ID: 1111720306

View in Genome Browser
Species Human (GRCh38)
Location 13:91935456-91935478
Sequence TTGTATATGAAGCAGAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111720301_1111720306 10 Left 1111720301 13:91935423-91935445 CCTTCCACCATGTGAGGACACAG 0: 242
1: 711
2: 1479
3: 2036
4: 2654
Right 1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 209
1111720302_1111720306 6 Left 1111720302 13:91935427-91935449 CCACCATGTGAGGACACAGCAGT 0: 1
1: 39
2: 255
3: 796
4: 1552
Right 1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 209
1111720303_1111720306 3 Left 1111720303 13:91935430-91935452 CCATGTGAGGACACAGCAGTAAA 0: 1
1: 6
2: 131
3: 839
4: 2293
Right 1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 209
1111720299_1111720306 27 Left 1111720299 13:91935406-91935428 CCAGAGAGCTACTAGTTCCTTCC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111720306 Original CRISPR TTGTATATGAAGCAGAAGGG TGG Intronic
901732013 1:11286848-11286870 TTGGATAGGAATCAGTAGGGTGG + Exonic
901962308 1:12837291-12837313 TTGTATTTTAAGTAGAAAGGGGG - Intergenic
901984641 1:13064846-13064868 TTGTATTTTTAGCAGAAAGGGGG + Intronic
901997169 1:13161924-13161946 TTGTATTTTTAGCAGAAAGGGGG - Intergenic
903546680 1:24128414-24128436 TTGGGGATAAAGCAGAAGGGAGG - Intronic
903859376 1:26355694-26355716 TATTATAGGAAGCAGCAGGGCGG - Intergenic
903948738 1:26981237-26981259 TTGTGGATGAAGCAGCAGGGTGG - Intergenic
904088788 1:27930044-27930066 TTGTATATTTAGCAAAAAGGGGG - Intergenic
904991587 1:34597802-34597824 TTGTAGGTGGAGAAGAAGGGAGG - Intergenic
905484108 1:38283721-38283743 TTGGATATGAAGGAGGAGAGGGG - Intergenic
913492635 1:119395726-119395748 TTGTTTATGGAATAGAAGGGAGG - Intergenic
914332058 1:146681142-146681164 TTGTAGATGGAGCAGAGGGAAGG - Intergenic
915715988 1:157945679-157945701 TTGTCTATGAACCAGAAAGCAGG + Intergenic
919004043 1:191871805-191871827 ATGTATTAGAAGCAGAAAGGAGG - Intergenic
921962965 1:221055401-221055423 TTGTATATAAAGCAAAATGTAGG - Intergenic
923948041 1:238912723-238912745 TTATCTATGAACCAGAAAGGGGG - Intergenic
1064295221 10:14073280-14073302 TTGTTAATGGAGCTGAAGGGAGG + Intronic
1064563227 10:16613250-16613272 TTGTATATTAAGCATGAGAGTGG + Intronic
1066050319 10:31628738-31628760 TTGTAATAGAAGCAGAAGGCTGG + Intergenic
1068996660 10:63213601-63213623 GATTATATGAAGCAGAAGGATGG + Exonic
1069797111 10:71060515-71060537 TTGTACAGGGAGCAGAATGGAGG + Intergenic
1070175450 10:73965805-73965827 TTGTGTCTGAACCAGGAGGGAGG - Intergenic
1070764267 10:79047517-79047539 TTCTATAGGCAGCAGAAGGGAGG - Intergenic
1072145546 10:92632882-92632904 TTTTATAGAAAACAGAAGGGAGG - Intronic
1072759533 10:98044992-98045014 ATGGATATGGAGCAGAAGAGGGG - Intergenic
1077635235 11:3837660-3837682 TTGTAGAAGTAGCATAAGGGTGG - Intronic
