ID: 1111718042

View in Genome Browser
Species Human (GRCh38)
Location 13:91905451-91905473
Sequence TACAAAAAGAAGTGGGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111718034_1111718042 28 Left 1111718034 13:91905400-91905422 CCAAATCCCTAATGAATACTGGA 0: 1
1: 0
2: 4
3: 20
4: 166
Right 1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 226
1111718035_1111718042 22 Left 1111718035 13:91905406-91905428 CCCTAATGAATACTGGAATACTT 0: 1
1: 0
2: 4
3: 15
4: 222
Right 1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 226
1111718036_1111718042 21 Left 1111718036 13:91905407-91905429 CCTAATGAATACTGGAATACTTA 0: 1
1: 0
2: 4
3: 13
4: 199
Right 1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111718042 Original CRISPR TACAAAAAGAAGTGGGTCCA AGG Intronic
902538182 1:17133752-17133774 AAAAAAAAGAAGTGTGTCCTGGG - Intergenic
908424759 1:63995941-63995963 TACAAAAAGATGTGGATACAGGG + Intronic
909406682 1:75297994-75298016 TTCATAAAGAAGTGTTTCCATGG - Intronic
910123000 1:83810933-83810955 TCCAAAAAGAAGAGAATCCAAGG - Intergenic
911213600 1:95167923-95167945 TACGAGAGAAAGTGGGTCCAGGG - Intronic
911435661 1:97854775-97854797 TACAAACAAAAGAGGGTACAGGG + Intronic
912253370 1:108033649-108033671 TACAAAAAGAAGTTGACCGAAGG + Intergenic
913177079 1:116284725-116284747 TAAAAAAAGAACTGGGGACAGGG + Intergenic
915231582 1:154449529-154449551 AAAAAAAAGAAGTCTGTCCAAGG + Intronic
918282301 1:183019190-183019212 AAAAAAAAGAATTGGGTGCATGG + Intergenic
919011370 1:191969306-191969328 TACAAAAAGGCGTGAGGCCATGG + Intergenic
919203840 1:194394561-194394583 TACAGAAAGAGGTGGGACAAAGG + Intergenic
919416219 1:197313577-197313599 TATAAAGAGAAGTTGGTCAATGG - Intronic
920754553 1:208716674-208716696 AACAAAATGAAATGGGTCCTAGG - Intergenic
921439369 1:215166385-215166407 TAAAAGCAGAAATGGGTCCAAGG + Intronic
921581178 1:216898315-216898337 TACTATAAGAAGTTGGTACATGG + Intronic
922130647 1:222773820-222773842 TACAAAAAAGAGTGGGTAAAGGG + Intergenic
923279791 1:232432413-232432435 TTCAAAAAGTAGTGGGTCTCTGG - Exonic
924643662 1:245857380-245857402 TAAGAACAGAAGTGAGTCCAGGG - Intronic
924673409 1:246151386-246151408 TACAAAAAGTATGGGGTTCATGG + Intronic
1063359941 10:5444667-5444689 GACAAAAAGAACATGGTCCAAGG - Intronic
1066998038 10:42581479-42581501 AAAAAAAAAAAGTGTGTCCACGG + Intronic
1067540716 10:47150385-47150407 TACAAAAACAAATGGTACCAGGG - Intergenic
1068066656 10:52140484-52140506 TATAAAAAGAGGTGTGTGCATGG - Intronic
1068456326 10:57258430-57258452 TACAAAATGAAGTGTGACTATGG - Intergenic
1070403363 10:76073155-76073177 AACAAAATGAAGTGGTTCCTTGG - Intronic
1071167536 10:82823810-82823832 AAAAAAAAGAACTGGGTCTAGGG - Intronic
1071460162 10:85886119-85886141 AACAACCAGAAGTGGGGCCATGG - Intronic
1071832876 10:89389831-89389853 CAGAACAGGAAGTGGGTCCAGGG + Intronic
1073010987 10:100359416-100359438 AAAAAAAAGAAGAGGGTCAACGG - Intronic
