ID: 1111716292

View in Genome Browser
Species Human (GRCh38)
Location 13:91883623-91883645
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 2, 2: 25, 3: 137, 4: 676}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900653090 1:3740749-3740771 TAACTGAAGCAGTGGGCGGAGGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
904348524 1:29889932-29889954 TAGCTAAAGCAGAGCCAGGGTGG + Intergenic
904413375 1:30339194-30339216 TTTCTGAAGCAAAGTGAGGTGGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904547403 1:31286482-31286504 GAGCCGTAGCAGAGTGATGAGGG - Intronic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905078441 1:35295399-35295421 TAGCTGAACATGAGTGAGCAAGG + Intronic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907241090 1:53081494-53081516 TAGCTGAAGCACAGAGAGTGAGG + Intronic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907530272 1:55088656-55088678 CAGCTGAGGCAGAGTGAAGGAGG + Intronic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
909695361 1:78462565-78462587 TAGCTAAAGCAGTGTTAAGAGGG - Intronic
910300817 1:85705555-85705577 TAACTGAAGCATAGTGAGTGAGG - Intronic
910672092 1:89783771-89783793 TAGCTGAAGTGGAGTGAACAAGG + Intronic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911212139 1:95153351-95153373 TAACTGAAACAAAGTTAGGAAGG + Intronic
911234731 1:95399952-95399974 GAGGTCAAGCAGAGTGAAGAGGG + Intergenic
911504289 1:98729270-98729292 TAGCTAAAGCAGTGTTAAGAGGG + Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
914679647 1:149930061-149930083 TAGTTGAAGCCTAATGAGGAGGG - Intronic
915639533 1:157213244-157213266 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
916195714 1:162220291-162220313 TAGCTGAATCAAAATGAGGGAGG - Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917305543 1:173620442-173620464 CAGCTAAAGCAGAGTTAAGAGGG + Intronic
917953311 1:180064178-180064200 AAGCCCAAGCACAGTGAGGATGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918975060 1:191473375-191473397 TAGCTAAAGCAGTGTGTAGAGGG + Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920384442 1:205559155-205559177 TAGTTGAATAAGAGTGATGAGGG - Intergenic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
920727003 1:208445699-208445721 TAGCTGTAGCAGTGTGGAGAGGG + Intergenic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921004001 1:211075077-211075099 TAGCCGAATAAGAGTGAGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921190532 1:212704200-212704222 TGGCTGGAGTGGAGTGAGGAAGG + Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922950467 1:229554813-229554835 TTCCTGAAGCCCAGTGAGGATGG - Intronic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
923605123 1:235436481-235436503 TAGCTGAAGTATAGTGTGGGGGG - Intronic
924412671 1:243822267-243822289 TAGCTAAAGCAGTGTTAAGAGGG + Intronic
924876327 1:248108717-248108739 TAGCTGAAGCAGTGTTTAGAGGG - Intergenic
1063572374 10:7228144-7228166 TATCTGAAGCCAGGTGAGGAAGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070365491 10:75732887-75732909 GAGCTGAAAAAGATTGAGGAGGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070686551 10:78488867-78488889 TAGCTTAAAAAAAGTGAGGAGGG + Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1072426623 10:95335891-95335913 TAGCTGACCCAGAGAGAAGATGG + Intronic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1073064264 10:100749042-100749064 TATCTGAAGTAGAGCAAGGAAGG - Intronic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073241006 10:102058179-102058201 TAGCCGAAGCAGAGAGAGAGGGG - Intergenic
1073451148 10:103610132-103610154 GAGCTGAGGCAGAGTGAGTGAGG + Intronic
1073713300 10:106071154-106071176 TAGCTGAAGCAGACTAAGACAGG - Intergenic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1077211685 11:1374035-1374057 TAACCGGAGCGGAGTGAGGAGGG - Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078916633 11:15784398-15784420 CAGCTGAATGAGAGTTAGGAGGG - Intergenic
1079445681 11:20554441-20554463 TGGCTGAAGCAAAGGAAGGAAGG - Intergenic
1079478206 11:20853888-20853910 TAACTGAGGCAGAGTGGGGAAGG + Intronic
1080214976 11:29830033-29830055 TAGCTAAAGCAGTGTGAAGAGGG + Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080549724 11:33362215-33362237 TAGATGAAGCAGACTGAGTGGGG + Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086525410 11:87719629-87719651 TACCTAAAACAGAGGGAGGAGGG + Intergenic