1078198399 11:9156450-9156472 TTGTATTTTTAGCAGAAGTGGGG - Intronic
1083392568 11:62365379-62365401 TTGTATATTTAGTAGAAGTGGGG - Intronic
1086890273 11:92249655-92249677 TTGCATATGAAGCTGAAGGAGGG - Intergenic
1088112665 11:106279762-106279784 TTGTATATGAAACAACAGTGAGG - Intergenic
1088603977 11:111511858-111511880 TTGTATCAGAAATAGAAGGGAGG - Intronic
1088755301 11:112880755-112880777 ATGTATATGGAGGACAAGGGAGG - Intergenic
1088771219 11:113037748-113037770 TGGTATCTGAAGCAGAAAGTGGG - Intronic
1088818064 11:113434850-113434872 TTCTCTATGGAGCACAAGGGTGG + Intronic
1088931266 11:114352799-114352821 TTGTATCTGAATCAGACTGGTGG - Intergenic
1091860600 12:3778610-3778632 TTGCATCTGAAGCAGGAGTGGGG - Intergenic
1094582168 12:31743660-31743682 TTGTATTTGTAGTAGAAGCGGGG - Intergenic
1096902439 12:54899179-54899201 TTGTATTTTTAGCAGAAAGGGGG - Intergenic
1100056864 12:90522806-90522828 TTGAATATGGACGAGAAGGGAGG + Intergenic
1105724972 13:23154656-23154678 TTTTATTTGAAACAGAATGGGGG - Intergenic
1108028087 13:46199683-46199705 GTAAATATGAAGGAGAAGGGAGG + Intronic
1108048286 13:46404037-46404059 GTGTAAATGAAGCTGAGGGGAGG - Intronic
1108867839 13:54942675-54942697 TTGTGTAGGGAGCAGAAGAGTGG + Intergenic
1108977389 13:56464410-56464432 TTGTGTATGCAGCAGGAGTGGGG - Intergenic
1109075168 13:57824668-57824690 TTATATAAGAAGCAAGAGGGAGG - Intergenic
1109823422 13:67686880-67686902 TTTTATATGGTGCAGAATGGTGG + Intergenic
1110066909 13:71119626-71119648 TTGTACAAAAAACAGAAGGGAGG + Intergenic
1110818090 13:79883100-79883122 TTGTAACTGATACAGAAGGGAGG - Intergenic
1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG + Intronic
1112194397 13:97210952-97210974 TTGTGTATGGAGAAGAGGGGTGG + Intergenic
1114062259 14:19028313-19028335 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1114100000 14:19371680-19371702 TTTTAAAAGAAGCAGAAGGGAGG - Intergenic
1114654293 14:24306818-24306840 TTGTAGATAAGACAGAAGGGTGG - Exonic
1115954538 14:38763620-38763642 TTATATATTAAGCATAAGGGAGG - Intergenic
1116375722 14:44197818-44197840 TTGTAGATGAAGCAGAAAAGAGG + Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116825888 14:49673082-49673104 CTGGATGTGAAGGAGAAGGGAGG - Intronic
1117983289 14:61363135-61363157 TAGCATATAAAGCATAAGGGTGG + Intronic
1118504958 14:66401137-66401159 GTGTATGTGAAGCAGAGGGTAGG - Intergenic
1119322853 14:73741855-73741877 TCATATATGAAGCTGGAGGGAGG + Intronic
1119524744 14:75313685-75313707 TTGTATATTAAGTAGAAACGGGG - Intergenic
1119661065 14:76452112-76452134 TTGTATTTTAAGTAGAAAGGGGG + Intronic
1120217797 14:81699035-81699057 CTGTGTATGTAGGAGAAGGGTGG - Intergenic
1123551043 15:21382247-21382269 TTTTAAAAGACGCAGAAGGGAGG - Intergenic
1124546997 15:30637990-30638012 TTGTATATGTAGTAGAAAGGGGG + Intronic
1124780600 15:32627980-32628002 TTGTATATTTAGTAGAAAGGGGG + Intronic