1073592014 10:104766752-104766774 TCCAAGAAGATGTGGGGCCACGG + Intronic
1074457437 10:113607461-113607483 GAAAAAAAGAAATGGGTCTATGG + Intronic
1075139887 10:119823072-119823094 TACCAAAAAGAGTGGGTTCAGGG - Exonic
1075297642 10:121292196-121292218 AACAAAAAAAAGGGGGTCCGAGG - Intergenic
1075342841 10:121661271-121661293 TACAAACAGAATTCTGTCCAAGG + Intergenic
1075608416 10:123832830-123832852 AAAAAAAAGAAGTGGGTCTTTGG + Intronic
1076006080 10:126948986-126949008 TACAAAGGGAACAGGGTCCAGGG - Intronic
1076486550 10:130823404-130823426 TTAAAAGAAAAGTGGGTCCATGG - Intergenic
1079157768 11:17964384-17964406 TACAATGAGAAGTAGCTCCAGGG + Intronic
1080555855 11:33416675-33416697 TCCAAAGAGAATTGGTTCCAGGG - Intergenic
1081339107 11:41905172-41905194 TACAAAAGAAAGTGGGTGAATGG - Intergenic
1083394702 11:62382217-62382239 GAGAAAAAAAAGTGGGCCCAGGG + Intronic
1085880153 11:80457762-80457784 TAAAAAAAGAAATTGGACCAGGG + Intergenic
1089743503 11:120601102-120601124 GACAAGAAGAACTTGGTCCAGGG + Intronic
1091956247 12:4645961-4645983 GACAAAATGAAGTGATTCCATGG - Intronic
1093226201 12:16486849-16486871 GACAAAAAACAGTGGGTACAGGG + Intronic
1095155368 12:38846800-38846822 TACAAAAAGATTTGCATCCAAGG + Intronic
1095722548 12:45416266-45416288 GACAAAAAGAAATGGACCCATGG - Intronic
1095797447 12:46235729-46235751 TATAAAGACAAGTGGGTTCAGGG + Intronic
1099692076 12:85968257-85968279 TACAAACAGCAGTGGGTTGAAGG + Exonic
1100269587 12:93011777-93011799 TACAAAAAGCACTGGTTCTAGGG + Intergenic
1100328512 12:93564650-93564672 GATAAAAAAAAGTGGATCCAGGG + Intergenic
1100440699 12:94614534-94614556 TTCAAAAAGATGTGGGAACAGGG - Intronic
1100517529 12:95342664-95342686 AAAAAAAAGAAGGGGGTACATGG + Intergenic
1101756386 12:107623848-107623870 TACAAAATGAAATGGGACCATGG + Intronic
1103390236 12:120567230-120567252 AACAAAAATAGGTGGGTCAAAGG - Intronic
1105718197 13:23088165-23088187 TACAAGAAAAACTGGTTCCATGG - Intergenic
1106969030 13:35113842-35113864 TACAAAAACAAGTGGCTTCATGG + Intronic
1107725571 13:43295931-43295953 TACAGAAAGCACTGGGTCCCCGG - Intronic
1109707488 13:66115684-66115706 TGAAAAAAGAATTGGGTGCAGGG + Intergenic
1110001249 13:70204045-70204067 TCCCAAACCAAGTGGGTCCAAGG - Intergenic
1110670586 13:78172613-78172635 TACAAAAAGTAGTGGGATTAAGG + Intergenic
1110952094 13:81507645-81507667 TCCAAAAAGAAATTGATCCATGG - Intergenic
1111718042 13:91905451-91905473 TACAAAAAGAAGTGGGTCCAAGG + Intronic
1111946056 13:94667221-94667243 TACAAAAAAAATAGGGACCAAGG - Intergenic
1113097891 13:106685458-106685480 GACAATAAGAAGTGGGTTGAGGG + Intergenic
1113176167 13:107566522-107566544 TCCAACAAGAAGCAGGTCCAAGG + Intronic
1115705887 14:35997904-35997926 TGCAATAAGAAGTGGGGGCAAGG - Intergenic
1115784242 14:36806243-36806265 TAAAAAAAGAGGTGGGTTAATGG + Intronic
1115820752 14:37210281-37210303 TAAAAAAAAAAGTGGGGCAATGG - Intronic