1086592548 11:88533238-88533260 TAGATGAAGCAATGTGAGCAAGG - Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1087436136 11:98119973-98119995 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088953610 11:114595842-114595864 TAGCTCAAGCAGAGGTAGGAAGG + Intergenic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1091033137 11:132209451-132209473 TATCTGAAGCTCAATGAGGATGG + Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091688748 12:2581778-2581800 TACCTGAAACACAGTGAGGAGGG - Exonic
1091938253 12:4450651-4450673 TGGCTGGAGCATAGTAAGGAGGG - Intergenic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092570668 12:9717952-9717974 TAGCTTAAGCAGAGTTTAGAGGG - Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094006510 12:25758213-25758235 TATGTGATGCAGAGTGGGGAAGG + Intergenic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096670610 12:53196284-53196306 AAGCTGACTCAGAGTGAGGCTGG - Intronic
1097805851 12:63964089-63964111 TAGCTGAAGCTGGGTGCTGAAGG - Intronic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1099809188 12:87559149-87559171 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1100232017 12:92618366-92618388 TCCCTGAAGGAGAGTGATGAAGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102015135 12:109643223-109643245 AAGCTGAGGGAGAGTGAGTAAGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102378906 12:112446555-112446577 TAGCAGAAGAGGAGTAAGGAGGG + Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1103007954 12:117436769-117436791 TGGATGAGGCAGCGTGAGGAAGG - Intronic
1103033117 12:117633956-117633978 TATGTGAAGCAGAGTCAGGCAGG - Intronic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104215192 12:126727230-126727252 TAACTGAACTAGAGTGAGGGAGG - Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104872196 12:132007899-132007921 TAGCTTAAGGAGAGAGAGGCAGG + Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107352489 13:39530337-39530359 GAACTGAAACAGAGTGCGGAGGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108160692 13:47635297-47635319 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1108730139 13:53226584-53226606 TAGGTGTAGAAGAGAGAGGAAGG - Intergenic
1109622350 13:64926019-64926041 TAGCTGCAGCAGAGAGGCGAGGG - Intergenic
1110878541 13:80541082-80541104 TAGCTAAAGCAGTGTGTAGAGGG - Intergenic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113384051 13:109831839-109831861 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114862666 14:26544437-26544459 TAGGTGATGCACAGTGAGGAGGG + Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115854361 14:37614098-37614120 TAGCTGAAGCAGTGTTTAGAAGG - Intronic
1116301665 14:43191030-43191052 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117440562 14:55755278-55755300 TAGCTGAGGCAGAGATAGTAGGG - Intergenic
1117829515 14:59736030-59736052 TAGCTAAAGCAGTGTTAAGAGGG + Intronic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1118589375 14:67389982-67390004 TGACTGAAGCTCAGTGAGGAAGG + Intronic
1118742837 14:68753028-68753050 ACCCTGAAGCAGAGTGAGGCTGG - Intergenic
1118849290 14:69572223-69572245 AACCTGAAGCAACGTGAGGAAGG - Exonic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118966853 14:70595124-70595146 TAGCTGAAGCCGAGTGACACTGG - Intronic
1119457536 14:74769382-74769404 TAGCTGAGGCAGGCTGAGGCAGG - Intronic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120962626 14:90139400-90139422 TAGCTAAGGCACAGTGAGCAAGG + Intronic
1121143184 14:91559574-91559596 TAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1121409238 14:93737833-93737855 TAGCTCATGCCGAGGGAGGATGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124197215 15:27642095-27642117 TAGCTAAAGCAGAGCTAAGAAGG + Intergenic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1125360394 15:38858540-38858562 TAGCTAAAGGTGAGTGTGGAAGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126318843 15:47400041-47400063 TAGCTTAAGGATGGTGAGGAGGG - Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128105763 15:65043569-65043591 TAGCTGAATCATAGTGATGAGGG - Intergenic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1130078512 15:80710623-80710645 TTGCTGATGCAGAGTGGTGAAGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131442233 15:92467757-92467779 TTGCTGATGGAGAGTGCGGAGGG - Exonic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1131998334 15:98154966-98154988 TGGCTGTAGCACAATGAGGAGGG + Intergenic