1124801433 15:32836806-32836828 TTGTATTTGAAGCAGAAAACTGG - Intronic
1127593804 15:60456369-60456391 TTGTATATTTAGTAGAAGTGGGG - Intronic
1127905797 15:63374850-63374872 TTGTTTTGGTAGCAGAAGGGTGG - Intronic
1128203195 15:65827672-65827694 TTGTATTTTTAGCAGAAAGGGGG - Intronic
1128381936 15:67119555-67119577 CTGTCTATGAAGCAGATGGATGG + Intronic
1128992891 15:72275184-72275206 TTTTCTGTGAAGCAGAATGGGGG - Intronic
1129695259 15:77737386-77737408 TTGTAAAAGAAAGAGAAGGGAGG + Intronic
1202959386 15_KI270727v1_random:109490-109512 TTTTAAAAGACGCAGAAGGGAGG - Intergenic
1133829232 16:9306302-9306324 TTGTATTTAAAGTAGAAAGGGGG + Intergenic
1133945357 16:10343488-10343510 TTGTACATGCATCTGAAGGGTGG - Intronic
1138484891 16:57333829-57333851 TTGTATATGTAGTAGAAACGAGG + Intergenic
1139225298 16:65228731-65228753 TAATATATGAAGCAGTAGAGAGG + Intergenic
1140001492 16:71029776-71029798 TTGTAGATGGAGCAGAGGGAAGG + Intronic
1140413610 16:74757256-74757278 ATTTATATGAAGGATAAGGGAGG - Intronic
1141966845 16:87451368-87451390 TTGTATTTCAAGTAGAAGCGGGG + Intronic
1145923222 17:28626964-28626986 TGGCATATGAAGGAGAAGGGCGG + Intronic
1146943413 17:36859199-36859221 TTCTAGATGAAGCGGCAGGGCGG - Intergenic
1147005550 17:37400551-37400573 TTGTAGAAGTAGCAGAATGGTGG - Intronic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1148861649 17:50607669-50607691 TTTGATGTGAAGCAGTAGGGAGG - Intronic
1152359662 17:79825761-79825783 TTGCAGAGGAACCAGAAGGGCGG - Intergenic
1153231466 18:2940840-2940862 AAATATATGAAGGAGAAGGGGGG + Intronic
1154451945 18:14485673-14485695 TTTTAAAAGACGCAGAAGGGAGG - Intergenic
1156111441 18:33732023-33732045 TTGCATATGCAGCACAAGGGTGG + Exonic
1157790021 18:50523354-50523376 TTGTTTAGGAAGCAGTAAGGAGG - Intergenic
1157958983 18:52131456-52131478 TTGTATTTGAAGCAGTAGACTGG + Intergenic
1158238511 18:55348776-55348798 TTGAATATGAAGCATAAGGAGGG + Intronic
1158785371 18:60705622-60705644 TTGTGTACTAAGCAGTAGGGAGG + Intergenic
1159995365 18:74959416-74959438 TTGTCCCAGAAGCAGAAGGGTGG - Intronic
1162043345 19:7983614-7983636 TTGTTTATGGAGCAGAAAGATGG - Intronic
1162131358 19:8527921-8527943 TTATATAAGAAACAGAAGGAGGG + Intronic
1162203237 19:9036336-9036358 TTGTATTTTTAGTAGAAGGGGGG - Intergenic
1162624629 19:11874728-11874750 TTGTAAAAGAAACAAAAGGGAGG - Intronic
1162687013 19:12395447-12395469 TTGTAGATAAAGTAGAAGAGAGG - Intronic
1162691344 19:12435281-12435303 TTGTAGATAAAGTAGAAGAGAGG - Intronic
1164728545 19:30483562-30483584 TTGTTTAAGAAGCAGAAAGAGGG - Intronic
1166347120 19:42173505-42173527 GTGTATATGAACCAGAATGGAGG + Intronic
1166584436 19:43933155-43933177 TTATATATGAAGGCCAAGGGAGG - Intronic
1168229866 19:55023623-55023645 CCGTATAGGAAGCAGAAGGCTGG - Intronic
1168697782 19:58415065-58415087 TTGTATTTTTAGTAGAAGGGGGG + Intronic
