TAAGGAATATGGGCCGGGCACGG + Intronic
1051877765 9:21809347-21809369 TATGGTCTAGGGGCCGGGCGCGG + Intronic
1052574661 9:30277196-30277218 TCTGAAATACAGGCAGGGCATGG + Intergenic
1052682834 9:31716285-31716307 TGTGGAATAGAGGCCTGGCATGG + Intergenic
1053544996 9:39013752-39013774 TAAGGTATACAGGCCTGGCGCGG - Intergenic
1053646197 9:40120859-40120881 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1053759519 9:41342681-41342703 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1054327209 9:63718756-63718778 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1054538373 9:66255117-66255139 TCTGGTAACCAGGCCAGGCACGG - Intergenic
1055519110 9:77062180-77062202 TTTACTATAGAGGCCGGGCACGG - Intergenic
1055532860 9:77203897-77203919 GATAGTTTAGAGGCCGGGCAGGG + Intronic
1055537215 9:77261187-77261209 AAAAGAATACAGGCCGGGCACGG - Intronic
1056205846 9:84318576-84318598 TATGGTTTCCAGGCCGGGCGTGG + Intronic
1056428710 9:86505396-86505418 TATAGTTTACAGGCCGGGCACGG + Intergenic
1056717992 9:89048969-89048991 AATGATATGCCGGCCGGGCACGG + Intronic
1056772737 9:89491771-89491793 CATTGTCTCCAGGCCGGGCAGGG - Intronic
1057041537 9:91851684-91851706 TAGGGTTTTCTGGCCGGGCATGG + Intronic
1057836986 9:98453314-98453336 AAGGGCATAGAGGCCGGGCATGG - Intronic
1058047741 9:100375134-100375156 TCTGGTTAACAGGCTGGGCACGG + Intergenic
1059174143 9:112153902-112153924 TATAGTACATAGGCCAGGCATGG - Intronic
1059307465 9:113366093-113366115 TCTGTGATACAGGCTGGGCATGG - Intronic
1059481870 9:114597278-114597300 TCTGCTATATAGGCCGGGCGCGG - Intronic
1059549677 9:115216481-115216503 TATGGTACATAGGCTGGGGAAGG - Intronic
1059744527 9:117187219-117187241 TATTTTATACAGGCTGGTCAGGG + Intronic
1061124306 9:128664240-128664262 TATGCTAAACAGGCTGGGCGTGG - Intergenic
1061321192 9:129830798-129830820 TATGGGGGACAGGCCAGGCACGG - Intronic
1061545724 9:131303039-131303061 TATGCTCCAAAGGCCGGGCACGG + Intronic
1062626376 9:137444491-137444513 TAAAGTCTTCAGGCCGGGCATGG + Intergenic
1202793987 9_KI270719v1_random:104301-104323 TCTGGTAACCAGGCCAGGCACGG + Intergenic
1185879614 X:3729475-3729497 GATGGAATTGAGGCCGGGCACGG + Intergenic
1186141521 X:6579370-6579392 TATAAAGTACAGGCCGGGCATGG - Intergenic
1186399152 X:9240924-9240946 TAAAGAATGCAGGCCGGGCATGG - Intergenic
1186538991 X:10380904-10380926 TATGTTATACAAGGCTGGCAGGG - Intergenic
1186758223 X:12695691-12695713 TAAGAGTTACAGGCCGGGCACGG - Intronic
1188048452 X:25454948-25454970 TATTGTCTTCAGGCCAGGCATGG - Intergenic
1188345343 X:29057717-29057739 TAGGCTAAACAGGCCGCGCACGG - Intronic
1188586228 X:31778857-31778879 TAAGATAAATAGGCCGGGCATGG - Intronic
1189407478 X:40737652-40737674 AATGAAATTCAGGCCGGGCATGG - Intergenic
1189802774 X:44707248-44707270 AATGTGATTCAGGCCGGGCATGG - Intergenic
1190047226 X:47122263-47122285 TATGGTAAATTGGCCAGGCAAGG - Intergenic
1190204538 X:48392423-48392445 TATGGGAAATTGGCCGGGCATGG - Intronic
1190205998 X:48402980-48403002 TATGGGAAATTGGCCGGGCATGG + Intronic
1190687173 X:52885588-52885610 TATATTATATAGGCCGGGCATGG - Intergenic
1190698809 X:52970204-52970226 TATATTATATAGGCCGGGCATGG + Intronic
1191775168 X:64805966-64805988 TATGGAAGACAGGCTGGGCCAGG + Intergenic
1192222360 X:69206125-69206147 CCTGGTAAACAGGCAGGGCAAGG + Intergenic
1192489448 X:71562171-71562193 TCTGAAATACAGGCCGGGTATGG + Intronic
1192548387 X:72032566-72032588 AATGTTATGTAGGCCGGGCATGG + Intergenic
1193118956 X:77803320-77803342 CATAGTAAACAGGCTGGGCATGG - Intergenic
1193369121 X:80672316-80672338 AAGGGTATATAGGCCGGGCACGG + Exonic
1193441506 X:81544805-81544827 AAAGGTAAACAGGCCTGGCATGG - Intergenic
1194488398 X:94515290-94515312 TGTGGTATGGAGGCAGGGCAAGG + Intergenic
1194672998 X:96757205-96757227 GAAGATATACAGGCCAGGCACGG - Intronic
1195056833 X:101154275-101154297 TAAAGAATCCAGGCCGGGCATGG + Intronic
1196209474 X:112979760-112979782 TATGTGATATAGGCCGGGCGCGG - Intergenic
1196696648 X:118620104-118620126 TACAGTAAATAGGCCGGGCATGG - Intronic
1197399112 X:125966794-125966816 GAAGACATACAGGCCGGGCATGG - Intergenic
1197889587 X:131255942-131255964 TCTGGAATACACGCCGGGCGTGG + Intergenic
1198153724 X:133936285-133936307 TATGAGACTCAGGCCGGGCAAGG - Intronic
1198539395 X:137620750-137620772 TATTGTATATTGGCCGGGCATGG - Intergenic
1198735572 X:139781421-139781443 TAAAGTATGCAGGCCAGGCACGG + Intronic
1200086371 X:153609138-153609160 TAAAGTATACATGCCAGGCATGG - Intergenic
1200669887 Y:6075944-6075966 ACTGGTAGACAGGCCGGGCGCGG + Intergenic