1120030305 14:79633404-79633426 TACAAAAATAACTGGAACCAAGG - Intronic
1122148022 14:99705504-99705526 TAAAAAGAGAAATGGGGCCAGGG - Intronic
1124140392 15:27072326-27072348 AAGAAAAAGAAGGGTGTCCATGG - Intronic
1126306997 15:47271262-47271284 AAGAAAAGGAAGTGGGTCTAGGG + Intronic
1128285065 15:66429850-66429872 AACAAAAAGAACTGGCACCATGG - Intronic
1128426506 15:67546713-67546735 TACAAAAAGAAGAGGGGAGAGGG - Intronic
1130336980 15:82964837-82964859 TACAGAAAGCAGTGTTTCCATGG + Intronic
1130621169 15:85464028-85464050 GACAAAAAGAAGTAGGAACAGGG - Intronic
1131823643 15:96297817-96297839 TGCAAAAAGAATTGATTCCATGG - Intergenic
1134785257 16:16936398-16936420 TACAAAAATTAGTGGGGCAATGG + Intergenic
1137016333 16:35379145-35379167 TACCTCAAGAAGTGGGTCAAAGG - Intergenic
1137974948 16:53023377-53023399 TAGAAAAAAAAGAGGGGCCAGGG + Intergenic
1139827574 16:69769333-69769355 AAAAAATAGAAGTGGGTGCAAGG + Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1141065689 16:80911925-80911947 TACACAAAGGAGTGGGTGTAGGG + Intergenic
1144122118 17:12165425-12165447 GGCAAAAAGAAGAGGGTACAAGG + Intergenic
1144267035 17:13579814-13579836 TACAAAAATTAGTGGGGCCGTGG + Intronic
1144852315 17:18250251-18250273 TACACAAGCAAGTGGGTTCATGG + Intronic
1146469304 17:33111451-33111473 TACCAAAGGATGTGGGTTCAGGG - Intronic
1147118798 17:38322786-38322808 TTAAAAAAGAAGAGTGTCCATGG - Exonic
1148317442 17:46715369-46715391 TACCAGAAGAAGTGGGTTAAGGG - Intronic
1150291619 17:63985642-63985664 TCCTCAAAGCAGTGGGTCCACGG + Intergenic
1152013206 17:77733538-77733560 TAAAAAAAGAATTGTTTCCAGGG - Intergenic
1153695178 18:7633208-7633230 TGCAAAAATAAGAGAGTCCAAGG + Intronic
1153867799 18:9289079-9289101 AACAAAAAGATGTGGACCCAAGG + Intergenic
1154530852 18:15343841-15343863 GAGAAAGAAAAGTGGGTCCAGGG + Intergenic
1155160142 18:23189152-23189174 TACAAAATGAAGAGGCGCCACGG - Intronic
1156281444 18:35643136-35643158 TACAAACAGAAGTGGCTGCCGGG - Intronic
1158091297 18:53716906-53716928 GACAAACAGAAGTGGGGCGAAGG - Intergenic
1158666830 18:59439893-59439915 TACAAAGAGAAATGGCTGCAGGG - Intronic
1158754782 18:60308915-60308937 TAAAAAAAAAAGTTGGACCATGG + Intergenic
1158984144 18:62796522-62796544 TACAAAAAGACCTGGGACCTTGG - Intronic
1161853137 19:6749073-6749095 TAAAAAAAGAAGGGGGGGCAGGG - Intronic
1161955732 19:7493846-7493868 AAAAAAAAGACTTGGGTCCACGG + Intronic
1161960190 19:7519080-7519102 AAAAAAAAGAAGTGGGTTCTGGG + Intronic
1162747279 19:12805910-12805932 AAAAAAAAAAAGTGGGTCGAGGG + Intronic
1164220710 19:23191039-23191061 TGCAAAAAAAAAAGGGTCCAAGG - Intergenic
1165574215 19:36800389-36800411 GACAAAGAAAAGTGGGACCAGGG - Intergenic
1167454938 19:49593035-49593057 AACACACAGAAGAGGGTCCAAGG - Intronic
1167818669 19:51906547-51906569 GAGAAAGAAAAGTGGGTCCAGGG - Intronic
927923638 2:26993549-26993571 CACAGAAAGAAGTTGTTCCAGGG + Intronic
928515461 2:32040483-32040505 TACAAATAGAATTGTGTCAAAGG - Intergenic