925560980 2:5195170-5195192 TTGTACAGGAATCAGAAGTGAGG + Intergenic
928381428 2:30821844-30821866 TTGTATCTGAAGGAGAGGAGAGG - Intergenic
928745055 2:34402919-34402941 TGGAATATGAAGGAGAAGTGAGG - Intergenic
929162772 2:38849576-38849598 TTGGATTTTAAGCAGAAGAGTGG - Intronic
932129010 2:69170418-69170440 CTGCCTGTGAAGCAGAAGGGAGG + Intronic
933304020 2:80575181-80575203 TTATATTTGAAGCAGAGGTGGGG + Intronic
936713214 2:115157186-115157208 GTATATATGACACAGAAGGGCGG + Intronic
938172630 2:129093276-129093298 ATGTATAGAAAACAGAAGGGAGG - Intergenic
938479622 2:131648498-131648520 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
941152397 2:161931101-161931123 TTGTATTTTCAGCAGAAAGGGGG + Intronic
941987589 2:171523464-171523486 TTGTTTATGTGGCAGAAGAGTGG + Intronic
942810948 2:180000589-180000611 ATGACTATGAAGCAAAAGGGAGG - Intronic
944156164 2:196609870-196609892 CTGTGTTTGAGGCAGAAGGGAGG - Intergenic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
946052487 2:216875416-216875438 GATTATAGGAAGCAGAAGGGAGG + Intergenic
946484061 2:220084160-220084182 TTGTGAATGCAGCAGAAGTGAGG - Intergenic
948223395 2:236290807-236290829 TGGTGTATGAGGCAGACGGGGGG + Intergenic
948920164 2:241062578-241062600 GTGTCTGTGAAGCAGCAGGGCGG - Intronic
1171015748 20:21540288-21540310 ATCTAAATAAAGCAGAAGGGTGG + Intergenic
1172696245 20:36825113-36825135 TTGTATTTGTAGTAGAAGTGGGG + Intronic
1174824007 20:53752728-53752750 GTGGAGATGAGGCAGAAGGGGGG - Intergenic
1176444076 21:6802627-6802649 TTTTAAAAGACGCAGAAGGGAGG + Intergenic
1176822243 21:13667666-13667688 TTTTAAAAGACGCAGAAGGGAGG + Intergenic
1177422358 21:20876645-20876667 ATGTCAATGAAGCAGAAGGTTGG - Intergenic
1178004675 21:28204751-28204773 TTGGATCTGAAACAGAAGGCTGG + Intergenic
1179239622 21:39578494-39578516 TTGCATTTGAAGAAGAAAGGGGG + Intronic
1179336294 21:40458384-40458406 TTGTATATGAAGTAGAACCTAGG + Intronic
1180480751 22:15750939-15750961 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1184256353 22:43289244-43289266 TTGTATAAGAAGCAGATTGATGG - Intronic
949972437 3:9420295-9420317 TAGTATGTGGAGCAGAAGAGGGG - Intronic
955262419 3:57406753-57406775 TTAGATATAAAGAAGAAGGGGGG - Intronic
956062388 3:65360701-65360723 TTGTATACAGAGCATAAGGGAGG + Intronic
957172764 3:76760060-76760082 TGGTATGTGAAGCAAAAGAGTGG + Intronic
957404665 3:79762205-79762227 CTGTCTATGAAGCAGAAAGTGGG - Intronic
958151151 3:89696561-89696583 TTGTTTTTGAAGCAGAATGTGGG - Intergenic
960020615 3:112948162-112948184 TTGAATATAAAGCAAGAGGGGGG - Intronic
960592469 3:119378984-119379006 TCGCATTTGAAGCAGAAGTGGGG - Intronic
961409131 3:126705463-126705485 TTGTAGATTAAGGAGAAGTGAGG + Intronic
962720541 3:138170157-138170179 TTGTAGATGAATTATAAGGGGGG + Exonic
962931520 3:140041923-140041945 ATGTAGATGGAGCAGAAGAGAGG - Intronic
