ID: 1111722149

View in Genome Browser
Species Human (GRCh38)
Location 13:91959447-91959469
Sequence TTTGATAGTTTGGTAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1158
Summary {0: 1, 1: 11, 2: 37, 3: 155, 4: 954}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111722149_1111722152 23 Left 1111722149 13:91959447-91959469 CCAAATTCTACCAAACTATCAAA 0: 1
1: 11
2: 37
3: 155
4: 954
Right 1111722152 13:91959493-91959515 CAAACTGTTCCAAAAACATGAGG 0: 1
1: 1
2: 10
3: 122
4: 951
1111722149_1111722153 26 Left 1111722149 13:91959447-91959469 CCAAATTCTACCAAACTATCAAA 0: 1
1: 11
2: 37
3: 155
4: 954
Right 1111722153 13:91959496-91959518 ACTGTTCCAAAAACATGAGGAGG 0: 1
1: 1
2: 36
3: 400
4: 1066
1111722149_1111722154 30 Left 1111722149 13:91959447-91959469 CCAAATTCTACCAAACTATCAAA 0: 1
1: 11
2: 37
3: 155
4: 954
Right 1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG 0: 1
1: 17
2: 250
3: 667
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111722149 Original CRISPR TTTGATAGTTTGGTAGAATT TGG (reversed) Intronic
901338368 1:8471470-8471492 TTTTGTATTTTGGTAGAAATAGG + Intronic
902888433 1:19423846-19423868 TTTTGTAGTTTGGTAGAGATGGG + Intronic
903978573 1:27168344-27168366 TTTCATATTTTGGTAGATATGGG - Intergenic
904189929 1:28735968-28735990 TTTAATAGTTTTGTAAACTTGGG + Intergenic
904634594 1:31870025-31870047 TTTGTAATTTTGGTAGAAATGGG - Intergenic
904958444 1:34309438-34309460 TTTGTATGTCTGGTAGAATTTGG - Intergenic
905982728 1:42245232-42245254 TTTATAAGTTTGGCAGAATTCGG - Intronic
906445048 1:45889097-45889119 TATGATAGTTAGGTAGACTGAGG - Intronic
906643100 1:47453215-47453237 CTTGAAAGTTGGGGAGAATTTGG + Intergenic
906757637 1:48334183-48334205 TTTGAACATCTGGTAGAATTTGG - Intronic
907227647 1:52963811-52963833 TTTTATAGTATGGCAGATTTGGG - Intronic
908070911 1:60459122-60459144 TTTATAAGTTTGGTAGAATTTGG - Intergenic
908189679 1:61689082-61689104 CTTGATAGTTTGCTAGATGTAGG - Intronic
908910615 1:69068598-69068620 CTTTATTCTTTGGTAGAATTTGG + Intergenic
908968910 1:69801303-69801325 TTTGTAGGTTTGGAAGAATTTGG + Intronic
909038791 1:70625932-70625954 TTTGTAAGCCTGGTAGAATTTGG - Intergenic
909048732 1:70742590-70742612 TTTGTATGTCTGGTAGAATTTGG + Intergenic
909060893 1:70878059-70878081 TTTGTAAGTCTGGTAGAATTCGG + Intronic
909396684 1:75178261-75178283 TTTGTAACTCTGGTAGAATTTGG + Intergenic
909507867 1:76414908-76414930 TTTCATAGTTTGTTTTAATTAGG + Intronic
909534576 1:76722032-76722054 TTTGATGGAGGGGTAGAATTTGG - Intergenic
910589550 1:88915158-88915180 TTTGTATGTTTGGTAGAATTTGG + Intergenic
911083142 1:93952913-93952935 TTTATAAATTTGGTAGAATTTGG + Intergenic
911292042 1:96068543-96068565 TTTGTGTGTTTGGTAGAATTTGG + Intergenic
911637476 1:100250909-100250931 TTTGTTTGTTTGGTAGAGATAGG + Intergenic
911874293 1:103139284-103139306 TTTGTTCATCTGGTAGAATTTGG - Intergenic
911987259 1:104643227-104643249 TCTGATAGTTTAGTATAACTAGG - Intergenic
912130437 1:106593110-106593132 TTTGAATGTTTGGTAGAATTTGG + Intergenic
912303911 1:108545413-108545435 TTTGTACCTTTGGTAGAATTCGG - Intergenic
912307642 1:108586414-108586436 TTTTATAGTTAGGTACAAATTGG - Intronic
912742645 1:112215191-112215213 TTTGAACATCTGGTAGAATTCGG - Intergenic
912826406 1:112908017-112908039 TTTGTTAGTGTGGTAAAATTAGG - Intergenic
912897053 1:113603407-113603429 TTTGAATGTCTGGTAGAATTTGG - Intronic
912928731 1:113936880-113936902 TTTGATAGATTGTTAAAATTAGG + Intronic
913464012 1:119120456-119120478 TTTGAATGTCTGATAGAATTCGG - Intronic
913578739 1:120204625-120204647 TTTGATATTTTTGTAGAGATGGG + Intergenic
913629434 1:120693744-120693766 TTTGATATTTTTGTAGAGATGGG - Intergenic
914511809 1:148339143-148339165 TTTGAATGTTTGGAAGAGTTCGG + Intergenic
914560668 1:148816066-148816088 TTTGATATTTTTGTAGAGATGGG + Intronic
914612166 1:149314149-149314171 TTTGATATTTTTGTAGAGATGGG - Intergenic
916022432 1:160804675-160804697 TTTGTATATTTGGTAGAATTTGG + Intronic
916644797 1:166772823-166772845 TTTGTATGTTTGGAAGAATTTGG - Intergenic
916774550 1:167946960-167946982 TTTGTACATTTGGTAGAATTCGG + Intronic
916816278 1:168356262-168356284 TTTGTATGTCTGGTAGAATTTGG + Intergenic
916986253 1:170194605-170194627 TTTGTAAGTTTGATAGAATTTGG + Intergenic
917356102 1:174128055-174128077 TTTGTAACTCTGGTAGAATTTGG + Intergenic
917573196 1:176291984-176292006 TTTGAATGTCTGATAGAATTCGG - Intergenic
917643142 1:177003041-177003063 TTTGCATATTTGGTAGAATTTGG - Intronic
917945370 1:179964466-179964488 TTTGTTTGTCTGGTATAATTTGG + Intronic
917960920 1:180143846-180143868 TTTGATTTTTTGGTAGAGATGGG + Intergenic
918060908 1:181060580-181060602 TTGGAGAGTTTGGGAGCATTTGG + Exonic
918182939 1:182100936-182100958 TCTGCTGGTTTGGTAGAAGTGGG - Intergenic
918196725 1:182229439-182229461 GTGGATAGTTTCATAGAATTGGG - Intergenic
918568107 1:185954286-185954308 TTTGGTGGTTTGGTTGAATGTGG + Intronic
918655559 1:187021706-187021728 CTTTATAATCTGGTAGAATTTGG - Intergenic
918919565 1:190691004-190691026 TTTGAATCTCTGGTAGAATTCGG - Intergenic
918950470 1:191129677-191129699 TTTGTATATTTGGTAGAATTTGG - Intergenic
919395752 1:197045563-197045585 TTTGTACCTTTGGTAGAATTCGG - Intronic
919492081 1:198217007-198217029 CTTGAATGTCTGGTAGAATTTGG - Intronic
920602498 1:207342785-207342807 TTTGTATGTTTGGTAGCATTTGG + Intronic
920777773 1:208956974-208956996 TATGTATGTTTGGTAGAATTTGG - Intergenic
921471325 1:215553518-215553540 TTTGGATGTTTGATAGAATTTGG + Intergenic
921775387 1:219093553-219093575 TTTGATAGTTTAATAGTCTTAGG - Intergenic
923080678 1:230651239-230651261 TTTGATAGTTTTCTATATTTGGG + Intronic
923284479 1:232479468-232479490 TTTGATCATTTGGAAGTATTTGG - Intronic
923721849 1:236473610-236473632 TTTGATTTTTTGGTAGAAATGGG - Intronic
923808369 1:237285612-237285634 TTTGAATGTCTGGTAGAATTCGG + Intronic
923910757 1:238440691-238440713 TTCTTTAGTTTGGTAGCATTTGG - Intergenic
923933458 1:238730827-238730849 TCTGGCAGGTTGGTAGAATTTGG + Intergenic
923982594 1:239341972-239341994 TTTGATAGCTAGGGGGAATTGGG - Intergenic
924068401 1:240250674-240250696 TTTGTACGTTTTGTAGAATTTGG + Intronic
924596429 1:245448721-245448743 TTTGATAGTCATGTAGATTTGGG + Intronic
924601434 1:245493096-245493118 TTTGTAAGTATGGCAGAATTTGG - Intronic
924843553 1:247741045-247741067 TTTAATATTTGGGTAGAATTTGG - Intergenic
924868200 1:248009576-248009598 TTTGTACCTTTGGTAGAATTCGG - Intronic
1063338321 10:5238353-5238375 TTTGTTCCTCTGGTAGAATTTGG - Intergenic
1064975444 10:21109587-21109609 TTTGTATCTTTGGTAGAATTCGG + Intronic
1065135173 10:22660297-22660319 TTTTATATTTTAGTAGAAATGGG - Intronic
1065341338 10:24709314-24709336 TTTGTATGTTTGATAGAATTTGG - Intronic
1065504974 10:26421088-26421110 TTTTATTGTTTTGTAGAAATGGG - Intergenic
1065772227 10:29088233-29088255 GATGGTAGTATGGTAGAATTCGG - Intergenic
1066138655 10:32479787-32479809 TTTAAATGTTGGGTAGAATTAGG + Intronic
1066140153 10:32496979-32497001 TTTGTACCTTTGGTAGAATTTGG + Intronic
1066164252 10:32769093-32769115 TTTGCACATTTGGTAGAATTTGG + Intronic
1066328184 10:34387586-34387608 TTTGTTTGTTTTGTAGACTTGGG + Intronic
1066479401 10:35781014-35781036 TTTGTATGTTTGGTAGAATTTGG - Intergenic
1066621393 10:37355180-37355202 TTTGAAAGTTTGGTAGAATTTGG + Intronic
1066762189 10:38765794-38765816 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1066959404 10:42206684-42206706 TTTCATGTTTTGGTAGAGTTAGG + Intergenic
1067230821 10:44408294-44408316 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1067256052 10:44643179-44643201 TTTGAAACTCCGGTAGAATTCGG - Intergenic
1067351336 10:45478912-45478934 TTTGAAAGTTTGGTAGAATTTGG - Intronic
1067430861 10:46244235-46244257 TTCATAAGTTTGGTAGAATTTGG - Intergenic
1067840515 10:49673682-49673704 TTTGTAATTTTGGTAGAATTTGG - Intergenic
1068026887 10:51657219-51657241 TTTGAAGGATAGGTAGAATTTGG - Intronic
1068383405 10:56290487-56290509 TGTTAAAGTTTGGTAGGATTAGG + Intergenic
1068618405 10:59148425-59148447 TTTGATAGTTTGGGTCAATCAGG - Intergenic
1068760503 10:60703120-60703142 TTTAATTGTTTGCTTGAATTAGG - Intronic
1068947705 10:62745993-62746015 GTTGATACTTTGGTAAAATTTGG - Intergenic
1069110333 10:64438951-64438973 TTTGAATCTCTGGTAGAATTCGG + Intergenic
1069120514 10:64564041-64564063 TTTGTAACTCTGGTAGAATTTGG + Intergenic
1069221061 10:65884200-65884222 TTTTAACATTTGGTAGAATTCGG + Intergenic
1069228251 10:65971714-65971736 TATGTATGTTTGGTAGAATTTGG - Intronic
1069275270 10:66583223-66583245 TTTGGATGTCTGGTAGAATTTGG + Intronic
1069341460 10:67414486-67414508 TTTGTATGTCTGGTAGAATTGGG - Intronic
1070213517 10:74350981-74351003 TTTGAACCTCTGGTAGAATTCGG - Intronic
1071123361 10:82306401-82306423 TTTAAAAGTCTGGCAGAATTCGG + Intronic
1071614491 10:87062413-87062435 GGTGATAGTTTGGTTGAAGTTGG + Intronic
1071688311 10:87786781-87786803 TTTTATATTTTGGTAGAGTCGGG - Intronic
1071737843 10:88321860-88321882 TTTGTAAGTCTGGTAGAATTTGG - Intronic
1071864383 10:89710398-89710420 TTTTATATTTTTGTAGAAATGGG + Intronic
1071880684 10:89894235-89894257 TTTGAATGTCTGGTAGAATTTGG + Intergenic
1072045216 10:91647715-91647737 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1072172065 10:92873877-92873899 TTTTATATTTTAGTAGAAATGGG - Intronic
1072883468 10:99251397-99251419 TTTGTATGTCTGGTAGAATTCGG - Intergenic
1072929514 10:99649539-99649561 TTTGTATATTTGGTAGAATTTGG + Intergenic
1073032353 10:100536725-100536747 TTTGAAGGTGTGGCAGAATTGGG + Intronic
1074144245 10:110702352-110702374 TTTGTTTGTTTGGTAGAGATGGG - Intronic
1074219892 10:111426232-111426254 TTTCATATTTTTGTAGAAATGGG + Intergenic
1074623342 10:115149928-115149950 TTTGAAAGTTTGGTGGACTTTGG + Intronic
1074933507 10:118154274-118154296 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1075268057 10:121022667-121022689 TTTGATATTTTGGTTGAATATGG + Intergenic
1075628296 10:123981544-123981566 TTTGTATGTCTGGTAGAATTAGG - Intergenic
1076408431 10:130229419-130229441 TTAGATATTTTGGCAGAGTTTGG - Intergenic
1076486407 10:130821637-130821659 TTTCACAGCTTGGTAGATTTGGG + Intergenic
1076609740 10:131716013-131716035 TTTATAAGTCTGGTAGAATTTGG + Intergenic
1077031090 11:467963-467985 TTTTTTAGTTTGGTAGAGATGGG - Intronic
1078321914 11:10343185-10343207 TTTGTACGTCTGGTAGAATTTGG - Intronic
1078542835 11:12225181-12225203 TTTGAGGGTTTTATAGAATTAGG + Intronic
1078876053 11:15398629-15398651 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1078947840 11:16091146-16091168 TTTAAGAGTGTGGTGGAATTTGG - Intronic
1079145602 11:17848690-17848712 TTTTATAATTTAGTAAAATTAGG - Intronic