928571297 2:32611779-32611801 TAAAATAAAAAGTGGGTCCAAGG + Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
931382903 2:61769898-61769920 TACAAAAATTAGTGGGGCGAGGG + Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934592454 2:95568068-95568090 TAGAAACAACAGTGGGTCCAGGG - Intergenic
936524512 2:113233690-113233712 AACAAAAAAAAAAGGGTCCAGGG + Intronic
937786806 2:125909284-125909306 AACAAAAAGAATCTGGTCCATGG + Intergenic
939054208 2:137343645-137343667 TAAAACAAGAAGTAGGGCCATGG - Intronic
941337904 2:164268025-164268047 TGCACAAAGCAGTGGGGCCACGG - Intergenic
942690255 2:178577385-178577407 TCCAAAATCAAGTTGGTCCAAGG - Exonic
943480577 2:188412053-188412075 TACATAAGGAAGTGGTTCAAAGG - Intronic
944055892 2:195521395-195521417 TACAGAAAGGAGTGGGTACACGG - Intergenic
946419659 2:219557700-219557722 TACTGAGAGAAGTGGGGCCAGGG + Intronic
1169985922 20:11444168-11444190 TGGAAAAAGAAGTGGGGCAAAGG - Intergenic
1170207689 20:13816777-13816799 TTCAAAAAGAAATGGGTACAAGG - Intronic
1170657400 20:18302098-18302120 TACAAAAATAAATGGGTATATGG + Intronic
1172525830 20:35600298-35600320 CACAGAAAGAAGTGCGACCAAGG + Intergenic
1172627993 20:36359631-36359653 TACACAAAGCTGTGGGTTCAAGG + Intronic
1173207624 20:41007188-41007210 GACAAAAAGGGGTGGGTCCCTGG - Intergenic
1173226576 20:41165663-41165685 TCCAATGAGAAGTGGTTCCATGG + Exonic
1178110563 21:29365738-29365760 AACAACAAGAAGAGGATCCATGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178166061 21:29979040-29979062 CACAAAAAGAACTTGTTCCAAGG + Intergenic
1179132964 21:38655329-38655351 TGCACACAGAGGTGGGTCCAGGG + Intronic
1179275843 21:39891067-39891089 TACAGACAGAAATGGATCCAAGG + Intronic
1181870419 22:25893899-25893921 TAGACAGAGAAGTGGGTGCATGG - Intronic
1181885923 22:26022450-26022472 TACAGAAAGAAGTGGATGCAAGG + Intronic
1183132712 22:35854775-35854797 TACAGAAAGAAATGGGTAAAAGG - Intronic
1183920051 22:41158769-41158791 TAGAAAGAGAAGTGGGGCCTGGG - Intronic
1184003417 22:41691590-41691612 TAAAAAAAAAAATTGGTCCAAGG + Intronic
949860055 3:8496986-8497008 AACCAAAAGAACTGGGTTCAAGG + Intergenic
953046369 3:39297082-39297104 TCCAAGAAGCAGTGGTTCCAGGG - Intergenic
955463071 3:59206680-59206702 TACAAAAAGAAATGTGTTCCAGG + Intergenic
957581650 3:82080720-82080742 TAAAAAATGAAGTTGGTCAAAGG + Intergenic
957843655 3:85702285-85702307 TAAAAAAAGAATTGGTGCCAAGG - Intronic
958270057 3:91488361-91488383 TACAAAAAGAAGAGACACCAGGG + Intergenic
962128698 3:132649678-132649700 TAGAAAGAAAAGTGGGCCCAGGG - Intronic
964623469 3:158737362-158737384 TACATAAAGAAGTATGTGCAAGG + Intronic
966048691 3:175587047-175587069 TCCCAAGAGTAGTGGGTCCACGG + Intronic
966704432 3:182895402-182895424 TACAAAAAGAATGGGGTACCTGG - Intronic
967163948 3:186763645-186763667 CACAAAAATACGTGGGTACATGG - Intergenic
967207357 3:187136257-187136279 GACAAAAAGAAGTCAGCCCAAGG + Intronic