1132143036 15:99410392-99410414 TACCTGATGCAGAGTGGTGATGG - Intergenic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134075797 16:11290485-11290507 TGGCTGGAGCAGAGAGAGGTGGG + Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134902891 16:17954544-17954566 TAGCTGAGCCAGAGTGAGTTGGG + Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135262765 16:20995681-20995703 TAGCTGAATCAGAATGGAGAAGG - Intronic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136368415 16:29820632-29820654 TGTCTGAATCAGAGTGGGGAAGG + Intronic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138525464 16:57603575-57603597 AAGCTGAAGAAGTGTGAGAAGGG + Intergenic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139617846 16:68110805-68110827 TAGCTAAAGCAGTGTTAAGAGGG - Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141412127 16:83842560-83842582 TTGCTGAAACAAAGTAAGGAGGG - Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142721137 17:1776691-1776713 AAGCTGAAGCTGAGTTATGAAGG + Exonic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143423119 17:6811745-6811767 AAGCTGAAACAGAGAGGGGAAGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144506610 17:15836895-15836917 TAGCTGCTGCAGAGAGGGGAAGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1149307458 17:55362977-55362999 GAGCTGAAGAAGACAGAGGAAGG + Intergenic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1151097450 17:71514814-71514836 TAGAGGAAGCAGTGTGAGAAAGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1152188030 17:78870770-78870792 TAGCTGAGGAACAGTGAGGCAGG - Intronic
1152460774 17:80441316-80441338 AAGCTGAAGAGGAGTGAGGCTGG - Intergenic
1153174334 18:2353823-2353845 TAACTGAAAAAGAGTGAGAATGG + Intergenic
1154022143 18:10673502-10673524 TAGGTGAAGGTGGGTGAGGAGGG + Intronic
1154504715 18:15024326-15024348 TAGCTTAAGTCAAGTGAGGAGGG + Intergenic
1155087081 18:22469046-22469068 CAGCTGAAGTAGGGTGAGGCTGG + Intergenic
1155494410 18:26428714-26428736 TAGTTAAAGCAGACTGAGGCAGG - Intergenic
1155616794 18:27730516-27730538 TAGCTTAAGTAGAGGGAGTAAGG - Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156856642 18:41790174-41790196 TACCTGCAGCAGTGTGAGGTTGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1158069334 18:53452218-53452240 TCTCTGAAGCAGAGTTAAGAGGG + Intronic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1159408346 18:68036004-68036026 TAGGTCAATGAGAGTGAGGATGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161854624 19:6756804-6756826 TAGCTGAAGCAGAGGGAATGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163025596 19:14509643-14509665 TAGCTCCAGAAGAGTGAGAAAGG + Intergenic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1164739490 19:30565839-30565861 TAGCTGTTGCAGAGTCAGGGAGG + Intronic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165452261 19:35890422-35890444 CAGCTGAACCAGAGTGGGGTTGG + Exonic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165794092 19:38508698-38508720 TAGCTGAAGCAGAGTCATCGAGG + Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166449329 19:42884674-42884696 CAGCTGAGGCAGAGAGAGGGAGG + Intronic
1166700958 19:44881344-44881366 TAGCTGGGGCAGAATGAGGCGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927445904 2:23161373-23161395 AAGCTGAAGAACAGAGAGGATGG + Intergenic
927550014 2:23990073-23990095 AAGCCCAAGCAGTGTGAGGAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928997639 2:37310930-37310952 TAACTGCTGCAGAGTGAAGAGGG + Intronic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931543682 2:63356764-63356786 TAGCTAAGGCAGTGTTAGGAAGG + Intronic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932734089 2:74242188-74242210 TAACTGGGGCAAAGTGAGGAAGG - Intronic
932944118 2:76207370-76207392 TATCTGAAGTATAATGAGGAGGG - Intergenic
933336078 2:80961419-80961441 AAGCTAAAGCAGTGTTAGGAGGG - Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935469693 2:103443489-103443511 TAGCTGAAGGATAGGAAGGAGGG + Intergenic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