1079182697 11:18207971-18207993 ATTGTAAGTTTGGTAGAATTCGG - Intronic
1079232616 11:18662307-18662329 TTTGTATGTCTGGTAGAATTCGG - Intergenic
1079297737 11:19248717-19248739 TTTGTATGTCTGGTAGAATTAGG - Intergenic
1079474691 11:20817227-20817249 TTTGTATGTTTGGTAGAATTTGG + Intronic
1079662022 11:23050557-23050579 TTTAAAGATTTGGTAGAATTTGG + Intergenic
1079936725 11:26625821-26625843 TTTTATATTTTTCTAGAATTTGG + Intronic
1079971024 11:27035360-27035382 TTTGTACATTTGGTAGAATTTGG - Intergenic
1080159072 11:29149937-29149959 TCTCATAGACTGGTAGAATTAGG - Intergenic
1080318252 11:30974763-30974785 TTTGTAAGTTTGGTAGAATTTGG - Intronic
1080351533 11:31390772-31390794 TTTAAATGTTTGGTAGAATTCGG - Intronic
1080598169 11:33794656-33794678 ATGGATATTTTGGTAAAATTTGG + Intergenic
1080709187 11:34730440-34730462 TTTGAATGTCTGGTAGAATTTGG - Intergenic
1080713936 11:34779406-34779428 TTTAAATGTGTGGTAGAATTTGG + Intergenic
1081095812 11:38933289-38933311 TTTGTATGTTTGGTAGAATTTGG + Intergenic
1081269760 11:41068823-41068845 TTTGTTCTTTTGGTAGAATTCGG - Intronic
1081390011 11:42518189-42518211 TTTGCAACTCTGGTAGAATTCGG - Intergenic
1082284944 11:50307993-50308015 ATAGAAAGTTTGTTAGAATTAGG + Intergenic
1082650169 11:55780898-55780920 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1082671029 11:56036673-56036695 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1082695858 11:56363496-56363518 TTTTAATGTTTGGTAAAATTAGG - Intergenic
1082698148 11:56396335-56396357 TTAGATAATTTTGTAGAAGTGGG - Intergenic
1083003360 11:59318055-59318077 TTTGTACGTCTGGTAGAATTTGG + Intergenic
1083081272 11:60095993-60096015 TTTGACAGTTTGATAATATTTGG + Intronic
1083132444 11:60637989-60638011 TTTGAAGGTCTGGTAGAATTTGG - Intergenic
1083794019 11:65004134-65004156 TTTGTTTGTTTGGTAGAGATGGG - Intergenic
1084622373 11:70281692-70281714 TTTGACAATTTGGAAGGATTTGG - Intronic
1085493284 11:76942770-76942792 TTTGTATGTTTGGTAGAACTTGG + Intronic
1085966031 11:81527701-81527723 TTTGTAAATCTGGTAGAATTTGG + Intergenic
1086123310 11:83323772-83323794 CTTGACAGTGTGGTAGAATTTGG + Intergenic
1086494811 11:87391615-87391637 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1086511099 11:87558881-87558903 TTAAATATTTTGGCAGAATTTGG + Intergenic
1086560146 11:88158332-88158354 TTTGTATGTCTGGTAGAATTTGG - Intronic
1086599164 11:88611303-88611325 TTTGAACATCTGGTAGAATTTGG + Intronic
1086833076 11:91589546-91589568 TTTGCATGTTTGGTAGAATTTGG + Intergenic
1087189130 11:95233646-95233668 TATAATAGTTTGGAGGAATTTGG - Intergenic
1087637082 11:100714302-100714324 TTATAAAGTTTAGTAGAATTAGG - Intronic
1088077984 11:105875502-105875524 TTTGTACCTTTGGTAGAATTTGG + Intronic
1088387181 11:109272219-109272241 TTTGAAAGTCTGGTAGAATTCGG + Intergenic
1088516626 11:110642870-110642892 TTTGTATGTCTGGTAGAATTCGG + Intronic
1088768895 11:113013253-113013275 TTTGATATTTTCGTAGATATGGG - Intronic
1089090046 11:115865604-115865626 TTAGAAAGTTTGGTAGAATTTGG + Intergenic
1089194363 11:116685045-116685067 TTTGTTAGTTTTTTAGAAATTGG + Intergenic
1089235877 11:117024726-117024748 TTGTATATTTTGGTAGAGTTGGG - Intronic
1089267483 11:117275793-117275815 TTTGAATGTCTGGTAGAATTTGG - Intronic
1089738735 11:120567328-120567350 TTTAATTTTTTGGTAGAAATGGG + Intronic
1090155025 11:124428142-124428164 CTTGGTAGTGTGGGAGAATTGGG - Intergenic
1090215993 11:124965229-124965251 TTTGTACCTTTGGTAGAATTTGG + Intronic
1090220976 11:125025507-125025529 CTTAAATGTTTGGTAGAATTTGG + Intronic
1090504130 11:127292314-127292336 TTTGCTCATTTGGTAGAATTTGG - Intergenic
1090630303 11:128640860-128640882 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1090911665 11:131125582-131125604 TGTGAAAGTTTGGTAGAATTTGG + Intergenic
1091436383 12:476418-476440 TTTTATTGTTTGGTAGAGATGGG - Intronic
1091598149 12:1894291-1894313 TTTGAAAGTTTGGTACAATTTGG - Intronic
1091708371 12:2716747-2716769 TTTGCATGTCTGGTAGAATTTGG - Intergenic
1092308750 12:7329869-7329891 TTTGATAGTTTGTTTTTATTAGG - Intergenic
1092332459 12:7597726-7597748 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1092648547 12:10607075-10607097 TTTGATAGTTTAAAAGCATTTGG + Intronic
1092892791 12:12984838-12984860 TTTAATATTTTGTTAGAATCTGG - Intronic
1092906993 12:13110038-13110060 TTTGTATGTCTGGTAGAATTTGG + Intronic
1093060398 12:14596310-14596332 TTTGTACATTTGGTAGAATTTGG + Intergenic
1093289788 12:17305448-17305470 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1093603514 12:21060809-21060831 CTTGTTTCTTTGGTAGAATTTGG + Intronic
1093620402 12:21281977-21281999 TTTAAATGTTTGGTAGAATTAGG - Intronic
1093739868 12:22672653-22672675 CTTGTGAGTTAGGTAGAATTTGG + Intronic
1094312120 12:29095717-29095739 TTTGTAACTCTGGTAGAATTTGG - Intergenic
1095217117 12:39562719-39562741 TTTAAATATTTGGTAGAATTTGG - Intronic
1095258289 12:40067377-40067399 TTTTTTATTTTGGTAGAAATGGG + Intronic
1095400311 12:41807127-41807149 TTTGAACCTCTGGTAGAATTCGG - Intergenic
1095588603 12:43877048-43877070 TTTCATAGTTTTCTTGAATTTGG + Intronic
1095845568 12:46740527-46740549 TTTGTACGTCTGGTAGAATTCGG - Intergenic
1096276129 12:50209832-50209854 TTTGAGTTTTTGGTAGAGTTGGG + Intronic
1096460538 12:51819506-51819528 TTTGAGTGTCTGGGAGAATTTGG + Intergenic
1096888862 12:54746104-54746126 TTTAAAGATTTGGTAGAATTTGG + Intergenic
1096897326 12:54836171-54836193 TTTGAAGGTCTGGTAGACTTTGG + Intronic
1096926530 12:55154032-55154054 TTTGAACCTCTGGTAGAATTTGG + Intergenic
1097062683 12:56297804-56297826 TTTGCTAGTAAGGTAGACTTTGG - Intronic
1097137092 12:56866258-56866280 TTTTATAGTTTGTAATAATTTGG - Intergenic
1097214479 12:57399539-57399561 TGTGATAATTTGATAGAAATAGG - Intronic
1097480845 12:60124046-60124068 TTTGAGAGTCAGGTAGATTTGGG + Intergenic
1097686449 12:62695537-62695559 TGTGTTAGTTTGGTAGATTTGGG - Intronic
1098120222 12:67228679-67228701 TTTGAACCTCTGGTAGAATTCGG + Intergenic
1098437050 12:70479041-70479063 TTTGTATGTCTGGTAGAATTCGG + Intergenic
1098512720 12:71337325-71337347 TTTGTGTGTCTGGTAGAATTTGG - Intronic
1098982393 12:76971150-76971172 TTTGAATGTCTGGTGGAATTCGG + Intergenic
1099075973 12:78109358-78109380 TTTGCATGATTGGTAGAATTAGG - Intronic
1099088293 12:78274557-78274579 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1099253407 12:80286461-80286483 TTTGTAACTCTGGTAGAATTTGG + Intronic
1099492185 12:83300900-83300922 TTTGATAAATTGATAGAAGTAGG + Intergenic
1099522642 12:83682694-83682716 TTTGATGATTTGATAGAAGTAGG + Intergenic
1099696866 12:86034339-86034361 CTTTATACATTGGTAGAATTTGG + Intronic
1099737076 12:86582553-86582575 TTTGATAGTTTAGTAGGATTTGG + Intronic
1100157936 12:91822968-91822990 TTGGATATTTTGTTAGTATTTGG - Intergenic
1100630333 12:96382416-96382438 TTTATACGTTTGGTAGAATTCGG - Intronic
1100772837 12:97942273-97942295 TTTTATAGTTAGGTAGACTGAGG - Intergenic
1100776558 12:97980967-97980989 TTTAATTGTTTGGTAAAATTTGG - Intergenic
1100942169 12:99735664-99735686 TTTATATGTTTGGTAGAATTTGG - Intronic
1101939030 12:109085528-109085550 TTTAATAGTTGTGTAGCATTTGG + Intronic
1102132071 12:110539612-110539634 TTTCATAGGCTGGTAGAAGTAGG - Intronic
1102408371 12:112694236-112694258 TTTGAGAATTTGGTGGAATTTGG + Intronic
1104089432 12:125502855-125502877 TGTGAAACTCTGGTAGAATTAGG + Intronic
1105063575 12:133176827-133176849 TTTGTACATTTGGTAGAATTCGG - Intronic
1105321485 13:19326972-19326994 TTTGTATGTTTGGTAGATTTTGG - Intergenic
1105588648 13:21769721-21769743 TTTGATAGATTGGGAAAAGTTGG - Intergenic
1106405138 13:29466703-29466725 TTTTGTAGTTTGGTAGAGATGGG - Intronic
1106780264 13:33052127-33052149 TTGGATTTTTTGGTAGAAATGGG + Intronic
1107083599 13:36401600-36401622 TTTAAATGTTTGGTAGAATTTGG + Intergenic
1107085518 13:36424040-36424062 TTTAAATGTTTGGTAGAATTTGG - Intergenic
1107223711 13:38019828-38019850 TTTGAAAGTCTGGTAGAATTTGG + Intergenic
1107439896 13:40416791-40416813 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1107685269 13:42891311-42891333 CTTGAAAGTTTAATAGAATTTGG + Intronic
1107968521 13:45618955-45618977 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1108170643 13:47738312-47738334 TTTGTAACTTTGTTAGAATTTGG - Intergenic
1108635376 13:52329153-52329175 TTTGTAAGTTTGGTAGAATTTGG - Intergenic
1108652433 13:52494076-52494098 TTTGTAAGTTTGGTAGAATTTGG + Intergenic
1108928125 13:55778433-55778455 TTTGTAAGTGTAGTAGAATTTGG - Intergenic
1109224346 13:59674498-59674520 TATGATTGTTTGGTAGAGGTTGG - Intronic
1109308790 13:60668329-60668351 TTTGCATGTCTGGTAGAATTTGG + Intergenic
1109325823 13:60866645-60866667 TTTGCTTATCTGGTAGAATTTGG + Intergenic
1109504158 13:63277511-63277533 TTTGTACATTTGGTAGAATTTGG - Intergenic
1109806954 13:67455860-67455882 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1110122270 13:71896942-71896964 TTTATAAGTTTGATAGAATTTGG - Intergenic
1110160514 13:72372327-72372349 TTTAAATGTTTGGTAGAATTCGG + Intergenic
1110682427 13:78331654-78331676 TTGGATGGTTTGGAAGATTTGGG + Intergenic
1110870173 13:80442776-80442798 TTTGTAAGTTTAGTAGAATTTGG + Intergenic
1110887958 13:80661850-80661872 TTTGAATGTCTGGTAGAATTTGG + Intergenic
1110901222 13:80827257-80827279 TTTGAATGTCTGGTAGAATTTGG + Intergenic
1110940986 13:81348139-81348161 TTTGCTAGTTTTATAAAATTAGG - Intergenic
1111112651 13:83734402-83734424 TTTCATTTTTTTGTAGAATTCGG - Intergenic
1111137142 13:84062715-84062737 TTTGAAAGCCTGGTAAAATTTGG + Intergenic
1111722149 13:91959447-91959469 TTTGATAGTTTGGTAGAATTTGG - Intronic
1111783664 13:92760270-92760292 TTTGAAAGGTTGGTAGAATTAGG + Intronic
1112080318 13:95962599-95962621 TTTGAAAGTTTGGTAGAATTAGG - Intronic
1112087273 13:96044900-96044922 TTTGAATGTCTGGTAGAATTTGG - Intronic
1112535194 13:100247077-100247099 TTTTATAGTTTAGTAGAGATGGG + Intronic
1112661494 13:101514216-101514238 TTTAATAGTTAGATATAATTTGG + Intronic
1112707192 13:102083822-102083844 TTAAATATTTTGGCAGAATTTGG + Intronic
1112814679 13:103258098-103258120 TTTGGTATTTTAGTAGAAATTGG - Intergenic
1112821476 13:103341888-103341910 TTTGAAAGATTGGTAAAATTTGG + Intergenic
1112846067 13:103645664-103645686 TTTGTATGTTTGGTAGAATTTGG + Intergenic
1112985095 13:105439016-105439038 TTTGAAAGTTTGCTACTATTTGG - Intergenic
1113770857 13:112907665-112907687 TTTAATAATTTGGTAGACTCTGG + Intronic
1114690897 14:24580168-24580190 TTTGATATTTTGGGAGAAGAAGG - Intergenic
1114907341 14:27146837-27146859 TTTGTGTGTCTGGTAGAATTTGG + Intergenic
1115017060 14:28630277-28630299 TTTGTTCTTGTGGTAGAATTTGG + Intergenic
1115333204 14:32220113-32220135 TTTCATATTTTGGTAGAGATGGG + Intergenic