964281729 3:155074602-155074624 TTGTATTTTTAGCAGAGGGGAGG + Intronic
964664757 3:159159936-159159958 CTGTATATGAAGCATAGGGTCGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967431844 3:189394487-189394509 TTGTGGATGAAGCAGAAGATAGG + Intergenic
968248973 3:197187667-197187689 ATGTACATGAAGCAACAGGGAGG - Intronic
973884300 4:55305155-55305177 TTCTGTATGAAGTATAAGGGTGG + Intergenic
974072601 4:57138311-57138333 ATGAATATCAAGCAGAACGGAGG - Intergenic
974646673 4:64703541-64703563 TAGTATATGTAGCAGAGGAGTGG - Intergenic
975049487 4:69842459-69842481 TTGTATATAAAGCATAAGTCTGG - Intronic
975402278 4:73951990-73952012 TAGTAAAAGAAGCAGAAGGTTGG + Intergenic
976867724 4:89750696-89750718 TTGTATGTCAAGTGGAAGGGTGG - Intronic
979645473 4:123061938-123061960 TTAAATATGAACCAGATGGGAGG + Intronic
979715137 4:123828839-123828861 TAGCATATGAAGCAGAAAAGAGG + Intergenic
981828520 4:148973199-148973221 TTCTATATTAAGCAGAAAAGAGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986852728 5:11831929-11831951 ATATATATGATGCAAAAGGGAGG + Intronic
989699616 5:44247025-44247047 TTTTAAATGTAGCAGAAGGAAGG - Intergenic
990761029 5:59129493-59129515 TAGTAGATGAAGCAGAATGATGG - Intronic
990999861 5:61771870-61771892 CTGTAAAGGAAGCAGAAAGGAGG + Intergenic
991491772 5:67190819-67190841 TTAGATATACAGCAGAAGGGAGG - Intronic
993692987 5:91025639-91025661 CTGAATGTGCAGCAGAAGGGTGG - Intronic
993827983 5:92716383-92716405 TTGAATATGTAGCACAAGGAAGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995400454 5:111735026-111735048 TTATCCATGAAGCAAAAGGGAGG - Intronic
996947117 5:129083796-129083818 TTGTGTATGTAGGAGAGGGGTGG + Intergenic
999781174 5:154851705-154851727 TTGTATATGTAGTAGAAATGGGG - Intronic
1000646151 5:163762677-163762699 TTGAATATGAAGAAGAATGTTGG + Intergenic
1000977643 5:167782593-167782615 TTGTAAATGCAAGAGAAGGGAGG + Intronic
1002360667 5:178668204-178668226 TTCTATAGAAAGCAGAATGGTGG + Intergenic
1005823928 6:29620982-29621004 TTGGATATAAAGGAGAAGAGGGG - Intronic
1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG + Intronic
1006967550 6:38004017-38004039 TTTTATATGAAACTGAAGGATGG + Intronic
1008718029 6:54312964-54312986 TTGTATATGGAGCAAAAATGAGG - Intronic
1009811995 6:68680072-68680094 TTGTCTATGAACCAGAAAGTTGG + Intronic
1011555973 6:88571906-88571928 TTGTCCATTAAGCACAAGGGAGG - Intergenic
1012188099 6:96247011-96247033 TTGGATAATAAGCAGAATGGTGG + Intergenic
1013035054 6:106373901-106373923 TGGTAATTGAAGCAGAAGGTTGG + Intergenic
1013064149 6:106667199-106667221 TTGCTGATGAAGCAGAAGAGGGG + Exonic
1015994082 6:138980112-138980134 TTGGATATGGAACATAAGGGAGG - Intronic
1016232445 6:141822210-141822232 ATGTATATGAAGTACAAGAGAGG - Intergenic
1017607672 6:156150842-156150864 TCATCTATGAAGCAGAAAGGGGG - Intergenic
1018923812 6:168193421-168193443 TTCCACATGAAGCAGAAAGGAGG + Intergenic