969062511 4:4449028-4449050 AAAAAAAAGAATGGGGTCCAAGG - Intronic
970485236 4:16518405-16518427 TACAAAGAGTAGAGGGTTCAAGG - Intronic
972454624 4:39241500-39241522 AAAAAAAAAAAGTGGGTCCGGGG + Intronic
973105732 4:46334773-46334795 TAGAAAAAGAAATGGTTTCATGG + Intronic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
974501408 4:62708703-62708725 TACACAGAGAAGTGTGTACAAGG + Intergenic
975926978 4:79468204-79468226 TCTAAGAAGAAGTGAGTCCATGG - Intergenic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
980031778 4:127840063-127840085 TACAAAAATTAGCGGGGCCATGG + Exonic
980215645 4:129849749-129849771 TACAAAAATAAGCTGGGCCATGG + Intergenic
983923319 4:173370711-173370733 AAAAAAAAAAAGTGGGTCCGTGG + Intronic
986194331 5:5524323-5524345 TGCAAAAAGTACTGGGTCCCTGG + Intergenic
986785556 5:11111128-11111150 TCCAAAGAGAAATGTGTCCATGG - Intronic
989125792 5:38051301-38051323 TACAAAAAGGGATGGGTGCAAGG + Intergenic
991591266 5:68253972-68253994 AAAAAAAAAAAGGGGGTCCACGG - Intronic
993229159 5:85209885-85209907 TACAAACAGCAGTGGATCAAGGG + Intergenic
993746095 5:91598822-91598844 TAAAAACATAAGTGGGTTCAAGG + Intergenic
994036473 5:95207521-95207543 GACAAAATGAAGTGGGTCAGAGG + Intronic
994076149 5:95651966-95651988 TACAAAGAGAAAAGGGTACAGGG + Intronic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
994659873 5:102641065-102641087 TACAAGAGGAAGTGGGTGGAGGG + Intergenic
998990133 5:147806485-147806507 TAGAAAATAAAGTGGGTCAATGG - Intergenic
1000386779 5:160682096-160682118 TACAAAAATAATTGGCTACAGGG - Intronic
1002876508 6:1215599-1215621 TTTAAAAAGAAGAGGGTGCAAGG + Intergenic
1003494314 6:6650844-6650866 TATAAAGAGAAGTGGGTTGAAGG - Intronic
1003518585 6:6837994-6838016 TAAAAAAAGGAGAGAGTCCAGGG + Intergenic
1003789444 6:9527306-9527328 CAGAAAAGGAAGTGGGTGCATGG + Intergenic
1007135555 6:39517980-39518002 TACAGAACAAAGTGGGTCAAAGG + Intronic
1008565363 6:52762683-52762705 GAGAAAGAAAAGTGGGTCCAGGG - Intronic
1008985104 6:57532981-57533003 TACAAAAAGAAGAGACACCAGGG - Intronic
1009173138 6:60425936-60425958 TACAAAAAGAAGAGACACCAGGG - Intergenic
1010138051 6:72578120-72578142 TACAAAAATTAGTCGGGCCATGG + Intergenic
1010804593 6:80220270-80220292 TACAAAAATAACTGAGTACAAGG - Intronic
1011716361 6:90109301-90109323 CACAAGAAGAAGTGGTTTCATGG - Intronic
1012373514 6:98533677-98533699 TACATAAAGAACAGGGACCATGG + Intergenic
1013683363 6:112549884-112549906 TTCAAAAAGAAATGTGTTCAAGG + Intergenic
1014575149 6:123060106-123060128 TACAAAAAGAAAAGGGCCAAGGG - Intronic
1014622114 6:123680317-123680339 TATAAAAATAAGTGGATACAAGG - Intergenic
1014642823 6:123933987-123934009 TACAAACAGTAGTGGCTTCATGG - Intronic
1014820156 6:125979953-125979975 TACTAAAAGATGTGTTTCCAAGG - Exonic
1014885570 6:126776646-126776668 AAAATAAAGAAGTGGGTACAAGG + Intergenic
1017285556 6:152671691-152671713 AACAAAAAGTAGTATGTCCAAGG + Intergenic
1018326038 6:162670227-162670249 TACAAAAAGATGTGACTGCAGGG - Intronic
1018774747 6:167002739-167002761 TACAAAAATAAGTTGGCCTATGG + Intronic
1023008145 7:35897463-35897485 TACAAAGAGATTTGAGTCCATGG + Intronic
1023643497 7:42284800-42284822 TAAAAAAAGAAGGTGGTCCAGGG - Intergenic
1023896996 7:44442380-44442402 TGCCAAAAGAAGTAGTTCCAGGG + Intronic
1024568206 7:50701901-50701923 AACAAAAAAAAGTGTGACCATGG - Intronic
1024628872 7:51231326-51231348 AGCAAAAAGAAGTGTCTCCATGG + Intronic
1029204692 7:98862652-98862674 TACAAAAATTAGTGGGGGCATGG - Intronic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1029804202 7:102979251-102979273 TTCAAGAAGAAATGGGTCCCAGG + Intronic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1038592474 8:28852595-28852617 TACAAAGAGAACTGGATCAAAGG + Intronic
1039444206 8:37617916-37617938 GACAAAGAGAAGTTGGTTCAGGG + Intergenic
1040634481 8:49256169-49256191 AACATGAAGAAGTGGGTACATGG - Intergenic
1042324720 8:67516723-67516745 TAAAGAAAGAGATGGGTCCAGGG - Intronic
1043067547 8:75594447-75594469 TACATGAAGGAGAGGGTCCAAGG + Intergenic
1043279059 8:78439617-78439639 GAGAAAGAGAAGTGGGCCCAGGG - Intergenic
1043498968 8:80834280-80834302 TACAAAAAAAAGTGAGTCAAAGG + Intronic
1043670227 8:82875345-82875367 TACAATTAGAAGTGATTCCAGGG + Intergenic
1046689615 8:117267870-117267892 TGCACAAAGAAGTGGGACCCTGG + Intergenic
1048476930 8:134752000-134752022 GAAAAAAAGAAATGTGTCCAGGG - Intergenic
1050939298 9:11439452-11439474 TCCAAAAAGCAGTGGGACCCTGG - Intergenic
1052128300 9:24807442-24807464 GACAAAAAGAAATGGGTAAAAGG + Intergenic
1052464178 9:28809130-28809152 GAGAAAAAGACGTTGGTCCATGG + Intergenic
1053367882 9:37536677-37536699 TACAATGAGAAGAAGGTCCAGGG - Intronic
1056694391 9:88833774-88833796 TATAATAAAAAATGGGTCCATGG - Intergenic
1058777307 9:108296995-108297017 TAGAAAAAGAAGTGGGGCAGGGG + Intergenic
1059540343 9:115124001-115124023 TACAAAAAGGAGTAGGACCTTGG + Intergenic
1062386708 9:136314988-136315010 TACAAAGAGAAGAGGGAACAGGG - Intergenic
1186840788 X:13483121-13483143 AAAAAAAAGAAATGGGGCCAAGG - Intergenic
1188439569 X:30202141-30202163 TATAAGAACAAGTGGGTGCAGGG - Intergenic
1188529445 X:31123156-31123178 TACAAAATGAAGCGGATTCACGG + Intronic
1189351032 X:40275876-40275898 TACCATAAGAAGTGGGTGGAAGG - Intergenic
1189918571 X:45881242-45881264 TATAAAAAGAAGTGGACCAAAGG + Intergenic
1191932783 X:66392768-66392790 TACAAAAAAAAGTGGTTTAATGG - Intergenic
1192556862 X:72097165-72097187 TACAAAAACTACTGGGCCCAAGG - Intergenic
1196130040 X:112145690-112145712 GACGAAAAGAAGTGGGGCAATGG + Intergenic
1196414780 X:115459161-115459183 TAGAATGAGAAGTGGGTCCACGG - Intergenic
1197036929 X:121884790-121884812 TACAAAAACTAGTGGGGCCTGGG - Intergenic
1200019772 X:153192818-153192840 GACAAAGAGAAATGGGTCGAAGG - Intergenic
1200833689 Y:7712189-7712211 AAGAAAGAAAAGTGGGTCCAGGG - Intergenic