1115371548 14:32620748-32620770 TTTGAATATCTGGTAGAATTTGG + Intronic
1115911832 14:38265523-38265545 TTTGTAACTCTGGTAGAATTTGG + Intergenic
1116012000 14:39362274-39362296 TTTATAAGTTTGCTAGAATTTGG + Intronic
1116147778 14:41098400-41098422 ATTGTTACTTTGGTAGAGTTTGG - Intergenic
1116159191 14:41246660-41246682 TTTCATAGTTGGGGAGATTTAGG + Intergenic
1116165270 14:41326951-41326973 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1116222560 14:42107527-42107549 TTTGTTTGTCTGATAGAATTTGG + Intergenic
1116319327 14:43440167-43440189 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1116370848 14:44129612-44129634 TTTGAGAGTTTTGTATATTTAGG - Intergenic
1116459132 14:45151456-45151478 TCTGATATTTTGTTAGATTTGGG - Exonic
1116486007 14:45449386-45449408 TATGTATGTTTGGTAGAATTTGG + Intergenic
1116699410 14:48220449-48220471 TTTAATAGTTTCATAGAATATGG - Intergenic
1117111367 14:52459476-52459498 TTTGTATGTCTGGTAGAATTTGG - Intronic
1117512540 14:56468202-56468224 TTTGTAAGTTTGGTAGAATTAGG - Intergenic
1117616713 14:57541385-57541407 TTTGTTCCTCTGGTAGAATTCGG + Intergenic
1117796726 14:59402314-59402336 TTTGAACCTCTGGTAGAATTCGG + Intergenic
1117837479 14:59822098-59822120 TTTGTATGTCTGGTAGAATTTGG + Intronic
1117887950 14:60385196-60385218 TTTGTACGTCTGGTAGAATTTGG - Intergenic
1117889080 14:60398711-60398733 TTTCATATTTTGGTAGAGATGGG + Intronic
1118479312 14:66147664-66147686 TTTGAACCTCTGGTAGAATTTGG - Intergenic
1118662098 14:68025431-68025453 TTTGTATGTCTGGTAGAATTTGG + Intronic
1118964796 14:70570672-70570694 TTTGAACATTTGGTAGAATGTGG - Intergenic
1120394342 14:83949459-83949481 TTTATAAGTTTGGTAGAATTTGG + Intergenic
1120444978 14:84583752-84583774 TTTGTTAGTTTTTCAGAATTGGG - Intergenic
1120553792 14:85904504-85904526 TTTGTTCCTCTGGTAGAATTTGG + Intergenic
1120612771 14:86663307-86663329 TTTCAAAGTTTTGTAGATTTTGG - Intergenic
1121759913 14:96436100-96436122 TTTGACTGTTTGGTAGACTTTGG + Intronic
1121849236 14:97204371-97204393 TTTGAAAGATTGGAAGGATTTGG - Intergenic
1122845267 14:104492188-104492210 TATGAACATTTGGTAGAATTTGG - Intronic
1124134719 15:27024414-27024436 TCTGATAGTTTTGTAGTTTTAGG + Intronic
1124667058 15:31602007-31602029 TTTGTACCTTTGGTAGAATTCGG - Intronic
1124699439 15:31899894-31899916 GTTGATACTTTGAAAGAATTAGG + Intergenic
1124935613 15:34167096-34167118 TTTGACAGGTTGACAGAATTAGG + Intronic
1125254609 15:37748886-37748908 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1125496637 15:40201632-40201654 TTTTAAAGTTTGTTTGAATTGGG - Intronic
1125627279 15:41118656-41118678 TTTGAACATTTGGTAGAAATGGG - Intergenic
1126203093 15:46011362-46011384 TTTATTAGTTAGATAGAATTTGG + Intergenic
1126496686 15:49298994-49299016 TTTATATGTTTGGTAGAATTTGG + Intronic
1126873991 15:53018904-53018926 TTTGCACATTTGGTAGAATTTGG + Intergenic
1127140781 15:55974320-55974342 TTTAAATATTTGGTAGAATTTGG - Intronic
1127326612 15:57901833-57901855 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1127339407 15:58025560-58025582 TTTGTATGTTTGGTAGAATTTGG - Intronic
1127696904 15:61459104-61459126 TTTGCTCGTTTTCTAGAATTTGG + Intergenic
1128280767 15:66392348-66392370 TTTGATTGTTTTGTAGAGATGGG + Intronic
1128420312 15:67485828-67485850 TTTGTATTTTTGGTAGAATTGGG + Intronic
1128589504 15:68882414-68882436 TTAGACAGAGTGGTAGAATTTGG + Intronic
1128862707 15:71087682-71087704 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1129052252 15:72791927-72791949 TTTGATAGTTTGTTAAAAAGTGG - Intergenic
1129489726 15:75912357-75912379 TTTGTACCTTTGGTAGAATTCGG + Intronic
1129568455 15:76651670-76651692 TTTGTATGTCTGGTAGAATTTGG - Intronic
1129581236 15:76812843-76812865 TTTGAATGTTTGGTAGAATTCGG - Intronic
1129851188 15:78794886-78794908 TTTTGTATTTTGGTAGAAATAGG + Intronic
1130811643 15:87385195-87385217 TTTTAAAGATTGGTAGAATTTGG - Intergenic
1131450916 15:92539148-92539170 TTTGATTTGTTAGTAGAATTGGG + Intergenic
1131477025 15:92748678-92748700 TATGAAAGTTTGGAAGACTTTGG + Intronic
1131606961 15:93916253-93916275 GTTGAAATTTTGGTATAATTAGG + Intergenic
1131658605 15:94488838-94488860 TTTGAAAATTTGGTAGAATCTGG - Intergenic
1131980410 15:97989095-97989117 TTTGAAAGTTGAGTAGAAGTTGG + Intergenic
1132173284 15:99685897-99685919 TTTGAATGCTTGATAGAATTCGG + Intronic
1132438971 15:101839968-101839990 TTTAAATGTTTGGTAGAATTTGG + Intergenic
1133092783 16:3417701-3417723 TTTAATTGTTTTGTAGAGTTGGG - Intronic
1133290745 16:4719161-4719183 TTTGATTTTTTTGTAGAGTTGGG - Intronic
1135096822 16:19571386-19571408 TTGGATTTTTTGGTAGAGTTGGG + Intronic
1135650195 16:24199554-24199576 TTTGATACTTTGGGGGAGTTAGG - Intronic
1135695921 16:24586293-24586315 TTTAATTGTTTTGTAGAAATGGG + Intergenic
1137054828 16:35739715-35739737 TATGATAGTTTGGAGGAATGGGG + Intergenic
1137224144 16:46486170-46486192 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1137239613 16:46644386-46644408 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1137807642 16:51322448-51322470 CTTTTTAATTTGGTAGAATTAGG - Intergenic
1139728984 16:68926320-68926342 TTTTATAGTTTAGTAGAAACGGG - Intronic
1140495535 16:75383932-75383954 TTTGATAATTTGATACAATATGG + Intronic
1143337386 17:6182432-6182454 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1143726677 17:8852290-8852312 TTTGCTATTTTGGTAAAATATGG - Intronic
1143802344 17:9394534-9394556 TTTGACAGTTTAGTAGAGATGGG + Intronic
1143953290 17:10650452-10650474 CTTGAGAGTTGGGTAGAATCGGG - Intronic
1144006889 17:11108954-11108976 ATTGATAGTGTGGTAGAATGTGG + Intergenic
1144153531 17:12474639-12474661 TTTGTATATTTGGTAGAATTCGG + Intergenic
1144247303 17:13379770-13379792 TCTTAAAGTTAGGTAGAATTAGG + Intergenic
1144488770 17:15689281-15689303 ATTGAAAGTTTGGTAGAATTTGG + Intergenic
1144912248 17:18693018-18693040 ATTGAAAGTTTGGTAGAATTTGG - Intergenic
1145844547 17:28026818-28026840 TTTTATTTTTTGGTAGAGTTGGG + Intergenic
1145968377 17:28938051-28938073 CTTGATAGTCTGTTAAAATTTGG - Intronic
1145984243 17:29034052-29034074 TTTGATGGTCTGGTAGAGTAAGG + Intronic
1146118038 17:30160386-30160408 TTTGTAAGTTTGGTAGACTTTGG + Intronic
1146155365 17:30519222-30519244 TTTTTTATTTTGGTAGAGTTGGG + Intronic
1146423467 17:32712290-32712312 ATTGATAGTTTGCTAAGATTTGG - Intronic
1148367065 17:47063510-47063532 TTTGTTAGTTTGGCTGGATTTGG + Intergenic
1148981364 17:51578231-51578253 TTTGTTCCTCTGGTAGAATTCGG - Intergenic
1148994359 17:51696255-51696277 TTTGTTTATATGGTAGAATTTGG + Intronic
1149359232 17:55875887-55875909 TTTGTAAGTCTGGTAGAATTCGG + Intergenic
1149462486 17:56841553-56841575 TTTGATAATTTGATAGAAAAAGG - Intronic
1149802916 17:59587394-59587416 TTTTATATTTTGGTAGAGATAGG + Intronic
1149843570 17:59988084-59988106 TTTTATATTTTGGTAGAGATAGG - Intergenic
1150432103 17:65126696-65126718 TTTGTTTGTTTAGTAGAGTTGGG - Intergenic
1150857141 17:68764118-68764140 TTTGATTTTTTGGTAGAGATGGG + Intergenic
1150882856 17:69050636-69050658 TTTCATTGTTTGTTAGATTTTGG + Intronic
1151039840 17:70846246-70846268 TTTGCAAATTTGGTAAAATTTGG + Intergenic
1152702783 17:81827579-81827601 TTTTATATTTTTGTAGAAATGGG - Intronic
1203167980 17_GL000205v2_random:115983-116005 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1152986695 18:327877-327899 TTTGAATGTTTGGTAGAATTTGG + Intronic
1152987057 18:330625-330647 TTAGATCTTTGGGTAGAATTAGG + Intronic
1152999921 18:445377-445399 TTTCATAATTTGGCATAATTGGG - Intronic
1153056037 18:947351-947373 TTTATAAGTTTGGTAGAATTTGG + Intergenic
1154016741 18:10625772-10625794 TTTTATATTTTAGTAGAAATGGG - Intergenic
1154097922 18:11437166-11437188 TTTGAAAGTTTGGTAGAATTTGG - Intergenic
1154131952 18:11744880-11744902 TTTGTAATTTTTGTAGAATTGGG + Intronic
1154188773 18:12209887-12209909 TTTTATATTTTAGTAGAAATGGG + Intergenic
1154470509 18:14695538-14695560 TTCCATAGTTGGGTAGAACTGGG + Intergenic
1155011286 18:21781251-21781273 TTTAAATGTTTGGTAGAATCTGG + Intronic
1155534209 18:26799443-26799465 CTTTAAATTTTGGTAGAATTTGG - Intergenic
1155614665 18:27707618-27707640 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1156087012 18:33417896-33417918 TTTGTATGTCTGGTAGAATTTGG - Intronic
1156562019 18:38136002-38136024 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1156814410 18:41292120-41292142 TTTGAAATTTTGGTAGAGATGGG - Intergenic
1156926956 18:42593749-42593771 CTTGTATGTTTGGTAGAATTTGG + Intergenic
1157273830 18:46296125-46296147 TTTTATATTTTTGTAGAGTTGGG + Intergenic
1157659501 18:49427451-49427473 TTTAATAGTTTATTACAATTAGG - Intronic
1157821240 18:50771769-50771791 TTTATAAGTTTGGTAGATTTTGG - Intergenic
1158084320 18:53632862-53632884 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1158258013 18:55575027-55575049 TTAGTAATTTTGGTAGAATTGGG - Intronic
1158577688 18:58653082-58653104 TTTGCATGTTTGGTAGAATTTGG + Intergenic
1159403825 18:67974209-67974231 TTTGTATGTCTGGTAGAATTAGG + Intergenic
1160361122 18:78280202-78280224 TTTGTGTGTCTGGTAGAATTTGG + Intergenic
1160475008 18:79175325-79175347 TTTAAAAGTTTGGTGTAATTTGG + Intronic
1161224652 19:3137608-3137630 TTTGGTATTTTGGTAGAGATGGG - Intronic
1162867016 19:13555743-13555765 TTTGTTTGTTTGGTAGAGATAGG + Intronic
1162902898 19:13805798-13805820 TTTTATATTTTGGTAGAGATGGG - Intronic
1163696553 19:18766914-18766936 TTTAAAAGTTTGGTAAAATTAGG + Intronic
1164185757 19:22867634-22867656 ATTGATAGTTTGATAGAAAAAGG - Intergenic
1164251287 19:23478310-23478332 TTTGTATATTTGGTAGAATTTGG - Intergenic
1164614808 19:29660769-29660791 TTTGATATTTTTGTAGAGATGGG + Intergenic
1164667422 19:30050745-30050767 TTTAATCTTTTGGTAGAAATGGG + Intergenic
1164986820 19:32654325-32654347 TTTAATATTTTGGTAGAGATGGG - Intronic
1165017767 19:32895031-32895053 TTTGTAAGGTTTGTAGAATTTGG - Intronic
1165165670 19:33853695-33853717 TTTGGAATCTTGGTAGAATTTGG - Intergenic
1165174252 19:33915760-33915782 TTTGTTTGTTTGGTAGAGATAGG - Intergenic
1165207816 19:34206009-34206031 TGTGATAGTTTGGATGAAGTGGG + Intronic
1165366420 19:35370020-35370042 ATTGATAATTTGGTAGGAATTGG - Intergenic
1166263523 19:41660648-41660670 TTTGTACCTTTGGTAGAATTTGG - Intronic
1166616346 19:44251303-44251325 TTTGTACCTTTGGTAGAATTTGG - Intronic
1166806529 19:45490746-45490768 TTTTATATTTTGGTAGAGATGGG + Intronic
1167813584 19:51857512-51857534 TTTCATATCTTGGTAGAATTGGG + Intronic
1167914409 19:52728365-52728387 TTTTATAGTTTTGTAGAGATGGG - Intronic
1167962690 19:53119946-53119968 TTTGAAAGTTTGATAGAATTCGG - Intronic
1168456938 19:56519659-56519681 TTTGATCTTTTGGAATAATTTGG + Intronic