935803125 2:106718624-106718646 AAGCTGAAGCAGTGTTAAGAGGG - Intergenic
935803229 2:106719948-106719970 AAGCTGAAGCAGTGTTAAGAGGG - Intergenic
935929688 2:108110774-108110796 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
936003769 2:108863454-108863476 TAGCTGAAGCAGAGTTAGTGAGG + Intronic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938191652 2:129287609-129287631 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
938216837 2:129525232-129525254 TAGCTAAGGCAGTGTGAAGAGGG + Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938503905 2:131854534-131854556 TAGCTTAAGTCAAGTGAGGAGGG + Intergenic
939391420 2:141573434-141573456 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942075365 2:172352351-172352373 GAGATGAGGTAGAGTGAGGAAGG + Intergenic
943233776 2:185291628-185291650 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
943734312 2:191337217-191337239 TAGCGGAAGGTGAATGAGGAAGG - Intronic
943922624 2:193729016-193729038 CCGCTGAAGAAGAGTGAGGGAGG + Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944439139 2:199724534-199724556 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944788926 2:203103757-203103779 TAGCTAAAGCAGTGTTAAGAGGG - Intronic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945009168 2:205443525-205443547 TAGCTTAGGCAGAGTTAGAAAGG - Intronic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946745107 2:222837662-222837684 TAACTAAAGCACAGTGAGGGTGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169234962 20:3923387-3923409 TACCTGAAACAAAGTGAGAAAGG + Exonic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169955812 20:11101602-11101624 TAACTGAAAGATAGTGAGGAAGG + Intergenic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170368246 20:15620004-15620026 TAGCTGAGGCAGAGGCAGGGAGG + Intronic
1170766769 20:19296500-19296522 TAGCTAAAGCAGTGTTAAGAGGG - Intronic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170815175 20:19708038-19708060 TCACTGAAGGAGACTGAGGAAGG + Intronic
1170876889 20:20258453-20258475 AAGCTGAAGCACAGCGAGGGAGG + Intronic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172230500 20:33332860-33332882 TCGCTGATGGAGAGGGAGGAAGG + Intergenic
1172359742 20:34303562-34303584 TGGCTGAACCAGCGAGAGGACGG - Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173762856 20:45579212-45579234 GAACTGAAGGAGGGTGAGGAGGG - Exonic
1174028872 20:47604346-47604368 TAAATGAAGCATAGTGAAGAGGG - Intronic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174943938 20:54964007-54964029 TGGCTGAAGTATAGTGAGGGAGG + Intergenic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177286314 21:19055916-19055938 TGACTGAAGCTTAGTGAGGAAGG + Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1179231313 21:39506351-39506373 TGGCTGAAGTAGAGTGGTGAGGG + Intronic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1179818871 21:43924982-43925004 TGGCTGAAGTGCAGTGAGGAAGG - Intronic
1180186743 21:46144055-46144077 TAGCTGAGGCAGAGAGAGAGAGG - Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1184042340 22:41951560-41951582 TAGATGAGGCAGAATGGGGAGGG + Intergenic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184320872 22:43741334-43741356 TAACTGAGGCAGAGTGAAAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949629314 3:5905595-5905617 TAGATGGTGCAGACTGAGGATGG - Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950649890 3:14400874-14400896 TAGCTGAAGCAGAGGGATGTGGG + Intergenic
950659778 3:14460056-14460078 AAACTGAGGCAGAGTGAAGAAGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
950995567 3:17492744-17492766 CAGCTGAAGCAGTGTTAAGATGG - Intronic
951623742 3:24636264-24636286 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
951741976 3:25934480-25934502 TAGCTAAAGCAGTGTGTAGAGGG + Intergenic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952694862 3:36252904-36252926 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
956488108 3:69742515-69742537 TGGCTGTAGCAGAGGGAGGTAGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956783048 3:72619583-72619605 TAGCTGAGGTGGAGTGGGGAGGG - Intergenic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
959016650 3:101142347-101142369 TAAATGAAGGAGAGTAAGGAAGG + Intergenic