1021395639 7:20144673-20144695 CTGAATATCAAGCAAAAGGGAGG + Intronic
1024733101 7:52274270-52274292 TTGTGTGTGAAGGAGAAGGCAGG - Intergenic
1026133927 7:67642919-67642941 TTGTATTTGTAGCAGAGGTGGGG + Intergenic
1027679367 7:81200552-81200574 TTATATCTGAGGCAGAAGGTGGG + Intergenic
1029496619 7:100898450-100898472 TTGTATATTTAGCAGAGGTGGGG + Intergenic
1033222096 7:139534556-139534578 TTGTATTGGAAGCATTAGGGGGG + Intronic
1033468433 7:141620467-141620489 TTGTATCTGAAGGAGAAGGTAGG + Intronic
1034742653 7:153493033-153493055 TTTGATATGAAGATGAAGGGGGG - Intergenic
1035718993 8:1776885-1776907 TTGTCCACGCAGCAGAAGGGTGG + Intronic
1035967749 8:4213219-4213241 TTGTCTATGAACCAGCTGGGTGG + Intronic
1036234008 8:7022585-7022607 TTGTATATGAACCAAAAAGCTGG + Intergenic
1037646443 8:20796692-20796714 TTCTATATGAAGCATAGGGGTGG + Intergenic
1038252204 8:25915662-25915684 TTGTCTATGAAGACGATGGGAGG + Intronic
1039960116 8:42239809-42239831 TTGTATTTGTAGTAGAAAGGAGG + Intergenic
1043138714 8:76560192-76560214 GTGGAGATGAAGTAGAAGGGAGG + Intergenic
1043592488 8:81846902-81846924 TCGTATATGAAGCAACAAGGAGG + Intergenic
1043871178 8:85434811-85434833 CTGTAGCTGAAGCAGAAGGTGGG + Intronic
1045030102 8:98127056-98127078 CTGTATATGAACCAGAAGGCAGG - Intronic
1052887513 9:33664520-33664542 TTGAATATGAAGGAGAAGCATGG - Intergenic
1054715828 9:68557068-68557090 TTGGATATGAAGGAGAGGGAAGG - Intergenic
1055881020 9:81003532-81003554 TTGTCTATGAACCAGAAAGGGGG - Intergenic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1058684297 9:107466560-107466582 TTGAATGTGAAGCAGGATGGAGG + Intergenic
1059817742 9:117936989-117937011 TTAAAGATGGAGCAGAAGGGAGG - Intergenic
1060768079 9:126309809-126309831 ATGTATATAGAGCAGGAGGGGGG + Intergenic
1060816951 9:126640077-126640099 ATGTATAGAAAGAAGAAGGGAGG + Intronic
1061442507 9:130615837-130615859 TTGGTTATGAAGAAGAAGCGTGG + Intronic
1203525123 Un_GL000213v1:81900-81922 TTTTAAAAGACGCAGAAGGGAGG - Intergenic
1187038473 X:15567206-15567228 AAGTATATGAAGCAGGAGAGAGG - Intronic
1188455547 X:30360927-30360949 TTGTATTTTTAGCAGAAGCGAGG - Intergenic
1188803287 X:34557894-34557916 ATGTATATGAAGCACAACTGGGG + Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193769310 X:85569953-85569975 TTGCATAAGAAGCATAAGGCTGG + Intergenic
1195429685 X:104774678-104774700 TTTGATAGGAAGCAGAAGAGTGG + Intronic
1196400034 X:115305683-115305705 TTGTAAAAAAAGCAGAAGGTTGG - Intronic
1197161369 X:123326492-123326514 TTGTCTATGAAACAGAGGTGTGG - Intronic
1197418152 X:126202236-126202258 TTGAAATAGAAGCAGAAGGGAGG + Intergenic
1197710967 X:129667038-129667060 TTGGAGATGGAGCAGAGGGGAGG - Intergenic
1199260631 X:145769666-145769688 TTGTGTTAGAAACAGAAGGGAGG - Intergenic
1200735986 Y:6796077-6796099 TTTTGTATGAAGCATAAGGAAGG + Intergenic