1168497451 19:56865417-56865439 TTTGGTATTTTTGTAGAAATGGG + Intergenic
924968858 2:104850-104872 TCTGTAAGTTTGGTAGAATTTGG + Intergenic
925637613 2:5956113-5956135 TTTGAATGTCTGGTAGAATTTGG + Intergenic
925638126 2:5961629-5961651 TTTATAAGTTTTGTAGAATTCGG + Intergenic
926066051 2:9841326-9841348 CTTAAAAATTTGGTAGAATTTGG + Intergenic
926309654 2:11666276-11666298 TGTGAGAGTTTGGTAGGATGAGG - Intronic
926501583 2:13660318-13660340 TTTGTACGTCTGGTAGAATTTGG + Intergenic
926539834 2:14162122-14162144 TTTGAGAATTAGGAAGAATTGGG + Intergenic
927183132 2:20462179-20462201 TTTGTACCTTTGGTAGAATTTGG - Intergenic
927370841 2:22353729-22353751 TTTGTTAGTTTAGTTGAGTTTGG - Intergenic
927476966 2:23420867-23420889 TTTGAAGGTTGGGTATAATTTGG - Intronic
927555388 2:24027510-24027532 ATTGAAAGTTTGCTAGAACTTGG - Intronic
927614543 2:24579201-24579223 TTTGCAAGTTTAGTAGAATATGG + Intronic
928067365 2:28179041-28179063 TTTATAAGTTTGGTAGAATTTGG - Intronic
928712749 2:34025678-34025700 TTTGTTATTTTGATAGAATTAGG - Intergenic
928757005 2:34538673-34538695 TTTTTAAGTTTAGTAGAATTTGG + Intergenic
928774589 2:34745020-34745042 TTTTATAGTTCGGTTGGATTTGG + Intergenic
929265829 2:39918299-39918321 TTTGCAAGTTGGGTAGAATTTGG + Intergenic
930628183 2:53722229-53722251 TTTGTATGTCTGGTAGAATTCGG - Intronic
930647331 2:53925594-53925616 TTGGAGAGTTTGGTCGAATTAGG - Exonic
930894700 2:56431835-56431857 TTTGTTACTTTCATAGAATTAGG + Intergenic
930954213 2:57185200-57185222 TTTAATCATGTGGTAGAATTTGG - Intergenic
931025071 2:58103650-58103672 TTTGTACTTTTGGTAGAATTTGG - Intronic
931045288 2:58344905-58344927 TCTTTAAGTTTGGTAGAATTTGG - Intergenic
931134397 2:59380308-59380330 TTTATAAGTTTGGTAGAATTTGG - Intergenic
931480720 2:62636820-62636842 TTTGTACGTCTGGTAGAATTTGG - Intergenic
931528232 2:63182728-63182750 TTTGTAGATTTGGTAGAATTTGG + Intronic
931566964 2:63624733-63624755 TTTGTACCTTTGGTAGAATTCGG - Intronic
931642119 2:64391140-64391162 TTTGAAAGATAGATAGAATTGGG + Intergenic
932371738 2:71195309-71195331 TTTGTATGTCTGGTAGAATTTGG + Intronic
932511961 2:72301435-72301457 TTTGTTCATCTGGTAGAATTTGG + Intronic
932607890 2:73176624-73176646 CTTGATAGGTGGGCAGAATTTGG - Intergenic
933323731 2:80810075-80810097 TTTGTAACTCTGGTAGAATTCGG - Intergenic
933516457 2:83309799-83309821 TTTGATATTTTAGTAGAGGTGGG + Intergenic
934325504 2:92010417-92010439 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
934463853 2:94241035-94241057 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
934591783 2:95559294-95559316 TTTGTATGTCTGGTAGAATTTGG + Intergenic
935381725 2:102458633-102458655 TTTAAATGTTTGATAGAATTAGG - Intergenic
935476962 2:103534568-103534590 TTTGAATGTCTGCTAGAATTTGG + Intergenic
935859589 2:107314049-107314071 TTTGTAAGTTTGGTCAAATTTGG + Intergenic
936003570 2:108860889-108860911 TTTGTTCATCTGGTAGAATTTGG + Intronic
936696496 2:114955498-114955520 TTTAAATGTTTGGTAGAATTCGG - Intronic
936819826 2:116506808-116506830 TTTGAACATCTGGTAGAATTTGG + Intergenic
937518124 2:122678974-122678996 AATGATAGGTTGGTAGGATTTGG + Intergenic
937587074 2:123565882-123565904 TTTGTTTGTTTGGCAGATTTTGG + Intergenic
937602809 2:123759368-123759390 TTTCAATGTCTGGTAGAATTTGG - Intergenic
937893622 2:126960206-126960228 TTTGTACCTTTGGTAGAATTTGG + Intergenic
938165783 2:129025222-129025244 TTTGTATGTCTGGTAGAATTTGG + Intergenic
938822314 2:134971511-134971533 TTTATGAGTTTGGTAGAATATGG + Intronic
938975830 2:136477341-136477363 TTTGTATATTTGGTAGAATTTGG + Intergenic
939033587 2:137104961-137104983 TTTGAACCTCTGGTAGAATTCGG - Intronic
939247253 2:139641724-139641746 TTTGTATGTCTGGTAGAATTTGG + Intergenic
939376291 2:141372468-141372490 TTTGTATGTTTGGTAGAATTTGG + Intronic
939468598 2:142590296-142590318 TTTAATGATTTGGTAGAAATAGG + Intergenic
939494498 2:142912137-142912159 TTTGTAAGTCTGATAGAATTTGG + Intronic
939674618 2:145056605-145056627 TTTGATAAGTTGGATGAATTGGG - Intergenic
939937435 2:148310233-148310255 TTTGTACCTTTGGTAGAATTCGG + Intronic
940431083 2:153590387-153590409 TTTGTATATTTGGTAGAATTTGG - Intergenic
940454771 2:153882797-153882819 TTTTATAATTTTGTAGAAATGGG + Intronic
940527948 2:154841520-154841542 TTTGTACCTTTGGTAGAATTTGG + Intronic
940762684 2:157754662-157754684 TTTGAATGTCTGATAGAATTCGG - Intronic
941123979 2:161563762-161563784 TTTGTATGTTTGGTAGAATTTGG + Intronic
941132082 2:161663870-161663892 TTTGATGTTTATGTAGAATTGGG + Intronic
941467805 2:165850820-165850842 TGTGTAAGTTTGGTAGAATTTGG + Intergenic
941563558 2:167079420-167079442 TTTGTACGTCTGGTAGAATTCGG + Intronic
941583430 2:167328309-167328331 TTTATACGTTTGGTAGAATTTGG + Intergenic
941608796 2:167634755-167634777 TTTGTACCTTTGGTAGAATTAGG - Intergenic
942411376 2:175712669-175712691 TTTGTACCTTTGGTAGAATTCGG - Intergenic
942456080 2:176139437-176139459 CTTGATAGTTTTGCAGAATGAGG + Intergenic
942566875 2:177274081-177274103 TATGATAATTTGATAGAATCTGG - Intronic
942598288 2:177613506-177613528 TTGGAAAATTTGGAAGAATTGGG + Exonic
943102274 2:183501894-183501916 TTTGAATGTTTTGTAGAATTCGG + Intergenic
943375161 2:187067472-187067494 TTTGTACATTTGGTAGAATTTGG + Intergenic
943695745 2:190928645-190928667 TTTTATAGTTTGTTTGACTTAGG + Intronic
943714521 2:191135774-191135796 TATGAAAGTTTGATAGAATTTGG - Intronic
943818103 2:192281850-192281872 TTTGTATGTTTGGTATAATTTGG + Intergenic
944001594 2:194845076-194845098 TTTTGTGGTTTGGGAGAATTAGG - Intergenic
944213188 2:197227551-197227573 TAAAATAGTTTAGTAGAATTGGG - Intronic
944259708 2:197663399-197663421 TTTGTATGTTTGGTAGAATGTGG + Intronic
944370485 2:198976921-198976943 TTTGAATGTCTGGTAGAATTTGG - Intergenic
944647425 2:201793500-201793522 TTTAATAGTTAAGTAGAATAAGG - Intronic
945031595 2:205669489-205669511 GGTGTTAGTTTGGTAGAGTTTGG + Intergenic
945789724 2:214290004-214290026 TTTATATGTTTGGTAGAATTTGG + Intronic
945970860 2:216229964-216229986 TTTGAAAGTTTGGTAGAATTTGG + Intergenic
946454793 2:219816097-219816119 TTTGTAACTCTGGTAGAATTCGG + Intergenic
946490280 2:220142656-220142678 TTTAAATGTTTGGTAGAATTTGG + Intergenic
946789897 2:223290197-223290219 TTTGTAACTCTGGTAGAATTCGG + Intergenic
946997155 2:225406587-225406609 TTTAATACTTTTCTAGAATTAGG + Intronic
947065840 2:226224836-226224858 TTTGTTTTTTTGGTAGAAATGGG - Intergenic
947131333 2:226929056-226929078 TTTGAATGTCTGGTAGAATTTGG - Intronic
947413939 2:229873380-229873402 TTGGATAGTTAGGTAGGTTTAGG - Intronic
948073439 2:235146145-235146167 ATTTATAGTTTGGTAAGATTGGG - Intergenic
948176592 2:235948353-235948375 TTTGTATGTTTGGTAGAAATGGG + Intronic
1169004133 20:2192740-2192762 TGTGCTTGTTTGGTAGCATTTGG + Intergenic
1169412726 20:5386422-5386444 TTTGTAAGTTTGGCAGACTTTGG - Intergenic
1169849070 20:10031064-10031086 TTTGAGAATCTGGTAGATTTTGG - Intronic
1169940387 20:10930880-10930902 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1170086684 20:12541261-12541283 TTTAAATGTATGGTAGAATTCGG + Intergenic
1170138149 20:13098554-13098576 TTTGAGAGCTTTGTAAAATTGGG - Intronic
1170240456 20:14160309-14160331 TTTGGAAGTTTGGTAGAATTCGG + Intronic
1170564535 20:17589747-17589769 TTTGAGAAGTTGGTAGAAGTAGG + Intronic
1170747476 20:19113508-19113530 TGTGACAGTTTGATAGAATATGG + Intergenic
1170754411 20:19186737-19186759 TTTTATAGTTTGTTACATTTAGG + Intergenic
1170966224 20:21074027-21074049 TTTGTTCGTTTTGTAGAAATGGG - Intergenic
1171060493 20:21953622-21953644 TTTGTAAGTTTGATAGACTTAGG + Intergenic
1171237997 20:23543592-23543614 TTAAATATTTTGGCAGAATTTGG - Intergenic
1172607138 20:36221649-36221671 TGGGATAGTTTGGTAGTTTTGGG + Intronic
1173294442 20:41743765-41743787 TTTGTACATTTGGTAGAATTTGG + Intergenic
1173586036 20:44183978-44184000 TTTAATTTTTTGGTAGAAATGGG - Intronic
1174808988 20:53629760-53629782 TTTGGTTGTTTGTTAGGATTTGG + Intergenic
1174842027 20:53910107-53910129 TTTGATGTTTTGGTAGAGATGGG + Intergenic
1175041276 20:56053435-56053457 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1175078827 20:56400737-56400759 TTTAATAATTAGTTAGAATTTGG + Intronic
1175358144 20:58385270-58385292 TTTGAAAGTTTTGTAGAGATGGG - Intergenic
1176317595 21:5261940-5261962 TTTGTACATTTGGTAGAATTTGG + Intergenic
1176333573 21:5574640-5574662 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1176350505 21:5791070-5791092 TTTGTACATTTGGTAGAATTTGG + Intergenic
1176357319 21:5911654-5911676 TTTGTACATTTGGTAGAATTTGG + Intergenic
1176394184 21:6246312-6246334 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1176403777 21:6343153-6343175 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1176433380 21:6645951-6645973 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1176467235 21:7069862-7069884 TTTGTACCTTTGGTAGAATTCGG + Intronic
1176490796 21:7451640-7451662 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1176509846 21:7686743-7686765 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1176544826 21:8189140-8189162 TTTGTACATTTGGTAGAATTTGG + Intergenic
1176563777 21:8372185-8372207 TTTGTACATTTGGTAGAATTTGG + Intergenic
1176594919 21:8684200-8684222 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1176694257 21:9955281-9955303 TTTGAATGTCTGGTAGAATTTGG + Intergenic
1176803975 21:13462329-13462351 TTCCATAGTTGGGTAGAACTGGG - Intergenic
1176876315 21:14133061-14133083 CTTGTGTGTTTGGTAGAATTTGG - Intronic
1176919866 21:14675175-14675197 TTTGACTGATTGATAGAATTTGG - Intergenic
1177104640 21:16939773-16939795 TTTAAATATTTGGTAGAATTTGG + Intergenic
1177208627 21:18041969-18041991 TTTAATTTTTAGGTAGAATTTGG + Intronic
1177458616 21:21379025-21379047 TTTTAAAGTTTTGTAGATTTTGG + Intronic
1177463567 21:21444420-21444442 TTTGTAACTCTGGTAGAATTTGG + Intronic
1177566837 21:22834105-22834127 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1177662236 21:24099977-24099999 TTTGTACGTCTGGTAGAATTTGG + Intergenic
1177871597 21:26579502-26579524 ATTGGTAGTTTGATAGAAATAGG + Intergenic
1177884075 21:26727727-26727749 TTTGACTGTCTTGTAGAATTCGG + Intergenic
1178160030 21:29901698-29901720 TTTGAACTTCTGGTAGAATTCGG - Intronic
1178445274 21:32635053-32635075 TTTTATAATTTTGTTGAATTAGG + Intronic
1179252347 21:39682527-39682549 TTTTTTATTTTTGTAGAATTGGG - Intergenic
1180277773 22:10661359-10661381 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1180287411 22:10761232-10761254 TTGTATATTTTGGTAGAAATGGG - Intergenic
1180452423 22:15477713-15477735 TTTGCTAGTTTGGTCAACTTTGG + Intergenic
1181158909 22:20944886-20944908 TTTTGTATTTTAGTAGAATTGGG + Intronic
1181326044 22:22046948-22046970 TTTGCTTGTTTGTTAGAATTTGG - Intergenic