960147330 3:114217288-114217310 TACCTGGTGCAGAGTGAGTATGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961166459 3:124766980-124767002 TTGCTGAGGCAGCTTGAGGAAGG - Intronic
961454798 3:127018610-127018632 GAGCTGAAGCAGGGTGGGGGCGG - Intronic
961510807 3:127402361-127402383 TACCTGACGCAGGGTGGGGAAGG + Intergenic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
963288561 3:143463201-143463223 TATCTGAATCACAGTGTGGAAGG - Intronic
963766700 3:149343578-149343600 TATCTCAAGCAGAGAAAGGAAGG + Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964245040 3:154642094-154642116 AAGCTGTAGCTAAGTGAGGAGGG - Intergenic
964248085 3:154677517-154677539 TAGCTGAGGTTGAGTGAGCAAGG + Intergenic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964966660 3:162502502-162502524 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
970931484 4:21517307-21517329 TATGTGAGGCAGAGTAAGGAGGG - Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
971623181 4:28883278-28883300 TAAATGAAGCAGTGTGAAGAAGG + Intergenic
971839521 4:31833470-31833492 TAGGTGAAATAGTGTGAGGATGG + Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975453691 4:74564003-74564025 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
975490131 4:74978949-74978971 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
975706300 4:77115344-77115366 TAGCCCAAGCAGGGTAAGGAAGG - Intergenic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976369202 4:84267523-84267545 TGGCTGAAGGACAGGGAGGAGGG - Intergenic
976527578 4:86112365-86112387 CAGCTAAAGCAGTGTCAGGAGGG - Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977086177 4:92601522-92601544 TAGCTGAAGCAGTGTCAAGAGGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
980021850 4:127720131-127720153 TAGCTAAAGCAGTGTTAAGAGGG - Exonic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980184928 4:129449053-129449075 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
980369640 4:131850676-131850698 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
980381490 4:132025524-132025546 CAACTCAAGCAGAGTGAAGACGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
982872137 4:160593764-160593786 TAGCTGAAACAGAAAGAAGACGG + Intergenic
983487507 4:168349608-168349630 CAGCTAAAGCAGTGTGACGAGGG - Intergenic
983515734 4:168654714-168654736 GAGCTGCAGCAGAGCGGGGAGGG - Intronic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983774646 4:171592207-171592229 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984436470 4:179716815-179716837 TAGATAAAGAAGAGTGAGGGAGG + Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985920982 5:2973501-2973523 TAACTGCAGCAGAGTCATGATGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987298158 5:16572729-16572751 GACCTGAAACAGAGTTAGGATGG + Intronic
988717607 5:33843393-33843415 GAGCCCAAGCAGGGTGAGGAGGG + Intronic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990231650 5:53718965-53718987 TAGCTAAAGCAGAGTTAAGAGGG + Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
992109071 5:73475536-73475558 TATCTGATGCAGGGTTAGGAAGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992222534 5:74586984-74587006 TAGCTGATGAAGATTGAGGAGGG + Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993621657 5:90175991-90176013 TAGCTAAAGCAGTGTTATGAGGG + Intergenic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
995821771 5:116242675-116242697 TGGCTGAAGCAGAAGTAGGAGGG - Intronic
996220310 5:120924131-120924153 GAGTTGCAGCAGGGTGAGGAAGG - Intergenic
996426329 5:123317392-123317414 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997274217 5:132570162-132570184 TAGGTGTGGCTGAGTGAGGAAGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998768493 5:145514996-145515018 TAGCTGAAGCAGTGTTTAGAGGG + Intronic
999392361 5:151202819-151202841 TAACTGAGGCACAGAGAGGATGG - Intronic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000304759 5:159985049-159985071 TGGCTGAAGTGGAGTGAGGGAGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002667708 5:180838208-180838230 GAGCCCAAGCAGGGTGAGGAGGG + Intergenic
1002837613 6:878402-878424 TAGCTCAACCAGAGAGGGGAAGG + Intergenic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004370536 6:15048625-15048647 AAGCTGCAGTAGAGTGGGGACGG + Intergenic
1004774391 6:18826593-18826615 TAGCTGAAGCTGATTGAGTAAGG - Intergenic
1004945930 6:20612934-20612956 TAGCTGAAGCAGACGGCAGATGG - Intronic
1004955370 6:20722980-20723002 TAGCTGAAGGATGGTGAAGATGG - Intronic
1005168686 6:22956178-22956200 TAGCAGAAGCTGGGGGAGGAGGG + Intergenic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1007397640 6:41586710-41586732 GAGCTGAAGCAGCGGAAGGAGGG + Intronic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008758076 6:54821814-54821836 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1009279092 6:61723853-61723875 TACCTGAAGGAGAGGGAGAATGG + Intronic
1009345308 6:62607679-62607701 AAGCTGAAGCAGTGTGGAGATGG - Intergenic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1010447076 6:75960159-75960181 GAGCTGAAGCAGGGTGGGGTGGG - Intronic
1011388922 6:86829397-86829419 TACCTGAAGCAGAGTGAATGAGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011919367 6:92552287-92552309 TAGCTGAGGAAGGATGAGGACGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1013896927 6:115100337-115100359 CAGCTAAAGCAGTGTTAGGAGGG - Intergenic
1014393285 6:120892168-120892190 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1014422627 6:121263927-121263949 CAGCTAAAGCAGTGTTAGGAGGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016847684 6:148585052-148585074 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1017596310 6:156032328-156032350 TATCTGAAACCGTGTGAGGAAGG + Intergenic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019390612 7:784506-784528 TAGCTGAGGCAGGAAGAGGATGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020873997 7:13671213-13671235 TAGCTGAAGTAGTGTTTGGAGGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022134999 7:27438764-27438786 AAGCTGAAGCAGAGAGATGCTGG + Intergenic
1022530230 7:31062404-31062426 AAGATGAAGTAGAGTGAGGTAGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024106477 7:46093000-46093022 CAGCTGAAGCAGTGTTAAGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024340953 7:48258763-48258785 TAGCTAAAGCAGTGTGAAGAGGG - Intronic
1025637643 7:63337248-63337270 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1025645054 7:63410851-63410873 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1027587545 7:80076642-80076664 AAACCCAAGCAGAGTGAGGAGGG + Intergenic
1027587686 7:80078091-80078113 TAGCTAAAGAACAGTGAGGGAGG + Intergenic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1028896242 7:96045316-96045338 TAGCTGAAGTCTAGTGAGGGTGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030844586 7:114393408-114393430 GAGCCCAAGCAGAGTAAGGAAGG + Intronic
1030988910 7:116276314-116276336 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1031039508 7:116824449-116824471 TAGCTAAAGCAGTGTTAAGAGGG - Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032513885 7:132493002-132493024 TACCTGAAGCAGGGGGAGGGAGG + Intronic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033798849 7:144877978-144878000 CATCTGAAGCGGAGAGAGGAGGG - Intergenic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034446506 7:151116592-151116614 TGAGTGAAGCAGAGTAAGGATGG - Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1036606321 8:10308684-10308706 TAACTGAAGCACAGTGAGCATGG - Intronic
1036698321 8:10993836-10993858 TAGCTAAGGCTGAGTGAGGTAGG - Intronic
1037044223 8:14277040-14277062 TAGCACAAACAAAGTGAGGAAGG - Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038073976 8:24048998-24049020 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1038493731 8:27987503-27987525 AAGCTGAACCTGTGTGAGGATGG - Exonic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1039172365 8:34762270-34762292 TAACTGAAGCATAGTAAAGAAGG - Intergenic
1039458856 8:37726972-37726994 TAGCTGAAGGAGGGAGAGAAGGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1039934339 8:42027927-42027949 TAGCAAAAGCAGAGTTAAGAGGG - Intronic
1042237816 8:66631741-66631763 TATCTGAAACAGAGTGAAGCGGG + Exonic
1042473393 8:69216996-69217018 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1044159834 8:88899365-88899387 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045282204 8:100758800-100758822 AACCTGAAGCATTGTGAGGAAGG - Intergenic