1181965696 22:26655247-26655269 TTTTATAGGTTTGTTGAATTGGG + Intergenic
1182184287 22:28385932-28385954 TTAGAAAGTTTGGAAGATTTTGG - Intronic
1182382277 22:29901719-29901741 TTTGTTTGTTTGATAGAAATGGG + Intronic
1183758670 22:39795345-39795367 TTCATAAGTTTGGTAGAATTTGG + Intronic
1184625623 22:45726248-45726270 TTTGAATGTCTGGTGGAATTTGG + Intronic
1184749421 22:46476422-46476444 TTTTATATTTTGGTAGAGATGGG - Intronic
1203249696 22_KI270733v1_random:105378-105400 TTTGTACATTTGGTAGAATTTGG + Intergenic
949149981 3:754906-754928 TTTGTAAATTTGGTGGAATTTGG + Intergenic
949150590 3:761992-762014 TTTGTACCTTTGGTAGAATTTGG - Intergenic
949555660 3:5150159-5150181 CTTTAATGTTTGGTAGAATTAGG + Intronic
949640721 3:6033028-6033050 TTTGTACCTTTGGTAGAATTCGG + Intergenic
949661762 3:6287174-6287196 TTATATAGTCTGGTAGAACTTGG - Intergenic
949661829 3:6288242-6288264 ATTGGTAGTTTGATAGAAATAGG - Intergenic
950243434 3:11392807-11392829 TTTGTTTGTTTGGTAGAAACTGG + Intronic
951143374 3:19195569-19195591 CTTTATATTTTGGCAGAATTTGG + Intronic
951477523 3:23124313-23124335 TTTGATACTTTGTTAGGTTTTGG + Intergenic
951609102 3:24471431-24471453 ATTGATAGTCTTTTAGAATTTGG + Intronic
951628787 3:24696005-24696027 TTTGTACCTTTGGTAGAATTTGG + Intergenic
951885108 3:27516555-27516577 TTTGCTAGTATGCTAGTATTTGG + Intergenic
951947836 3:28162070-28162092 TTTGTACATTTGGTAGAATTTGG - Intergenic
952543463 3:34393634-34393656 CTTATAAGTTTGGTAGAATTGGG + Intergenic
952861249 3:37814392-37814414 TTTTATATTTTGGTAGAGATGGG - Intronic
953226114 3:41022948-41022970 TTTTATTGTTTTGTAGAAATGGG + Intergenic
953280588 3:41551674-41551696 TTTGAAAGTTTGGTAGAATTGGG - Intronic
953380170 3:42464612-42464634 TTTGTACGTTTGGTAGAATTTGG - Intergenic
953403655 3:42649396-42649418 CTTGATAGTTGGGCAGTATTGGG + Intergenic
953636428 3:44669074-44669096 TTTGTTATTTTGATAGAAATTGG + Intergenic
954335868 3:49917131-49917153 TTGTATTTTTTGGTAGAATTAGG + Intronic
954517672 3:51193502-51193524 TTTTTACGTTTGGTAGAATTTGG + Intronic
955243833 3:57205235-57205257 TTTAATTGTTTTGTAGAGTTGGG - Intronic
955425220 3:58781837-58781859 TTTGAAAGCTTGGTGGAATTTGG - Intronic
955786472 3:62545764-62545786 TTTTATAGTTTGGAAAACTTGGG - Intronic
955877163 3:63503754-63503776 TTTGTTAGTTTGTTAGTTTTAGG - Intronic
955932265 3:64068870-64068892 TTTGAAAGTTTGGTAGAAGTTGG + Intergenic
956031937 3:65047797-65047819 TTCTATATTTTGGGAGAATTTGG + Intergenic
956110706 3:65867561-65867583 TTTAATTATTTGGTAGAATCAGG - Intronic
956260855 3:67339485-67339507 TTTGTATGTGTGGTAGAATTTGG - Intergenic
956303671 3:67800668-67800690 TTTGTACATTTGGTAGAATTTGG + Intergenic
956356042 3:68393415-68393437 TTTGAAAGTCTGGTAGAATTTGG - Intronic
956833063 3:73072586-73072608 GTTGATAGTATGGTTAAATTAGG - Intergenic
957659272 3:83126038-83126060 TCTGATGTTTTGGTACAATTTGG + Intergenic
957692111 3:83584737-83584759 TTTAAATGATTGGTAGAATTTGG + Intergenic
957814192 3:85271395-85271417 TTCAATAATTTGTTAGAATTAGG + Intronic
957929317 3:86857888-86857910 TTTAAGTGTTTTGTAGAATTTGG + Intergenic
958002579 3:87769814-87769836 TTTGAATGTTTTATAGAATTTGG + Intergenic
958005704 3:87808205-87808227 TTTGACAGTTTGATAGAATTTGG + Intergenic
958434202 3:94077526-94077548 TTTGTACGTTTGGTAGAATTCGG + Intronic
958520600 3:95181548-95181570 TTTGTAACTTTGGTAGAATTTGG + Intergenic
958639796 3:96791125-96791147 TTTGAAAGTTTGGTAGTATTTGG + Intergenic
959046381 3:101478600-101478622 TTTGTAAGTTTGGTAGAAATTGG - Intronic
960018273 3:112917911-112917933 TTTGTGCCTTTGGTAGAATTTGG - Intergenic
960099489 3:113725124-113725146 TTTGATACTTTGTTAGAAATTGG - Intronic
960283275 3:115799625-115799647 TTTGATAGATTGGTAATATAAGG + Intergenic
960468393 3:118027639-118027661 TTTGAACATGTGGTAGAATTTGG + Intergenic
960489242 3:118292103-118292125 TTTGAACATCTGGTAGAATTTGG + Intergenic
960782825 3:121338953-121338975 TTTGAATGTCTGGTAGAATTTGG - Intronic
960848410 3:122026376-122026398 TTTGACAGTTATGTAGAATGTGG + Intergenic
960861392 3:122157600-122157622 TTTGAATGTTTGGTAAAATTTGG + Intergenic
960929898 3:122836583-122836605 TTTGAACCTCTGGTAGAATTCGG + Intronic
961635926 3:128332620-128332642 TTTTATACTTTTGTAGAGTTGGG + Intronic
961718571 3:128876148-128876170 TTTGATGGTTTGGTGGTCTTTGG + Intergenic
961758164 3:129143333-129143355 TTTTATATTTTAGTAGAGTTGGG - Intronic
962192436 3:133325839-133325861 TTTGATAATATTGAAGAATTGGG + Intronic
962326477 3:134437941-134437963 TTTGATATTAGGGCAGAATTTGG - Intergenic
962483653 3:135820393-135820415 TTGAAAAGTTCGGTAGAATTTGG - Intergenic
962504615 3:136033474-136033496 TTTGAATGTCTGGTAGAATTCGG + Intronic
962592121 3:136901466-136901488 TATGAGTGTTTGGTAGAATTTGG + Intronic
962734433 3:138312634-138312656 TTTGATAGTTTCATAGTATCAGG - Intronic
962766579 3:138569485-138569507 TTTAATAGTTTTTTAAAATTAGG + Intronic
962821434 3:139051154-139051176 TTTGTATATTTGGTAGAATTTGG + Intronic
962833851 3:139169057-139169079 TTTGTACCTTTGGTAGAATTCGG + Intronic
962979794 3:140477727-140477749 TTAGATAGTTTGGCAGAACTGGG + Intronic
963210816 3:142687891-142687913 TTTCATAGTTTATTTGAATTAGG + Intronic
963217881 3:142771345-142771367 TTTGTTTGTTTGGTAGAGATGGG + Intronic
963373234 3:144429092-144429114 TTTGATAGTTTAGAACAAGTGGG + Intergenic
963527916 3:146437364-146437386 TTTGTACGTCTGGTAGAATTTGG + Intronic
963561510 3:146871963-146871985 TTTGTATGTTTGGTAGAATTTGG + Intergenic
963653669 3:148017774-148017796 TTTGAAAGTTAGGTAGAATTTGG - Intergenic
963676909 3:148323570-148323592 TTTGTAAATCTGGTAGAATTTGG + Intergenic
963797241 3:149643013-149643035 TTTGCTAATTTGGGAGCATTTGG - Intronic
963980580 3:151532234-151532256 TTGGTTACTCTGGTAGAATTCGG - Intergenic
964059050 3:152499202-152499224 TTTGCTAGTTTGTGAGTATTAGG + Intergenic
965064293 3:163826360-163826382 TTTGTACGTTTGGTAGATTTTGG + Intergenic
965297010 3:166960215-166960237 TTTGATATAATGCTAGAATTTGG + Intergenic
965491508 3:169342439-169342461 TTTTATAATTTGGTAGAGTTAGG - Intronic
965849958 3:173010989-173011011 TTTGTATATTTGGTAGAATTTGG - Intronic
966291499 3:178364687-178364709 TTTGTAACTCTGGTAGAATTCGG - Intergenic
966361392 3:179133133-179133155 ATTGAAAGTTTAGTAGAATTTGG - Intergenic
966468477 3:180260023-180260045 TTTAAGTGTTTGGTAGAATTTGG - Intergenic
966587751 3:181646172-181646194 TTTGCTGTTTTGGTAGAATTTGG - Intergenic
966694342 3:182774562-182774584 TTTGAAAGTTTGGTAGAATTTGG + Intergenic
966962202 3:184951312-184951334 TTTGATATTTTTGTAGAGATGGG - Intronic
967086756 3:186102108-186102130 TTTGTAAGTTTCTTAGAATTGGG - Intronic
967239225 3:187420433-187420455 TTTGAATGTCTGGTAGAATTTGG - Intergenic
967255227 3:187584598-187584620 TTTGTTCATCTGGTAGAATTTGG + Intergenic
967454108 3:189661662-189661684 TTTGTATGTCTGGTAGAATTTGG + Intronic
968255493 3:197266188-197266210 CTTGATAATTTGGATGAATTTGG - Intronic
969063834 4:4461501-4461523 TTTGTTAGTTTGACATAATTAGG - Intronic
969120604 4:4907347-4907369 TTTAAATATTTGGTAGAATTTGG - Intergenic
969169816 4:5352003-5352025 TTTGGAAGTTTGGTATAATTTGG - Intronic
970153140 4:13111752-13111774 TTTGGATGTCTGGTAGAATTTGG - Intergenic
970759916 4:19472402-19472424 TTTGTATGTCTGGTAGAATTGGG - Intergenic
970773538 4:19644516-19644538 ATTGTTTGTTTAGTAGAATTTGG + Intergenic
970917110 4:21348915-21348937 TTTGATAGTTTGGTTGAAGCTGG + Intronic
971151277 4:24034360-24034382 TTTAATAGTTTGTTTGAATGAGG - Intergenic
971542978 4:27844975-27844997 TTTCATTTTTTGGTAGAAATGGG + Intergenic
971744569 4:30562980-30563002 TTTGCATGTTTGATAGAATTTGG - Intergenic
971933115 4:33111576-33111598 TTTGTATGTTTGGTAGAATTCGG + Intergenic
972007287 4:34126352-34126374 TTTTATAGTTTGAAATAATTTGG + Intergenic
972284564 4:37635853-37635875 TCTGATAATTTGATGGAATTTGG - Intronic
972471203 4:39406050-39406072 TTTGATTTTTTGGTAGAGGTGGG - Intergenic
972664801 4:41154705-41154727 TTAGACATTTTGGCAGAATTTGG + Intronic
972824398 4:42740024-42740046 TCTTATATGTTGGTAGAATTTGG - Intergenic
972837100 4:42885023-42885045 TTTGTAAGTTTGGTAGAATTTGG + Intergenic
972997557 4:44900334-44900356 TTTCAGAGTTTGATAAAATTTGG + Intergenic
973020860 4:45204906-45204928 TTTGTATGTTTGGTAGAATTTGG + Intergenic
973049860 4:45583537-45583559 TTTATTAATTTGGTAGAATTCGG + Intergenic
973129835 4:46636714-46636736 AGTGATATTTTGCTAGAATTTGG + Intergenic
973367263 4:49217951-49217973 TTTGACATTCTGGTAGGATTGGG - Intergenic
973666404 4:53163814-53163836 GATGGTAGTTTGGCAGAATTTGG + Intronic
973678955 4:53296225-53296247 TTTGTAACTGTGGTAGAATTTGG + Intronic
974126544 4:57703603-57703625 TTTGTACTTTTGGTAGAATTTGG + Intergenic
974280258 4:59782850-59782872 TTTGTAACTCTGGTAGAATTTGG - Intergenic
974589881 4:63932526-63932548 TTTGAAAGTTCGGTAGAATTTGG - Intergenic
974606662 4:64160535-64160557 TTTGATCGTCTGATATAATTTGG + Intergenic
974621748 4:64364809-64364831 TTTGAAAGTCTGGTAGAGTTTGG - Intronic
975410914 4:74048546-74048568 TTTGTACATTTGGTAGAATTTGG + Intergenic
975778494 4:77816248-77816270 TTTTTTAATTTGGGAGAATTGGG - Intronic
975807130 4:78124561-78124583 TTTGTACCTTTGGTAGAATTAGG + Intronic
976374969 4:84335627-84335649 TTTAAATGTCTGGTAGAATTTGG + Intergenic
976457941 4:85271294-85271316 TTTGTATGTCTGGTAGAATTTGG - Intergenic
976459171 4:85287906-85287928 TTTGTATGTCTGGTAGAATTTGG + Intergenic
976819484 4:89188964-89188986 TTTGTACTTTTGGTAGAATTTGG + Intergenic
976976973 4:91177407-91177429 TTTGTACGTCTGGTAGAATTTGG + Intronic
977139066 4:93343685-93343707 TTTAAATGTTTGGTAGATTTGGG + Intronic
977477385 4:97529570-97529592 TTTGCATGTCTGGTAGAATTCGG + Intronic
977517032 4:98033506-98033528 TTTGTACCTTTGGTAGAATTTGG - Intronic
977517662 4:98041921-98041943 TTTGTATGTTTGGTAGAATTTGG + Intronic
977519197 4:98059457-98059479 TTTGTAAATTTGGTAGAATTTGG - Intronic
978004534 4:103600043-103600065 TTTGTAACTCTGGTAGAATTCGG + Intronic
978085560 4:104648488-104648510 TTTAAAAGTTTGATGGAATTTGG - Intergenic
978137925 4:105285306-105285328 TTTGTACATTTGGTAGAATTTGG + Intergenic
978205004 4:106070731-106070753 TTTGTAATTCTGGTAGAATTGGG + Intronic
978458906 4:108928718-108928740 TTTGTTTGTTTTGTAGAAATGGG + Intronic
978561458 4:110038233-110038255 TTTTTTAGTTTTGTAGAAATGGG + Intergenic
978689010 4:111484074-111484096 TTTGACAGTGTGGTGGAAATAGG - Intergenic
978783629 4:112583632-112583654 TTTGAAATTTTTGTAGAGTTGGG - Intronic
978910357 4:114055590-114055612 TTTGTAAGTTTGATAGAATTTGG + Intergenic
978921659 4:114190805-114190827 CTTGATATTTTTCTAGAATTCGG - Intergenic
978973123 4:114834701-114834723 TTTGTAACTCTGGTAGAATTCGG + Intronic
979480886 4:121215939-121215961 TTTGAAAGATTGATAGAATGTGG + Intronic
979750380 4:124271954-124271976 TTTGTAACTCTGGTAGAATTCGG + Intergenic
979876306 4:125896058-125896080 TTTGTAGGTCTGGTAGAATTCGG - Intergenic
979900291 4:126207356-126207378 TTTGTTCCTCTGGTAGAATTCGG + Intergenic
979903090 4:126248363-126248385 TTTACAGGTTTGGTAGAATTTGG + Intergenic
979903978 4:126260438-126260460 TTGTATATTTTGGTATAATTGGG + Intergenic
979930295 4:126621623-126621645 TTTGTATGTCTGGTAGAATTTGG - Intergenic
980020290 4:127701381-127701403 TTTAAAAGTTTGTTTGAATTAGG - Intronic
980088099 4:128412794-128412816 TTTGAACATGTGGTAGAATTAGG + Intergenic
980147844 4:129011625-129011647 TTTGTATATTTGGTAGAATTTGG + Intronic
980197700 4:129612780-129612802 TTTGGTAGTTTGATAGGAATAGG + Intergenic
980366876 4:131815479-131815501 TTTGAATGTCTGATAGAATTTGG + Intergenic
980437282 4:132793838-132793860 TTTGTATGTTTGGTAGAATTTGG - Intergenic
980538597 4:134163409-134163431 TTTGAATGTCTGGTAGAATTTGG - Intergenic
980649207 4:135688258-135688280 TTTGTATGTCTGGTAGAATTTGG + Intergenic
980693934 4:136331407-136331429 TTTGTACATTTGGTAGAATTTGG - Intergenic
980863335 4:138525063-138525085 TTTGTACATTTGGTAGAATTTGG - Intergenic
980864024 4:138532661-138532683 TTTGATATTTGGGCAGTATTGGG - Intergenic
980956230 4:139431889-139431911 TTTAAATGTTTGGTAAAATTTGG + Intergenic
981139269 4:141249484-141249506 TTTAAAGGTCTGGTAGAATTTGG + Intergenic
981166080 4:141559154-141559176 TTTATAGGTTTGGTAGAATTTGG - Intergenic
981203450 4:142011148-142011170 TTTTATTGTTTTGTTGAATTTGG + Intergenic
981280285 4:142949668-142949690 TTTGCAAGTCTGGTAGATTTTGG - Intergenic
981284795 4:143004093-143004115 TTTGGGAGTTTGGGAGAGTTTGG - Intergenic
981287770 4:143039996-143040018 TTTATATGTTTGGTAGAATTTGG - Intergenic
981738735 4:147980622-147980644 TTTGTAAGCCTGGTAGAATTTGG + Intronic
981859524 4:149338165-149338187 TTTGTAACTCTGGTAGAATTCGG + Intergenic
981923533 4:150113331-150113353 TTTGAATGTTTGATAGAATTTGG + Intronic
982039184 4:151378480-151378502 TTTGTACATTTGGTAGAATTTGG - Intergenic
982418192 4:155161919-155161941 TTTGATATTTTAGATGAATTTGG - Intergenic
982531796 4:156554482-156554504 TTTGAATGTTTGGTAGAATTTGG + Intergenic
982632179 4:157844716-157844738 TTTGAAAGTTTGTCAGTATTAGG + Intergenic
982859971 4:160436401-160436423 CTTGAAACTCTGGTAGAATTCGG - Intergenic
982939626 4:161533627-161533649 TTTGTATGTCTGGTAGAATTTGG - Intronic
983076044 4:163328795-163328817 TTTGAAAGATGGGTAGAGTTTGG - Intronic
983486664 4:168340098-168340120 TTTGATAGTGTTTTAGATTTTGG + Intergenic
983949643 4:173624258-173624280 TTTGTATGTTTGGTGGAATTTGG + Intergenic
984967544 4:185153328-185153350 TTTGTATGTCTGGTAGAATTTGG - Intergenic
985118267 4:186613727-186613749 TTTTGTATTTTGGTAAAATTGGG - Intronic
985572471 5:656030-656052 TTTTATAGTTTTGTATATTTTGG + Intronic
986149759 5:5116893-5116915 TTTGTATGTCTGGTAGAATTTGG + Intergenic
986244559 5:5994656-5994678 TTTGTATGTCTGGTAGAATTTGG + Intergenic
986634317 5:9805298-9805320 TTTGAATGTCTGATAGAATTCGG - Intergenic
987106342 5:14643540-14643562 TTTGTGTGTTTGGTAGAATTTGG + Intergenic
987916587 5:24223050-24223072 TTTGAATGTCTGTTAGAATTTGG + Intergenic
987956947 5:24752377-24752399 TTTGTAACTCTGGTAGAATTCGG + Intergenic
988076006 5:26355729-26355751 TGTGAAAGTTAGGTAGACTTTGG + Intergenic
988309434 5:29538746-29538768 TTTGAACCTCTGGTAGAATTCGG + Intergenic
988332366 5:29858585-29858607 TTTGAACTTCTGGTAGAATTCGG - Intergenic
988667254 5:33342658-33342680 TTTGTAACTCTGGTAGAATTAGG - Intergenic
988840462 5:35078611-35078633 TTTGTACGTCTGGTAGAATTCGG - Intronic
989311495 5:40023942-40023964 TTTGTATGTCTGGTAGAATTTGG + Intergenic
989364264 5:40638009-40638031 TTTGTACGTCTGGTAGAATTCGG - Intergenic
989365883 5:40654598-40654620 TTTGAATGTTTGGTAAAAGTTGG - Intergenic
989498314 5:42135734-42135756 TTTGAAAGTTTGATAGAATTTGG - Intergenic
990022821 5:51149008-51149030 TTTGTATGTTTGGTAGAATTTGG - Intergenic
990234737 5:53754989-53755011 TTTGTAACTCTGGTAGAATTTGG - Intergenic
990281535 5:54256473-54256495 CTTGAATGTCTGGTAGAATTCGG - Intronic
990337603 5:54790325-54790347 TTTGTTCCTCTGGTAGAATTCGG + Intergenic
990340371 5:54816498-54816520 TTTGTTCCTCTGGTAGAATTCGG - Intergenic
990628950 5:57646356-57646378 TTTGTAAATTTGGTAGAATTTGG + Intergenic
990668055 5:58095703-58095725 TTTGAAAGGTTGGAAGAATAGGG - Intergenic
991155366 5:63428140-63428162 TTTGAAAGTCTGATAGAATTTGG + Intergenic
991948017 5:71919528-71919550 TTTGAAAGTTTAGTAGAATTCGG - Intergenic
992026892 5:72679212-72679234 TTTGTGTGTTTGGTAGACTTTGG + Intergenic
992130563 5:73688276-73688298 TTTGAGAGGTGGGTAGAAATTGG - Intronic
992287735 5:75252573-75252595 TTTGTTCCTCTGGTAGAATTCGG + Intergenic
992345589 5:75873958-75873980 TTTGTATGTCTGGTAGAATTCGG - Intergenic
992468983 5:77036124-77036146 TTTTATAGTTTGTTTGAATTAGG + Intronic
992705251 5:79384552-79384574 ATTTATTGTTTTGTAGAATTTGG - Intronic
993217382 5:85043843-85043865 TTTGTTTGTCTGGTAGAATTTGG + Intergenic
993438793 5:87929472-87929494 TTTGTATGTCTGGTAGAATTAGG - Intergenic
993442609 5:87975064-87975086 TTTGTATGTCTGGTAGAATTTGG + Intergenic
993529814 5:89010270-89010292 CTTGAAGGTTGGGTAGAATTAGG + Intergenic
993541906 5:89162376-89162398 TTTGTAACTCTGGTAGAATTTGG - Intergenic
993971458 5:94425043-94425065 TCTGAAAGTTTGGCAGAATTTGG - Intronic
994363371 5:98881845-98881867 TTTTATATTTTGGAAGACTTTGG - Intronic
994405266 5:99338028-99338050 TTTGCTAGTTTGTTAGTATATGG - Intergenic
994503622 5:100611689-100611711 TTTGTAAATTTTGTAGAATTTGG + Intergenic
994603626 5:101939732-101939754 TTTGTGTGTCTGGTAGAATTTGG + Intergenic
994654086 5:102567652-102567674 TTTAAATGTTCGGTAGAATTAGG + Intergenic
994770688 5:103977721-103977743 TTTGCATGTTTGGTAGTATTTGG - Intergenic
995002740 5:107154645-107154667 TTTTATAAATTGGGAGAATTTGG - Intergenic
995372106 5:111429864-111429886 TTTAAATGTTTGGTAGAAATTGG - Intronic
995388102 5:111610517-111610539 TTTGAATGCATGGTAGAATTCGG + Intergenic
995892320 5:116968365-116968387 TTTGTTGGTTTGGTTTAATTTGG - Intergenic
996053553 5:118959548-118959570 ATTGGTAGTTTGATAGAAATAGG - Intronic
996262356 5:121488796-121488818 TTGGATAATTTGGAAAAATTTGG - Intergenic
996492977 5:124120492-124120514 TTTGTATGTCTGGTAGAATTTGG + Intergenic
996709607 5:126531165-126531187 TTTATATGTTTGGTAGAATTTGG - Intergenic
996890851 5:128417914-128417936 TTTATAATTTTGGTAGAATTTGG + Intronic
996958492 5:129214504-129214526 TTTAAGTGTTTGGCAGAATTCGG + Intergenic
997006640 5:129824703-129824725 TTTGTACATTTGGTAGAATTTGG - Intergenic
997183922 5:131862038-131862060 TTTATATGTTTGGTAGAATTTGG + Intronic
997802391 5:136878221-136878243 TTTGTATGTTTGATAGAATTTGG - Intergenic
997903083 5:137786490-137786512 TTTGTTCCTCTGGTAGAATTCGG - Intergenic
998290882 5:140913173-140913195 TTTAAATGTTTGGTAGAATTTGG + Intronic
998732151 5:145090806-145090828 TTTGTATGTGTGGTAGAATTTGG + Intergenic
998812612 5:145981412-145981434 TTTGATGGTTTGTTTGAATCAGG + Intronic
999650251 5:153759606-153759628 TTTAACTATTTGGTAGAATTTGG - Intronic
999864005 5:155680454-155680476 TTTGTAAGTTTTGTAGAATTTGG + Intergenic
1000152216 5:158514503-158514525 GTTGATACTTTGGAAGAAGTGGG - Intergenic
1000158934 5:158581124-158581146 TTTAAATATTTGGTAGAATTCGG + Intergenic
1000428817 5:161125659-161125681 TTAGTATGTTTGGTAGAATTTGG + Intergenic
1000572599 5:162934125-162934147 TTTATAACTTTGGTAGAATTAGG + Intergenic
1000650957 5:163818078-163818100 TTTAAATGTTTGGTAGAATTTGG + Intergenic
1001145699 5:169182512-169182534 TTTGAAATTATGCTAGAATTTGG + Intronic
1001595238 5:172894499-172894521 TTTCAAAGTTTGGGAGAAATTGG + Intronic
1002788520 6:422064-422086 TTTGTTATTTTAGTAGAAATGGG + Intergenic
1002959487 6:1900629-1900651 TTTGAAAGATTAGTAGAAGTTGG - Intronic
1003156395 6:3599727-3599749 TTTGTAAGTTTGCTAGAATTTGG + Intergenic
1003575560 6:7291225-7291247 TTTTATAGTTTAGTAGAGATGGG - Intronic
1004843983 6:19618491-19618513 TTTGCATGATTGGTAGAATTTGG - Intergenic
1004872162 6:19917185-19917207 TTTGTAAGTCTAGTAGAATTTGG - Intergenic
1004926415 6:20419735-20419757 TTTCATATTTTAGTAGAGTTGGG + Intronic
1004929830 6:20452136-20452158 TTTGTACGTCTGGTAGAATTTGG + Intronic
1005072032 6:21870868-21870890 TTTTATATTTTAGTAGAGTTGGG + Intergenic
1005104145 6:22205177-22205199 TTTCTTAGTTTGTTAGACTTTGG + Intergenic
1005159302 6:22840374-22840396 TTTGTATGTTTGATAGAATTTGG - Intergenic
1005243902 6:23859917-23859939 TGACATAGCTTGGTAGAATTAGG + Intergenic
1006760294 6:36454814-36454836 TTTCATATTTCTGTAGAATTGGG + Intronic
1008139040 6:47810724-47810746 TCTGAGATTTTGGTAGAAGTTGG + Intronic
1008155861 6:48013162-48013184 TTTGTAACTCTGGTAGAATTCGG + Intronic
1008204027 6:48630942-48630964 ATTGATAGTTTTGTTGACTTTGG - Intergenic
1008871181 6:56273769-56273791 TTTGAATGCCTGGTAGAATTTGG - Intronic
1008973013 6:57391916-57391938 ATTGATAGTTTGATAGGAATAGG + Intronic
1009161920 6:60293447-60293469 ATTGATAGTTTGATAGGAATAGG + Intergenic
1009245755 6:61235512-61235534 TTTGAATGTTTGGTAAAATCTGG - Intergenic
1009341990 6:62567238-62567260 TTTCATATTTTAGTAGAAATTGG + Intergenic
1009675108 6:66809735-66809757 TTTGATAGTTAGGCAGATATAGG - Intergenic
1009740534 6:67737856-67737878 TTTGCACATTTGGTAGAATTTGG - Intergenic
1009889242 6:69660272-69660294 TTTTGTACTCTGGTAGAATTTGG - Intergenic
1009943917 6:70321109-70321131 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1010629219 6:78177020-78177042 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1010936920 6:81873152-81873174 TTTGTAACTTTGGTAGAATTCGG - Intergenic
1010957722 6:82109377-82109399 TTTATAAGTTTGGTAGAATTTGG - Intergenic
1010988775 6:82455973-82455995 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1011027482 6:82885204-82885226 TTTGACAGTTTTTTGGAATTGGG + Intergenic
1011033522 6:82948417-82948439 TTTAAATGTTTGGTAGAATTTGG - Intronic
1011137083 6:84112191-84112213 TTTGTAACTCTGGTAGAATTAGG + Intergenic
1011271347 6:85582825-85582847 TTTGTACCTTTGGTAGAATTTGG - Intronic
1011343531 6:86344510-86344532 TTTTATTGTTTTGTTGAATTTGG - Intergenic
1011364419 6:86565645-86565667 TTTGAATGTCTGGTAGAATGTGG + Intergenic
1011495471 6:87933146-87933168 TTTGATGGTTTGGTTGATTGTGG - Intergenic
1011586984 6:88936842-88936864 CTTAAAAGTTTGGTAGAATTTGG + Intronic
1011834803 6:91418840-91418862 ATTGGTAGTTTGATAGAAATAGG - Intergenic
1011979043 6:93348326-93348348 TTTTATAGTTTGGTATATTTAGG - Intronic
1012016054 6:93853284-93853306 TTTGAATGTTCAGTAGAATTTGG + Intergenic
1012070770 6:94612645-94612667 TTTTATAGTTTGTTTGAAGTTGG - Intergenic
1012222093 6:96661216-96661238 TTTGTAAATCTGGTAGAATTAGG - Intergenic
1012323739 6:97886892-97886914 TCTGATAGTGCTGTAGAATTTGG + Intergenic
1012620353 6:101337043-101337065 TTTAAATGCTTGGTAGAATTCGG + Intergenic
1012653507 6:101786904-101786926 TTTAAAAGTTAGGTAGAATATGG + Intronic
1012799360 6:103805390-103805412 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1012830078 6:104193409-104193431 TTTGAATGTGTGGTAGAATCTGG - Intergenic
1013002845 6:106041977-106041999 TTTGATATTTTTGTAGAGATGGG + Intergenic
1013119352 6:107127445-107127467 TTTGATTATTTGGCTGAATTGGG - Intergenic
1013340468 6:109210008-109210030 TTTAAAAATTTGGTAGAATTCGG + Intergenic
1013387706 6:109648644-109648666 TTTGTACCTTTGGTAGAATTTGG - Intronic
1013433535 6:110078229-110078251 TTTTATACTTTTGTAGAAATGGG + Intergenic
1013672442 6:112420044-112420066 TTTAAGTGTTTGGTAAAATTTGG + Intergenic
1013672737 6:112422514-112422536 TTTGATAAATTGATAGAAGTAGG + Intergenic
1013734961 6:113214950-113214972 TTTGAACCTCTGGTAGAATTTGG + Intergenic
1013847248 6:114467917-114467939 TTTGTTTGTTTTGTAGAAATAGG - Intergenic
1014059759 6:117057906-117057928 TTTGAAAGTTTAGTCGAATTTGG + Intergenic
1014275542 6:119384106-119384128 TTTAAATGTTTGGTAGAATTCGG + Intergenic
1014390861 6:120861890-120861912 TTTGAATGTTTGGTAGAATTCGG - Intergenic
1014525693 6:122499117-122499139 TTTGTATGTCTGGTAGAATTAGG - Intronic
1014569366 6:122989755-122989777 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1014643930 6:123950386-123950408 TTTGAAAGTTTGGTAGAATTTGG + Intronic
1015136691 6:129880119-129880141 TTTGTAGGTTTGGTAGAACTTGG + Intergenic
1015141673 6:129941161-129941183 TCTCATAATTTGATAGAATTGGG + Intergenic
1015175255 6:130300012-130300034 TTTGAACATCTGGTAGAATTTGG - Intronic
1015496242 6:133886575-133886597 GTTTATATTTTGGGAGAATTTGG + Intergenic
1015607540 6:134974314-134974336 TTTGAATGTCTGGTAGAATTTGG - Intronic
1016436552 6:144043765-144043787 TTTGTAACTCTGGTAGAATTTGG + Intronic
1016496790 6:144672245-144672267 TTTGAATGTCTGATAGAATTCGG + Intronic
1017060281 6:150477450-150477472 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1017573076 6:155768869-155768891 TTTGAAGGTTTGATAGAATTCGG + Intergenic
1018004366 6:159606910-159606932 TTTAATTGTCTGGAAGAATTTGG + Intergenic
1018049245 6:159994045-159994067 TTTGTACCTTTGGTAGAATTTGG + Intronic
1018267932 6:162045010-162045032 TTTCATAGTTTGGGAAAAATTGG - Intronic
1018349945 6:162946542-162946564 TTTGTAAATTTTGTAGAATTTGG - Intronic
1018496764 6:164355483-164355505 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1018885270 6:167930030-167930052 TTTGATTTTTTTGTAGAAATGGG - Intronic
1020233040 7:6334636-6334658 TTTTATATTTTGGTAGAGATGGG + Intronic
1020574488 7:9908849-9908871 TTTAATAGTTCGGTAAAATTTGG + Intergenic
1020862594 7:13513596-13513618 TTTGAACATTTGGTAGTATTCGG - Intergenic
1021282385 7:18736822-18736844 TTTGTAACTCTGGTAGAATTCGG + Intronic
1021389218 7:20071339-20071361 TTTGTAACTCTGGTAGAATTTGG - Intergenic
1021414245 7:20364010-20364032 TTTGATAGTTAAGTAGGCTTTGG + Intronic
1022009350 7:26295231-26295253 TTTGATACTTTTGTAGAGATGGG + Intronic
1022659203 7:32350493-32350515 TTTTCTAGTTTGTTAGAATCTGG + Intergenic
1022688320 7:32618144-32618166 CTTAAGTGTTTGGTAGAATTTGG - Intergenic
1022870063 7:34468300-34468322 TTTATAAGTTTGGTAGAACTTGG + Intergenic
1023290468 7:38663413-38663435 TTTGAATGTTTGATAGAATTCGG - Intergenic
1023392717 7:39725685-39725707 ATTGAGAGTTTGGGAGAAATAGG + Intergenic
1023440266 7:40178061-40178083 TTTAATAGTTTGTTTGAATCAGG + Intronic
1023714386 7:43028673-43028695 TTTTGTATTTTGGTAGAGTTGGG - Intergenic
1023840538 7:44094936-44094958 TTTGTTTGTTTGTTTGAATTAGG - Intergenic
1024967513 7:55037156-55037178 TTTAATAGATTGGTATAACTTGG + Intronic
1025058956 7:55787859-55787881 TTTGTTTGTTTGGTAGATATGGG + Intergenic
1025118070 7:56275550-56275572 TTTGATTTTTTGGTAGAGATGGG + Intergenic
1026233142 7:68502972-68502994 TTTTATATTTTGGTAGAGATGGG + Intergenic
1026460869 7:70614152-70614174 TATGAAAGTTTGGTGGGATTTGG - Intronic
1026566579 7:71494528-71494550 TTTGTTTGTTTTGTAGAAATGGG + Intronic
1027786241 7:82582238-82582260 TTTGTACCTTTGGTAGAATTAGG + Intergenic
1027910414 7:84243236-84243258 TTTGTAACTCTGGTAGAATTCGG + Intronic
1028057163 7:86260547-86260569 TTTGATGGTTTGGCAGGAGTAGG - Intergenic
1028334496 7:89635209-89635231 TTTGAAAATTTGGTAGAATTTGG + Intergenic
1028383040 7:90220221-90220243 TTTGAAAGTTTGGTAGAATTCGG + Intronic
1028639271 7:93024848-93024870 TTTTATAGTTTGGTAGGAATGGG + Intergenic
1028787259 7:94809604-94809626 TTTGTATGTTTTGTAGAATTTGG - Intergenic
1028792622 7:94870127-94870149 TTTGAATGTCTGATAGAATTTGG + Intergenic
1028816599 7:95153726-95153748 CTTGAAAGTTTGGTAGAATTTGG + Intronic
1028817727 7:95166566-95166588 TTTGAAAGTTTGCTAGAATTTGG - Intronic
1029663201 7:101977467-101977489 TTTGATTTTTTGGTAGAGATGGG - Intronic
1029709558 7:102292215-102292237 TTTGATATTTTGGTAGAGATGGG - Intronic
1030204465 7:106939466-106939488 TTTGGTACTTTTGTAGAAATAGG + Intergenic
1030402176 7:109065414-109065436 TTTGAATGTTTTGTTGAATTTGG + Intergenic
1030455492 7:109767871-109767893 TTTATAAGTGTGGTAGAATTTGG + Intergenic
1030513473 7:110514186-110514208 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1030554319 7:111004334-111004356 TTTTATATTTTTGTAGAAATAGG + Intronic
1031229840 7:119092263-119092285 TTTCATATTTTGGTAGAGATGGG - Intergenic
1031235069 7:119165118-119165140 TTTATATGTTTGGTAGAATTTGG + Intergenic
1031457126 7:121995466-121995488 TGTGATAGTTTGGACTAATTTGG - Intronic
1031504675 7:122567089-122567111 TTTTATTGGTTAGTAGAATTTGG - Intronic
1031559728 7:123224040-123224062 TTTAAATGTTTGGTAAAATTTGG + Intergenic
1031826523 7:126572583-126572605 ATTGATAGTTTTGTTGGATTTGG - Intronic
1031835384 7:126675296-126675318 TTTGAATATATGGTAGAATTTGG - Intronic
1032779644 7:135153926-135153948 TTTGTATGTTTGGTAGAATTTGG + Intronic
1032882880 7:136108390-136108412 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1032901507 7:136314854-136314876 TTTACATGTTTGGTAGAATTTGG + Intergenic
1032942871 7:136815268-136815290 TTTGTAACTCTGGTAGAATTCGG + Intergenic
1033802297 7:144915463-144915485 TGTGATACTGTGTTAGAATTAGG + Intergenic
1033841700 7:145382722-145382744 TTTACATGTTTGGTAGAATTTGG + Intergenic
1034030262 7:147754565-147754587 TTTAATAGTTTGTTTGAATCAGG - Intronic
1034091926 7:148371580-148371602 TTTGATAAATAGGTAGAAATTGG - Intronic
1035177639 7:157063379-157063401 TTTGATATTATTGTATAATTGGG + Intergenic
1035210151 7:157321741-157321763 TTCAAAAGTTTGGTAGAAATGGG + Intergenic
1037049704 8:14356677-14356699 TTTGAACATTTGATAGAATTTGG + Intronic
1037348637 8:17925534-17925556 TTTGAAAGTTTTGTAGAAATTGG + Intronic
1037478650 8:19282896-19282918 TTTGTATGTTTGGTAGAATTTGG + Intergenic
1037529984 8:19763710-19763732 CTTGAAAGGTTAGTAGAATTCGG + Intergenic
1037687051 8:21149633-21149655 TTTGTAACGTTGGTAGAATTTGG - Intergenic
1038363449 8:26906720-26906742 TGTGATTGTTTGGAAGAGTTCGG + Intergenic
1038506443 8:28089036-28089058 TTTGATATCTTGTTAGATTTGGG - Intergenic
1038993256 8:32892787-32892809 TTTGATAGTTTGTTAGATCACGG + Intergenic
1039208116 8:35179844-35179866 TTTGAATATCTGGTAGAATTGGG - Intergenic
1039673112 8:39626003-39626025 TTTGAATATCTGGTAGAATTTGG + Intronic
1039744882 8:40415719-40415741 TTTGTTTGTTTGGAATAATTTGG - Intergenic
1040046600 8:42970956-42970978 TTTGTAATTTTTGTAGAATTGGG + Intronic
1040623504 8:49117066-49117088 TTTGCTAGTTTCTTAGAATTGGG + Intergenic
1040879470 8:52189757-52189779 TTTGATAGAGTGGGAGAATATGG + Intronic
1040942710 8:52849264-52849286 TTTGTAACTCTGGTAGAATTCGG + Intergenic
1041017413 8:53605050-53605072 TTTGAATGTCTGGTAAAATTCGG - Intergenic
1041021069 8:53639307-53639329 TTTGGACCTTTGGTAGAATTTGG + Intergenic
1041027448 8:53701561-53701583 TTTAAATGTTTGGTAAAATTTGG + Intergenic
1041182977 8:55267632-55267654 TGTGATAGTTTGGTGGGTTTAGG + Intronic
1041386086 8:57304773-57304795 TTTTATAGGTTGGTAGACTTTGG + Intergenic
1041715520 8:60928544-60928566 TATGTTAGGGTGGTAGAATTTGG + Intergenic
1041951587 8:63509737-63509759 TTTGATAGGTTGACAGAAGTAGG - Intergenic
1042405606 8:68401997-68402019 TTTGTAGGTTTGGTAAAATTTGG + Intronic
1043124576 8:76374385-76374407 TTTTATAGTTTATTACAATTAGG + Intergenic
1043230808 8:77798522-77798544 TTTGACTGTTTAGTAGGATTTGG + Intergenic
1043244117 8:77976328-77976350 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1043447820 8:80336397-80336419 TTTGATAGTTTTGTTGCAGTTGG - Intergenic
1043617600 8:82145958-82145980 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1043619490 8:82171177-82171199 TTTGTATCTTTGGTAGAATTCGG + Intergenic
1043761342 8:84072363-84072385 TTTGTATGTCTGGTAGAATTAGG + Intergenic
1044072668 8:87781871-87781893 ATTGTAAGTTTGGTAGAATTTGG - Intergenic
1044763111 8:95543216-95543238 ATTGTTAATTTGGTAGAGTTGGG + Intergenic
1044825469 8:96192297-96192319 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1044955866 8:97479498-97479520 TTTGAAGATCTGGTAGAATTTGG - Intergenic
1045590353 8:103587259-103587281 TTTAAATGTTTGGTAGAATTCGG - Intronic
1045610733 8:103838115-103838137 TTTTGTAGTTTTGTAGAAGTAGG + Intronic
1045786074 8:105922082-105922104 TTTGTATGTTTGGTAGAATTAGG - Intergenic
1045802181 8:106114556-106114578 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1046254288 8:111675846-111675868 TTTGTAACTCTGGTAGAATTTGG + Intergenic
1046541144 8:115585491-115585513 TTTGAGAGTATGGTATATTTGGG - Intronic
1047022440 8:120789790-120789812 TTTGAATGTCTGGTAGAATTTGG - Intronic
1047102320 8:121691417-121691439 TTTGTACATTTGGTAGAATTTGG - Intergenic
1047168933 8:122470999-122471021 TTTGTAAATCTGGTAGAATTTGG - Intergenic
1047604436 8:126460810-126460832 TTTGTAACTCTGGTAGAATTTGG - Intergenic
1047630517 8:126701683-126701705 TTTGTAAGTCTGGTAGAATTTGG - Intergenic
1048415139 8:134219719-134219741 TTTGAATGTCTGTTAGAATTTGG - Intergenic
1049069043 8:140343019-140343041 TTTGGAATTTTGCTAGAATTTGG - Intronic
1050295506 9:4200740-4200762 TTTGTATGTCTGGTAGAATTTGG - Intronic
1050852385 9:10303816-10303838 TTTGAACCTCTGGTAGAATTTGG - Intronic
1051524376 9:18026793-18026815 TTTGAACATCTGGTAGAATTCGG + Intergenic
1051807773 9:21015024-21015046 ATTGATAGTTTAGTGGACTTGGG - Intronic
1051869222 9:21716941-21716963 CTTGAAAGTCTGGTAGAAATTGG - Intergenic
1052717264 9:32132060-32132082 TTTGTAACTTTGGTAGAATTTGG - Intergenic
1052903126 9:33812013-33812035 TTTGTTAGTTTGGTAGAATTTGG - Intergenic
1053008284 9:34618829-34618851 TTTGAGAGTCTGGGAGAATGAGG - Intronic
1053194423 9:36105005-36105027 TTTAATAGCTTGGTAGAATCAGG + Intronic
1053631233 9:39941382-39941404 TTTGAATGTCTGATAGAATTTGG + Intergenic
1053693945 9:40617836-40617858 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1053774534 9:41522123-41522145 TTTGAATGTCTGATAGAATTTGG - Intergenic
1053940937 9:43248264-43248286 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1054212654 9:62309316-62309338 TTTGAATGTCTGATAGAATTTGG - Intergenic
1054270890 9:63022300-63022322 TTTCATGTTTTGGTAGAGTTAGG + Intergenic
1054305190 9:63417060-63417082 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1054403937 9:64741040-64741062 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1054437558 9:65226550-65226572 TTTCATGTTTTGGTAGAGTTAGG - Intergenic
1054492845 9:65795431-65795453 TTTCATGTTTTGGTAGAGTTAGG + Intergenic
1054802832 9:69368734-69368756 TTTATAAGTTTGGTAGAATTTGG + Intronic
1055209074 9:73767248-73767270 TGTGAGATCTTGGTAGAATTGGG - Intergenic
1055310150 9:74970816-74970838 TTAGAAAGTTTGGTAGAATTTGG - Intergenic
1055339402 9:75264873-75264895 TGGGAAGGTTTGGTAGAATTTGG - Intergenic
1055345333 9:75329985-75330007 TTTGTATGTCTGGTAGAATTTGG - Intergenic
1055911418 9:81356738-81356760 TTTAAATGTTTGGTAGAATTCGG - Intergenic
1055990243 9:82098075-82098097 TTTGTATGTCTGGTAGAATTCGG + Intergenic
1056175935 9:84036106-84036128 TTTGAAATCTTAGTAGAATTTGG + Intergenic
1056214577 9:84395172-84395194 TTTGGTATTTTTGTAGAAATGGG + Intergenic
1056279855 9:85030428-85030450 ATTGCTTGTTTGGAAGAATTTGG - Intergenic
1056361763 9:85865107-85865129 TTTGTAAGTCTGTTAGAATTTGG - Intergenic
1056987156 9:91373885-91373907 TTTGGTATTTTGGTAGCAATGGG + Intergenic
1057372613 9:94487819-94487841 TTCTGTAGTTTGGTAGGATTGGG + Intergenic
1058030300 9:100188775-100188797 TTTGAATATCTGGTAGAATTTGG + Intronic
1058293065 9:103267629-103267651 TTTGTATGTTTTGTAGAATTTGG + Intergenic
1058405133 9:104664398-104664420 TTTGTTCATCTGGTAGAATTTGG - Intergenic
1058441587 9:105013079-105013101 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1059053745 9:110956840-110956862 TTTGTAAGTTTGGTAGAATTTGG - Intronic
1060332862 9:122691179-122691201 TTTGTATGTTTGGTAGGATTTGG - Intergenic
1060844387 9:126824196-126824218 TTTGGTTTTTTGGTAGAAATGGG + Intronic
1060918875 9:127406704-127406726 TTTCATAGTGTGGTGGAAATGGG - Intronic
1061762853 9:132862498-132862520 TTTTGTATTTTGGTAGAAATAGG + Intronic
1203428124 Un_GL000195v1:60582-60604 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1203438156 Un_GL000195v1:162719-162741 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1203466091 Un_GL000220v1:88640-88662 TTTGTACATTTGGTAGAATTTGG + Intergenic
1203410895 Un_KI270579v1:1404-1426 TTTGTACATTTGGTAGAATTTGG + Intergenic
1185730076 X:2454614-2454636 TTTGATTGGTTAATAGAATTGGG - Intronic
1186081541 X:5938522-5938544 TTTCAAAGTTGGGTAGGATTAGG + Intronic
1186147300 X:6637647-6637669 TTTGAGAGTTTGTTAGAGCTAGG - Intergenic
1186502783 X:10065437-10065459 GTGAATAGTTTGGTAGCATTTGG + Intronic
1186526358 X:10252306-10252328 TTTGTACGTCTGGTAGAATTCGG + Intergenic
1186728731 X:12384943-12384965 TTAGATAGGTTGGAAGAAGTGGG - Intronic
1186886656 X:13920976-13920998 TTTGAGAGTTTGCTAGAAAGAGG + Intronic
1186911296 X:14169824-14169846 TTTGAATGTTTTGTTGAATTTGG + Intergenic
1186953857 X:14658507-14658529 TTTTAGAGTTTGGAAGAAGTGGG - Intronic
1187661589 X:21552343-21552365 TTTGAAAGTTTTGTTGAATTTGG + Intronic
1187683231 X:21789497-21789519 TTTCATAATTTTGTTGAATTGGG - Intergenic
1187714082 X:22084590-22084612 TTTAAATGTTTTGTAGAATTTGG + Intronic
1188059783 X:25586937-25586959 TTTGTACATTTGGTAGAATTTGG + Intergenic
1188064153 X:25637023-25637045 TTTGAAAGTTTGTTAGAATTCGG - Intergenic
1188202023 X:27303077-27303099 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1188304250 X:28542816-28542838 TTTGCATGTTTGGCAGAATTGGG - Intergenic
1188625570 X:32280421-32280443 TTTCTGAGCTTGGTAGAATTAGG - Intronic
1188648786 X:32603905-32603927 TTTGCATGTCTGGTAGAATTCGG - Intronic
1188666952 X:32835935-32835957 TTTCATAGGTTTATAGAATTAGG + Intronic
1188743491 X:33813811-33813833 TTTGCATGTCTGGTAGAATTTGG + Intergenic
1188785718 X:34344002-34344024 TTTGAATTTGTGGTAGAATTCGG - Intergenic
1188789496 X:34390770-34390792 TTTGAGATTTTGGTAAACTTAGG + Intergenic
1188928975 X:36081396-36081418 TTTGAATATCTGGTAGAATTTGG - Intronic
1189080701 X:37968916-37968938 TTTTGTAGATTGGTATAATTCGG - Intronic
1189501900 X:41568824-41568846 TTTGATATTTTTGTAGAGATGGG - Intronic
1189548021 X:42063143-42063165 TTTGTATGTCTGGTAGAATTCGG + Intergenic
1190182013 X:48200537-48200559 TTTTGTAGTTTAGTAGAAATGGG + Intronic
1190341049 X:49296105-49296127 TTTGTAACTCTGGTAGAATTTGG + Intronic
1190580884 X:51892676-51892698 TTTGCTTGTTTGGTACAAATGGG + Intronic
1190747886 X:53336667-53336689 TTTTGTAGTTTTGTAGATTTGGG - Intergenic
1191126274 X:56957637-56957659 TTTAAATGTTTGGTATAATTCGG - Intergenic
1191152809 X:57239174-57239196 CTTTATATTTTGGTAGAATTCGG + Intergenic
1191156054 X:57274312-57274334 TTTGTTCCTCTGGTAGAATTCGG - Intergenic
1191159664 X:57315310-57315332 TTTGTATGTCTGGTAGAATTTGG - Intronic
1191175167 X:57491657-57491679 TTTAAAAGTTTGGAAGAACTTGG + Intergenic
1191639818 X:63417800-63417822 TTTATGAGTGTGGTAGAATTTGG + Intergenic
1191771284 X:64761628-64761650 TTTGTAACTCTGGTAGAATTTGG + Intergenic
1191855601 X:65623508-65623530 TTTAAATATTTGGTAGAATTTGG + Intronic
1191935762 X:66425729-66425751 TTTGTAAGTCTGGTAGAATTTGG - Intergenic
1191983851 X:66957267-66957289 TTTGAAAATTTGGTAGACTTTGG + Intergenic
1192076729 X:68006340-68006362 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1192365997 X:70473763-70473785 TTTGAATTTTTTGTAGAATTGGG + Intronic
1192622062 X:72687774-72687796 TTTGCTAGTTTGTTGGAATTTGG + Intronic
1192708057 X:73548496-73548518 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1192724787 X:73737774-73737796 TTTGAAAGTTTGGTAGAATTGGG + Intergenic
1192933372 X:75832367-75832389 TTTGTACCTTTGGTAGAATTGGG + Intergenic
1192937714 X:75878242-75878264 TTTGTACCTTTGGTAGAATTCGG + Intergenic
1193282943 X:79676696-79676718 TTTTAGAGTTTGGTACAGTTAGG - Intergenic
1193436560 X:81480829-81480851 TTTGTACATTTGGTAGAATTTGG - Intergenic
1193444340 X:81581420-81581442 TTTGTTTGTCTGGTAGAATTTGG - Intergenic
1193571947 X:83154729-83154751 TTTGTACCTTTGGTAGAATTCGG - Intergenic
1193623044 X:83780303-83780325 TTTGAACCTCTGGTAGAATTTGG - Intergenic
1193636081 X:83950341-83950363 TTTGAATGTCTGATAGAATTTGG - Intergenic
1193689060 X:84617501-84617523 TTTGATATTGAAGTAGAATTTGG + Intergenic
1193761453 X:85471629-85471651 CTTTAAAGTTTGGTAAAATTTGG + Intergenic
1193861848 X:86677863-86677885 ATTGATAATTTGGTATAATTGGG - Intronic
1194025921 X:88750661-88750683 TTTGTACGTCTGGTAGAATTTGG + Intronic
1194070491 X:89319172-89319194 TTTGTAATTCTGGTAGAATTAGG + Intergenic
1194139789 X:90195651-90195673 TTTGTAGCTTTGGTAGAATTCGG + Intergenic
1194226237 X:91262121-91262143 TCTGAACGTCTGGTAGAATTTGG + Intergenic
1194291927 X:92084244-92084266 TTTGAAAATTTGGAAGAGTTCGG + Intronic
1194377828 X:93157445-93157467 TTTATATGTTTGGTAGAATTTGG - Intergenic
1194395495 X:93379146-93379168 TTTGATGGTTTGGTAGCTTTGGG - Intergenic
1194401385 X:93441140-93441162 TTTGTAGGTTTGGTAGAATTTGG - Intergenic
1194439581 X:93915067-93915089 ATTGATAGTTTGATAGATATAGG - Intergenic
1194529824 X:95032382-95032404 TTTAAATGTTTGGTAGAATTTGG + Intergenic
1194772172 X:97919089-97919111 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1194921071 X:99765267-99765289 TTTAAATGTTTGGTAAAATTCGG - Intergenic
1195140433 X:101953749-101953771 TTTGTACCTTTGGTAGAATTTGG - Intergenic
1195250375 X:103038627-103038649 TATAAACGTTTGGTAGAATTTGG + Intergenic
1195269950 X:103219688-103219710 TTTTATATTTTAGTAGAAATGGG - Intergenic
1195417688 X:104637951-104637973 TTTAGAAGTTTGGTAGAACTTGG + Intronic
1195640817 X:107172762-107172784 TTTGATGGTTGGCAAGAATTTGG + Intronic
1195810315 X:108821819-108821841 TTTGTACCTTTGGTAGAATTTGG + Intergenic
1195831058 X:109058994-109059016 TTTAGAAGTTTGGTAGAATTTGG + Intergenic
1196019412 X:110974513-110974535 TTTGAACCTCTGGTAGAATTTGG - Intronic
1196573575 X:117292025-117292047 TCTAAATGTTTGGTAGAATTTGG - Intergenic
1196990546 X:121324243-121324265 TTTGAATGTCTGGTATAATTTGG - Intergenic
1197082472 X:122436349-122436371 TTTTAACATTTGGTAGAATTTGG + Intergenic
1197371495 X:125631854-125631876 TTTGAATGTATGGTAGAATTTGG - Intergenic
1197394382 X:125908322-125908344 TTGGAATGTCTGGTAGAATTTGG - Intergenic
1197565048 X:128073042-128073064 TTTGAAGGTCTGGTAGAATTTGG + Intergenic
1197734101 X:129837468-129837490 TTTGAAAGAGGGGTAGAATTTGG + Intronic
1197847367 X:130817321-130817343 TTTGTACCTTTGGTAGAATTTGG - Intronic
1198062938 X:133065281-133065303 TTTGTATGTCTGGTAGAATTCGG - Intronic
1198211446 X:134520106-134520128 TTTTAAAGTTTGTTTGAATTGGG - Intronic
1198556189 X:137795851-137795873 TTTGAATCTCTGGTAGAATTCGG - Intergenic
1199016475 X:142821578-142821600 TTTGTACATTTGGTAGAATTTGG + Intergenic
1199187474 X:144932727-144932749 TTTAGAAGTTTGATAGAATTTGG + Intergenic
1199302596 X:146230531-146230553 TTTGTAACTCTGGTAGAATTAGG + Intergenic
1199401788 X:147406935-147406957 TTTGTAACTCTGGTAGAATTCGG - Intergenic
1199465391 X:148129797-148129819 TTTGTTGGTTTGGCAGCATTAGG - Intergenic
1199865032 X:151838774-151838796 CTTGAAAGTTTGGTAGAATTTGG - Intergenic
1199888800 X:152052783-152052805 TTTGTATGTCTGGTAGAATTTGG + Intergenic
1199921364 X:152407630-152407652 TTTAAATGTTTGATAGAATTCGG - Intronic
1200018979 X:153186250-153186272 TATGATTATTTGGTAGTATTTGG - Intergenic
1200485535 Y:3764620-3764642 TTTGTAGCTTTGGTAGAATTCGG + Intergenic
1200609440 Y:5308777-5308799 TTTGAAAATTTGGAAGAGTTCGG + Intronic
1200724732 Y:6654816-6654838 TTTGTAATTCTGGTAGAATTAGG + Intergenic
1200974808 Y:9197267-9197289 TGTGATCGTTTGGAACAATTTGG - Intergenic
1201248680 Y:12033197-12033219 TTTGTACCTTTGGTAGAATTAGG + Intergenic
1201314140 Y:12626615-12626637 TTTGTAACTCTGGTAGAATTTGG + Intergenic
1201376883 Y:13332152-13332174 TTTGTACGTCTGGTAGAATTTGG - Intronic
1201405068 Y:13641806-13641828 TGAAATAGTCTGGTAGAATTGGG + Intergenic
1201450790 Y:14111669-14111691 TTTGGTATTTTAGTAGAATTGGG + Intergenic
1201513489 Y:14791313-14791335 TTTCAAGGTTGGGTAGAATTAGG - Intronic
1201980698 Y:19906843-19906865 TTTGGTAGTTTGGTAGAAATAGG - Intergenic