1046106745 8:109675129-109675151 TAGCTAAAGCAGTGTGTAGAGGG + Intronic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047437010 8:124843113-124843135 AAGCTAAAGCAAAGTGAGGGAGG - Intergenic
1047650831 8:126918375-126918397 GACATGAAGCAGAGTGTGGAAGG - Intergenic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048894264 8:138975385-138975407 TAACTTAAGCAGAGTTTGGAAGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049064085 8:140299235-140299257 TAGCTAAACCAGAGTGATGGTGG + Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052088755 9:24300216-24300238 TAGCTGAAATATAGTGAGAAAGG + Intergenic
1052114854 9:24638013-24638035 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1052185080 9:25583909-25583931 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1052369583 9:27648459-27648481 AAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1053634018 9:39976336-39976358 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1053771729 9:41487168-41487190 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054209869 9:62274361-62274383 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054315126 9:63574593-63574615 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056465684 9:86851904-86851926 TAGCTAAAGCAGTGTGTAGAGGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1057010999 9:91601162-91601184 CAGGTGAAGCTGAGTGGGGACGG - Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058862245 9:109127723-109127745 GAGGTGAGGCAGAGTGAGCAGGG - Intergenic
1059602474 9:115794891-115794913 TAACTCAAGCATATTGAGGAAGG - Intergenic
1060026859 9:120179945-120179967 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061085754 9:128397255-128397277 TGGCTGGAGCGCAGTGAGGAAGG + Intergenic
1061561608 9:131407786-131407808 AAGCTGTGGTAGAGTGAGGAGGG + Intronic
1062238580 9:135524187-135524209 TATCTGCAGCAGAGGCAGGAAGG + Intronic
1186395304 X:9202348-9202370 AAGCTCAAGCTTAGTGAGGAAGG + Intergenic
1186713134 X:12221527-12221549 GAGCTGAAACAGAGGAAGGATGG + Intronic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187740669 X:22352095-22352117 TAGCTGAAACACACTGACGATGG - Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1187909640 X:24099216-24099238 TAGCTGAAGCAGTATTAAGAGGG - Intergenic
1187981508 X:24762621-24762643 TAGCTGAAGTATAGAAAGGAAGG + Intronic
1188020688 X:25153897-25153919 TAGCTGAATCAGAGTGAATTAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189952790 X:46249490-46249512 TAGATCAAGTAGAGTGAGCAAGG + Intergenic
1190328753 X:49222926-49222948 TACCTGAAAGACAGTGAGGAGGG + Exonic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1190873292 X:54442670-54442692 TAACTGAAGCCCAGAGAGGAAGG + Intronic
1190988962 X:55526132-55526154 GACCTGAAATAGAGTGAGGATGG + Intergenic
1190992810 X:55569515-55569537 CAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1191099369 X:56708902-56708924 TAGCTGAAGTAGTGTTAGGAGGG - Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191172432 X:57461641-57461663 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192055171 X:67766477-67766499 TCCCTGAGGCAGAGTGAGCAAGG - Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1193052396 X:77115257-77115279 TAGCTCAACCATAGTTAGGAAGG - Intergenic
1193091428 X:77497455-77497477 TACCTAAAGCAGAGTTAAGAGGG + Intergenic
1193154634 X:78159042-78159064 TAGCTGTAGTAGTGTGAAGAGGG - Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195469324 X:105214951-105214973 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196704522 X:118705411-118705433 TAGCTGCAGCAGAGAGTGTATGG - Intergenic
1196764645 X:119231877-119231899 TAGCTGTAGTAGAGTGACCAGGG + Intergenic
1196810804 X:119627654-119627676 TAACTGAGGCAGGGTGAGGGTGG + Intronic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198789911 X:140333560-140333582 TAGCTAAAGCAGTGTTAAGAGGG + Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199222569 X:145334337-145334359 TAGCTGCAGCAGACTAAGTAAGG + Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200337633 X:155366820-155366842 CAGCTTAAGATGAGTGAGGAAGG - Intergenic
1200348837 X:155474407-155474429 CAGCTTAAGATGAGTGAGGAAGG + Intergenic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic
1200731745 Y:6750089-6750111 TAGCTAAAGCAGTGTTAAGAGGG - Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic