ID: 1111722150

View in Genome Browser
Species Human (GRCh38)
Location 13:91959457-91959479
Sequence TTAGTTCTTCTTTGATAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1913
Summary {0: 1, 1: 9, 2: 73, 3: 514, 4: 1316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111722150_1111722152 13 Left 1111722150 13:91959457-91959479 CCAAACTATCAAAGAAGAACTAA 0: 1
1: 9
2: 73
3: 514
4: 1316
Right 1111722152 13:91959493-91959515 CAAACTGTTCCAAAAACATGAGG 0: 1
1: 1
2: 10
3: 122
4: 951
1111722150_1111722153 16 Left 1111722150 13:91959457-91959479 CCAAACTATCAAAGAAGAACTAA 0: 1
1: 9
2: 73
3: 514
4: 1316
Right 1111722153 13:91959496-91959518 ACTGTTCCAAAAACATGAGGAGG 0: 1
1: 1
2: 36
3: 400
4: 1066
1111722150_1111722154 20 Left 1111722150 13:91959457-91959479 CCAAACTATCAAAGAAGAACTAA 0: 1
1: 9
2: 73
3: 514
4: 1316
Right 1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG 0: 1
1: 17
2: 250
3: 667
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111722150 Original CRISPR TTAGTTCTTCTTTGATAGTT TGG (reversed) Intronic
900910038 1:5589737-5589759 TTAATTCTTCTTTAAAAGCTTGG - Intergenic
901256433 1:7831961-7831983 TTATTTTTTCTTTGTAAGTTTGG + Intronic
902084295 1:13846586-13846608 TTAATTCTTCTTTAAATGTTTGG + Intergenic
903150966 1:21408506-21408528 TTAGATCTTCTTTAAGATTTGGG + Intergenic
904985195 1:34540495-34540517 TTGCTTCTTCTTTGAATGTTTGG - Intergenic
905053304 1:35071817-35071839 TTAGTTCTTCTTTAAATGTTTGG + Intronic
905966299 1:42099636-42099658 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
906010437 1:42519360-42519382 TTAGTTCTTTTTTAAATGTTTGG + Intronic
906092296 1:43191041-43191063 TTAATTCTTCTTTAAGTGTTTGG + Intronic
906731786 1:48089247-48089269 TTATTTCTTCTTTTAATGTTTGG + Intergenic
906754772 1:48300485-48300507 TTAGTTCTTCTTTAAATATTTGG - Intronic
907004367 1:50895438-50895460 TTAGTTCTTCTTTAACTGTTTGG - Intronic
907369799 1:53993297-53993319 TTATTTCTTCCTTGAATGTTTGG - Intergenic
907605207 1:55809722-55809744 TTAGTTATTCTTTAAATGTTTGG - Intergenic
907905498 1:58781466-58781488 TTATTTCTTGTTTGTTTGTTTGG - Exonic
907953288 1:59204470-59204492 TTTCTTCTTTTTTGATAGATAGG - Intergenic
908026804 1:59960575-59960597 TTTATTCTTGATTGATAGTTTGG - Intergenic
908175262 1:61549420-61549442 TTAGTTCTTCTGTAAATGTTTGG + Intergenic
908397226 1:63737330-63737352 TTAGTTCTTCTTTAAATATTTGG + Intergenic
908695004 1:66829965-66829987 TGATTTCTTCTTTGATGGGTGGG - Intronic
908809948 1:67970487-67970509 CTAGTTCTTCTTTCAAAGTTTGG + Intergenic
908855818 1:68426692-68426714 TGATTTCTTCTTTGATCCTTTGG + Intergenic
909104173 1:71388440-71388462 TTAGTTGTTCTTTAAATGTTTGG - Intergenic
909166044 1:72226527-72226549 TAAGTTCTCCTTGGACAGTTAGG - Intronic
909355182 1:74700560-74700582 TTGCTTATTCTTTTATAGTTTGG + Intergenic
909385154 1:75046507-75046529 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
909493026 1:76247032-76247054 TTAGTTTTTCTTTAACAGTCAGG + Intronic
909582288 1:77251096-77251118 TTAATTCTTCTTTAAATGTTTGG - Intergenic
909587480 1:77306677-77306699 GTAGTTCTTCTTTAAATGTTTGG + Intronic
909616115 1:77610379-77610401 TTAGTTCGTCTTTAAATGTTTGG - Intronic
909759800 1:79272361-79272383 TTGGTTTTTCTTTAACAGTTGGG - Intergenic
910102218 1:83590205-83590227 TTAGTTCCTCTTTAAATGTTTGG + Intergenic
910103276 1:83601314-83601336 TTAATTATTCTTTGAAAGTTTGG - Intergenic
910137189 1:83985977-83985999 TTAATTCTTCATTGAGTGTTTGG - Intronic
910230287 1:84979241-84979263 TTAGTTCTTCTTTAAACATTTGG - Intronic
910351284 1:86300797-86300819 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
910378954 1:86604912-86604934 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
910547671 1:88436910-88436932 TTAGTTCTTCTATAAATGTTTGG - Intergenic
910606799 1:89094696-89094718 TTATTTCTTCTTTAAACGTTTGG - Intergenic
910819493 1:91330564-91330586 GTAGTTCTTCTTTAAATGTTTGG - Intronic
910821656 1:91357018-91357040 GTAATTCTTCTTTGAATGTTTGG - Intronic
910904127 1:92155887-92155909 TTACTTCTTCCTTTACAGTTTGG + Intergenic
911008133 1:93249042-93249064 TTAGTTTTTCTTTAAATGTTTGG + Intronic
911012197 1:93292199-93292221 TTAGTACTTCTTTAAATGTTTGG - Intergenic
911267421 1:95759597-95759619 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
911343538 1:96669443-96669465 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
911486191 1:98508950-98508972 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
911487517 1:98520608-98520630 TTAGTTCTTTTTTAAATGTTAGG - Intergenic
911496805 1:98641665-98641687 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
911938763 1:104015160-104015182 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
911966547 1:104379384-104379406 TTAGTTCTTCTTTAAATATTTGG - Intergenic
912031553 1:105251365-105251387 TTAGTTCTTCTTTAAGTGTTGGG + Intergenic
912036320 1:105320663-105320685 TTAGTTCTACTTTAAATGTTTGG + Intergenic
912059917 1:105654829-105654851 TAAGTTCTTCTTTCATATATAGG + Intergenic
912117292 1:106422503-106422525 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
912180518 1:107213580-107213602 TTAGTTCCTCAGTGATACTTTGG + Intronic
912632905 1:111263297-111263319 TTAGTTCCTCTTTAAATGTTTGG + Intergenic
913036620 1:114971995-114972017 TTAATTCTTCTTTAAATGTTTGG + Intronic
913101100 1:115567337-115567359 TTAATTCTTCTTTATAAGTTTGG - Intergenic
913146696 1:115998366-115998388 TTAGTTCTTCTTTAAATGTTTGG + Intronic
913707280 1:121438592-121438614 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
914443760 1:147731408-147731430 TTAGTTCTTCCTTTAAAGTTTGG + Intergenic
915023120 1:152800353-152800375 TTAGCTCTTCTTTAAATGTTTGG - Intronic
915043367 1:152987596-152987618 TTAGTTCTTCTTTAAGTATTTGG - Intergenic
915056553 1:153137300-153137322 TTAGTTTTTCTTTGAAAGTTCGG - Intergenic
915178114 1:154034259-154034281 TTAGTTCTCCTTTAAATGTTTGG + Intronic
915258056 1:154650854-154650876 TTAGTTCTTTTTTAAACGTTTGG + Intergenic
915753221 1:158232331-158232353 TTAGTTCTTCTTTAAATATTTGG - Intergenic
915858446 1:159416658-159416680 TTAGTTCCTTTTTGAAAGTTTGG + Intergenic
915865786 1:159496851-159496873 TTGGTTCTTCTTTAACTGTTTGG + Intergenic
916301485 1:163280072-163280094 TTAGTTCTTCTTTAAACCTTTGG - Intronic
916341515 1:163741477-163741499 TTAGTTCTTCTTGAAATGTTTGG + Intergenic
916355727 1:163905172-163905194 TTAGTTCTTCTTCAAATGTTTGG + Intergenic
916396631 1:164396719-164396741 TTAATTCTTCTTTAAATGTTTGG - Intergenic
916401698 1:164456211-164456233 TTATTTCTTCTTTGATTCATTGG - Intergenic
916593576 1:166218746-166218768 TTATTTCTTCTTTGAATGTTTGG + Intergenic
916644798 1:166772833-166772855 TTAGTTCTTCTTTGTATGTTTGG - Intergenic
916794966 1:168158112-168158134 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
917036216 1:170749960-170749982 TGAGTTGTTGTTTGATAGTATGG - Intergenic
917187018 1:172369045-172369067 TTAATTCTTCTTTTAAGGTTTGG - Intronic
917363959 1:174208831-174208853 TTATTTCTTCTTTAAATGTTTGG + Intronic
917375305 1:174346319-174346341 TTAATTCTTCTTTAAATGTTGGG + Intronic
917383726 1:174444519-174444541 TTAGTTCTTCTTTAAGTGTTTGG + Intronic
917386814 1:174485916-174485938 TTATTTCTTCTTTAAATGTTTGG + Intronic
917601613 1:176579640-176579662 TTAGTTCTTAATTGTTATTTTGG - Intronic
917759403 1:178140279-178140301 TAATTTCTTCTATGTTAGTTTGG + Intronic
917986249 1:180322433-180322455 TTAGTTCTTTTTTAAATGTTTGG + Intronic
917991350 1:180382617-180382639 TTAGTTCTTCTTTGAAAGTTTGG - Intronic
918189507 1:182159904-182159926 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
918224250 1:182465727-182465749 TTAATTCTTCTTTAAATGTTTGG - Intronic
918307146 1:183257459-183257481 TTAATTATTCTTTGAAAATTTGG + Intronic
918308655 1:183269706-183269728 TCAGTTCTTATTTCATAGGTGGG + Intronic
918415788 1:184306311-184306333 TTAGTTCTTCTTTAAATGTGTGG + Intergenic
918835283 1:189454710-189454732 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
918959346 1:191252429-191252451 TTAGTTCTTCTTTAAGTATTTGG + Intergenic
919170065 1:193942513-193942535 TTAGTTCTTCATTAAATGTTTGG - Intergenic
919226837 1:194715190-194715212 TTAGATCTTCTTTATAAGTTTGG - Intergenic
919284029 1:195529972-195529994 TTAGTTCTTCTGTAAATGTTTGG - Intergenic
919337011 1:196248711-196248733 TTAGTCCTTCTTTCAATGTTTGG - Intronic
919373374 1:196760776-196760798 CTAGTTCTTCTTTAAATGTTAGG + Intergenic
919379817 1:196845452-196845474 CTAGTTCTTCTTTAAACGTTAGG + Intronic
919448442 1:197739529-197739551 TGATTTCTTCTTTGACCGTTGGG - Intronic
919461020 1:197877346-197877368 TTAGTCCTTCTTTAAATGTTCGG + Intergenic
919532325 1:198738727-198738749 CTAGTTCTTCTTTAAATGTTTGG + Intronic
919583978 1:199413103-199413125 TTATTTCTTCTTTTAAAATTTGG - Intergenic
919696735 1:200584270-200584292 TTAATTCTTCTTTAATTGTTCGG - Intronic
919971961 1:202586696-202586718 TCACTTCTCCTTTGAGAGTTGGG + Exonic
920586147 1:207163540-207163562 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
920596369 1:207275324-207275346 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
920792134 1:209103474-209103496 TTAGCTCTTCTCTGAGAGTATGG - Intergenic
920998734 1:211020554-211020576 CTAGTTCTTCTTTAAAACTTTGG - Intronic
921013350 1:211163751-211163773 TTAGTTCTTCTTTAACGGTTTGG - Intergenic
921197257 1:212770608-212770630 TTAATTCTTCTTTATAAGTTTGG - Intronic
921529457 1:216263189-216263211 TTAGTTCTTCTATTAAAGTTTGG - Intronic
921545698 1:216472504-216472526 TTAGTCACTCTTTGAAAGTTTGG - Intergenic
921578742 1:216870583-216870605 TTATTTCTTCCATAATAGTTTGG + Intronic
921941878 1:220849805-220849827 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
921994335 1:221401118-221401140 TTAATTCTTCTTTAAATGTTTGG - Intergenic
922373501 1:224936632-224936654 TTAGTTATTCTTTAAATGTTTGG - Intronic
922388231 1:225110256-225110278 TTAGTTCTTCTTTAAATATTTGG + Intronic
922393774 1:225175237-225175259 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
922395005 1:225189451-225189473 TTAATTCTTCTTTAAGTGTTTGG + Intronic
922404127 1:225294512-225294534 TTAATTTGTCTTTAATAGTTTGG + Intronic
922907854 1:229188876-229188898 TTATTTATTCTTTGAAATTTTGG - Intergenic
922996316 1:229964737-229964759 TTCGTGCTTGGTTGATAGTTTGG + Intergenic
923692095 1:236204473-236204495 TTAGTTCTTCTTTAAATGTTTGG + Intronic
923960362 1:239075353-239075375 TTAATTCTTCTTTTAAGGTTTGG - Intergenic
924059719 1:240160120-240160142 TTATTTCTTCTTTAAATGTTTGG - Intronic
924327026 1:242905737-242905759 TTAATTCTTCTTTAAATGTTAGG - Intergenic
924488323 1:244509654-244509676 TTAGTTATTCTTTATAAGTTTGG + Intronic
924618626 1:245639052-245639074 TTAGTTATTCTTTAAATGTTTGG + Intronic
924832232 1:247609271-247609293 TTAGTCCTTCTTTAAATGTTTGG - Intergenic
1063397359 10:5702523-5702545 TTAGTTCCTCTTTAAATGTTTGG + Intronic
1063746244 10:8885589-8885611 ATACTACTTCTTTGATACTTGGG - Intergenic
1063774765 10:9250237-9250259 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1063997647 10:11635703-11635725 TTAATTCTTCTTTAACTGTTCGG + Intergenic
1065227840 10:23563623-23563645 TTACTTATTCTTTAAAAGTTTGG + Intergenic
1065248404 10:23783637-23783659 TTAATTTTTCTTTGAGTGTTTGG + Intronic
1065534604 10:26705048-26705070 TTAGTTTTTCTTTGATTTTGTGG + Intronic
1065906967 10:30263886-30263908 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1065907254 10:30267530-30267552 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1066037268 10:31505366-31505388 TTAGCTCTTCTTTGACAGTTTGG + Intronic
1066140959 10:32503702-32503724 TTAGTTCTTCTTTAAATATTTGG + Intronic
1066181097 10:32961418-32961440 TTAGTCCTTATTTTTTAGTTGGG - Intronic
1067236079 10:44451116-44451138 TTTTTTCTTCTTTGTTAGTCTGG + Intergenic
1067326446 10:45272009-45272031 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
1067351337 10:45478922-45478944 ATTGTTCTTCTTTGAAAGTTTGG - Intronic
1067430862 10:46244245-46244267 TTAGTTCTTCTTCATAAGTTTGG - Intergenic
1067677421 10:48395511-48395533 TTATTTTTTCTTTCACAGTTTGG - Intronic
1067813372 10:49449536-49449558 TAGGTTTTGCTTTGATAGTTAGG + Intergenic
1068330812 10:55565247-55565269 TTATTTCTTCTTTGATCAATTGG - Intronic
1068332616 10:55590992-55591014 TTATTTATTTTTTGATAATTGGG - Intronic
1068436387 10:56996750-56996772 TTAGTTCTTTTTTAAGTGTTTGG - Intergenic
1068448121 10:57149930-57149952 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1068451185 10:57191104-57191126 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1068494325 10:57766493-57766515 TTTGTTCTACTTGGATAGATTGG - Intergenic
1068593782 10:58879345-58879367 TTAGTTCTTCTTAAAATGTTTGG + Intergenic
1068642066 10:59420565-59420587 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1068781736 10:60926293-60926315 TTAATTCTTCTTTAAGTGTTTGG - Intronic
1068894495 10:62184817-62184839 TTAGTTCTTATTTGAGATCTTGG - Intronic
1069148088 10:64920857-64920879 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1069172986 10:65255741-65255763 TTAGTTCCTCTTTGAAAGTTTGG - Intergenic
1069229571 10:65992324-65992346 TTAGTTATTCTTTGTAAGTTTGG + Intronic
1069392154 10:67948011-67948033 TGATTTCTTCTTTGATCTTTTGG - Intronic
1069415119 10:68192589-68192611 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1070034993 10:72713858-72713880 TTATTTCTTCATTGTTTGTTAGG + Intronic
1070058965 10:72963351-72963373 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1070073448 10:73112010-73112032 TTAGTCACTCTTTAATAGTTTGG + Intronic
1070176174 10:73971645-73971667 TTATTTCTCCATTGATAGTTTGG - Intergenic
1070822219 10:79365473-79365495 TTAATTCTTCTTTGAGTGATAGG - Intergenic
1070854693 10:79597678-79597700 TTATTTCTTCTTTAAAAGTTTGG - Intergenic
1070936633 10:80303512-80303534 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1071039944 10:81295678-81295700 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1071233601 10:83618250-83618272 TTTGCTCTTCTTTGAAAGTGAGG - Intergenic
1071314816 10:84384795-84384817 TTACTTCCTCTTTTATAATTTGG - Intronic
1071316231 10:84401596-84401618 TTATTTCTTCATTAATTGTTTGG - Intronic
1071473453 10:86004297-86004319 CTATCTCTTCTTTGATAATTGGG - Intronic
1071479514 10:86054448-86054470 TTTGATCTTCTTTTAGAGTTAGG - Intronic
1071667167 10:87570147-87570169 TTAGTTCTTCTTTGAAAGTTTGG - Intergenic
1071869424 10:89777243-89777265 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1071928946 10:90443801-90443823 TTCATTCTTCTTTGAAAGTTTGG - Intergenic
1072059193 10:91792542-91792564 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
1072070875 10:91916030-91916052 TTAATTCTTCTTTGAAAGTTTGG + Intergenic
1072337937 10:94416529-94416551 TTAGTTCTTATTAATTAGTTTGG + Intronic
1072380353 10:94862433-94862455 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1072390422 10:94979417-94979439 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1072867090 10:99074633-99074655 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1073658420 10:105444362-105444384 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1073898331 10:108188879-108188901 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1073905091 10:108269818-108269840 TTAGTCCTTCTTTAAATGTTTGG + Intergenic
1073911884 10:108355384-108355406 TTAGTTAATATTTGATAGTGAGG + Intergenic
1074143053 10:110693338-110693360 TTAATTCTTCTTTAAATGTTTGG + Intronic
1074331392 10:112514087-112514109 TCAGTTCTTCTTTAAATGTTTGG + Intronic
1074623340 10:115149918-115149940 TTAATTCTTCTTTGAAAGTTTGG + Intronic
1074637782 10:115340605-115340627 TTAGTTCTGCTTTAAATGTTTGG + Intronic
1074975068 10:118573259-118573281 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1074975233 10:118575225-118575247 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1075179188 10:120195298-120195320 TTAGTTCTTCTTTTTAAGTTTGG + Intergenic
1075195333 10:120352432-120352454 CTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1075250047 10:120860205-120860227 ATAGCTCTTCTTCCATAGTTTGG - Exonic
1075496677 10:122926761-122926783 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1075830214 10:125403373-125403395 TTAGTTCTCCTTTAAATGTTTGG + Intergenic
1076094932 10:127724836-127724858 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1077527988 11:3079472-3079494 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1077839880 11:5962470-5962492 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1077990771 11:7409448-7409470 TTAGTTCTTCTTTATATGTTTGG + Intronic
1078691920 11:13590365-13590387 TTAGTTCTTCTTTCAATGTTTGG - Intergenic
1078738415 11:14043365-14043387 TTAGTTCTGAGTTGAAAGTTGGG + Intronic
1079182698 11:18207981-18208003 TTAGTTCTTCATTGTAAGTTTGG - Intronic
1079183904 11:18219570-18219592 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1079651033 11:22930250-22930272 TTTGTGCTTCTTTTATATTTTGG + Intergenic
1079677571 11:23249934-23249956 TTAGTTGTTCTTTATAAGTTTGG + Intergenic
1079687233 11:23374919-23374941 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1080097082 11:28421276-28421298 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1080213375 11:29813393-29813415 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1080318253 11:30974773-30974795 TAAATTCTTCTTTGTAAGTTTGG - Intronic
1080330877 11:31136589-31136611 ATATTTCTTTTTTGATATTTTGG - Intronic
1080601551 11:33825538-33825560 TCAGTTCTTCTTTAAATGTTTGG + Intergenic
1080706119 11:34695626-34695648 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1080706907 11:34703697-34703719 TTAGTTCTTCTTTACATGTTTGG + Intergenic
1080709167 11:34730142-34730164 TTTCTTTTTCTTTGATAGCTAGG - Intergenic
1080709188 11:34730450-34730472 TCAGTTCTTCTTTGAATGTCTGG - Intergenic
1080944962 11:36961288-36961310 TTAGTTATTCTTTAAATGTTTGG - Intergenic
1080965834 11:37213368-37213390 TTAGTTCCTCTTTAAATGTTTGG + Intergenic
1081052152 11:38356180-38356202 TTAGTTCTTCTTTGAACGTTTGG - Intergenic
1081063838 11:38514323-38514345 TTAGTTCCTCCTTAAAAGTTGGG + Intergenic
1081246081 11:40768378-40768400 TTAGTTTTTCTTTAAGTGTTTGG - Intronic
1081422486 11:42887316-42887338 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1081768127 11:45626902-45626924 TTAGCTCTTCTTTGATTGCTAGG - Intergenic
1082094540 11:48118386-48118408 TTAGATCTTCTTTAAAGGTTTGG - Intronic
1082662584 11:55930805-55930827 TTAGTTTTTCTTTAAACGTTTGG + Intergenic
1082955021 11:58861169-58861191 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1083040782 11:59683998-59684020 TTAATTCTTCTTTAAATGTTGGG - Intergenic
1083124377 11:60549562-60549584 TTAGTTCTTCTTCCAATGTTTGG - Intergenic
1083137069 11:60688998-60689020 TTAGTGCTTCTTTGGTAATTTGG - Intergenic
1084136930 11:67190976-67190998 TTAGTTCCTCTTTAAATGTTTGG - Intronic
1084479169 11:69408628-69408650 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1084503354 11:69549231-69549253 TTATTTCTTCTTTCAATGTTTGG - Intergenic
1084771883 11:71348664-71348686 TTCTTTCTCCTTTGATAATTAGG - Intergenic
1085007801 11:73110267-73110289 TCAGTTCTTCTTTAAGTGTTTGG + Intronic
1085148730 11:74229860-74229882 TTTGTTCTTGTTTTATAGATGGG + Intronic
1085493283 11:76942760-76942782 TTAGTTCTTCTTTGTATGTTTGG + Intronic
1085538096 11:77238756-77238778 TTAGTTCTTCTTTAAGTGTTTGG - Intronic
1085568277 11:77535722-77535744 TTAATTCTTCTTTAAATGTTTGG - Intronic
1085571676 11:77564298-77564320 TTAGTTTTTCTTTAAATGTTTGG + Intronic
1085589469 11:77744878-77744900 TTAGTTATTCTTTAAATGTTTGG + Intronic
1085978929 11:81697609-81697631 TTAGTTATTTTTTCAAAGTTTGG - Intergenic
1085980818 11:81722320-81722342 TTAGTTCTTCTTTAAAAGATTGG - Intergenic
1086003500 11:82008174-82008196 TTACTTCTTCTTTAAATGTTCGG + Intergenic
1086069080 11:82779811-82779833 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1086123308 11:83323762-83323784 TTAGTTCTTCCTTGACAGTGTGG + Intergenic
1086282238 11:85203605-85203627 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1086397176 11:86428286-86428308 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1086447323 11:86881672-86881694 TTAATTCTTCTTTAAATGTTTGG + Intronic
1086589099 11:88490818-88490840 TTAGTCCTTCTTTAAATGTTTGG - Intergenic
1086833075 11:91589536-91589558 TTAGTTCTTCTTTGCATGTTTGG + Intergenic
1086874550 11:92079319-92079341 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1087053999 11:93914692-93914714 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1087080294 11:94163808-94163830 TTAGTTCTTTTTTAAAAGTTTGG + Intronic
1087169355 11:95035298-95035320 TGAGTTCTTCTTTAAATGTTTGG - Intergenic
1087201639 11:95350927-95350949 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1087299717 11:96417997-96418019 TTACTTCTTCTTTAAATGTTTGG - Intronic
1087313811 11:96582259-96582281 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
1087380175 11:97395563-97395585 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1087402065 11:97680210-97680232 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1087524575 11:99293497-99293519 TTAGTTCTACTTTAAATGTTTGG + Intronic
1087598070 11:100279387-100279409 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1087645894 11:100807937-100807959 GATGTTCTTCTTTGATACTTGGG + Intronic
1087690334 11:101314056-101314078 TTAGTTCTTCTTTAAATCTTTGG + Intergenic
1087694219 11:101357124-101357146 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1087804755 11:102543823-102543845 TTAGTTTGTTATTGATAGTTTGG + Intergenic
1087823646 11:102740271-102740293 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1088046702 11:105461376-105461398 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1088050201 11:105504076-105504098 ATAGTTCTTGTTAGATAGATTGG + Intergenic
1088182171 11:107125387-107125409 TTAGTTCTTCTATAAATGTTTGG - Intergenic
1088423916 11:109679769-109679791 CTAGTTTTTCTTTGATACTTGGG - Intergenic
1088998383 11:115025583-115025605 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1089090045 11:115865594-115865616 CTAGTTCTTGTTAGAAAGTTTGG + Intergenic
1089382191 11:118042521-118042543 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1089777178 11:120846425-120846447 GTAGTTCTTCTTTGGGAGTTTGG + Intronic
1089799215 11:121010707-121010729 TTACTTCTTCCTTTATAATTTGG - Intergenic
1089816301 11:121178679-121178701 TTAGTTCTTCTTTGTAAGTATGG + Intronic
1089824350 11:121260881-121260903 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1089856027 11:121545431-121545453 TCAGTTCTTCTTTGATGGCTGGG + Intronic
1089886993 11:121835840-121835862 TTAGTCCTTCTTTAAAAGTTTGG - Intergenic
1089937633 11:122381519-122381541 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1089942699 11:122436155-122436177 TTATTTCTACTTTTATAGTTAGG + Intergenic
1089946802 11:122483593-122483615 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
1090111499 11:123914957-123914979 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1090317956 11:125813397-125813419 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
1090504131 11:127292324-127292346 TTAGTTCTTTTTTGCTCATTTGG - Intergenic
1090506019 11:127315434-127315456 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1090911664 11:131125572-131125594 TTAGTTCTTCTGTGAAAGTTTGG + Intergenic
1091340170 11:134805834-134805856 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1091716308 12:2779094-2779116 TTAGTTCTTCTTGAAATGTTTGG + Intergenic
1091911738 12:4236927-4236949 TTGGCTCTTCTTTGAATGTTTGG + Intergenic
1092085429 12:5754492-5754514 TTAATTTTTCTTTGAATGTTTGG + Intronic
1092311727 12:7363852-7363874 TTAGTTCTTCTTTAAATGGTTGG - Intronic
1093063859 12:14636021-14636043 TTAGTTCTTCTTTGGAAGTTTGG - Intronic
1093206073 12:16251734-16251756 TTAATTCTTCTTTAAATGTTTGG - Intronic
1093263828 12:16974856-16974878 TTATTTCTTCTTTAATTGTTTGG + Intergenic
1093283987 12:17234635-17234657 TTTGTTCTTCTTTGACAGACAGG - Intergenic
1093307199 12:17536095-17536117 TGAGTTTTTCTTTAAAAGTTTGG + Intergenic
1093366018 12:18300109-18300131 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1093401186 12:18748638-18748660 TTGTTTCTTCATTTATAGTTCGG + Intergenic
1093476266 12:19558099-19558121 TTAATTCTTCTTTAAATGTTTGG + Intronic
1093530197 12:20152057-20152079 TGATTTCTTCTTTGATAGAAGGG + Intergenic
1093538512 12:20251923-20251945 TTAGTTTTTCTTTAACTGTTTGG - Intergenic
1093538514 12:20251957-20251979 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1093601887 12:21036750-21036772 TTAATTCTTCTTTAAATGTTTGG + Intronic
1093716308 12:22386774-22386796 TTAATTCTTCTTTAGTTGTTTGG - Intronic
1093809775 12:23477286-23477308 TTAGTTCTTGTTTAAGTGTTTGG - Intergenic
1094334342 12:29331476-29331498 TTAGGTATTCTTGGAGAGTTTGG - Intronic
1094440862 12:30474920-30474942 TTAGCTCTTCTTTAAATGTTTGG - Intergenic
1094734188 12:33215183-33215205 ATAGTTCTTCTTTAAATGTTTGG - Intergenic
1094741972 12:33300139-33300161 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1095091752 12:38114104-38114126 TTATTGCTTCTTTGAAAGGTGGG - Intergenic
1095150408 12:38788026-38788048 TTAGTTTTTCTTTAAGTGTTTGG - Intronic
1095163637 12:38945635-38945657 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1095520579 12:43060022-43060044 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1095760180 12:45823847-45823869 TTGGTTCTTCTTTATAAGTTTGG - Intronic
1095912074 12:47438167-47438189 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1096753122 12:53775915-53775937 TGAGTTCTTCTTGGCTACTTGGG + Intergenic
1097304138 12:58050942-58050964 TTAGTTCTTTTTTGAAAGTTTGG - Intergenic
1097425754 12:59442032-59442054 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1097645333 12:62229789-62229811 TTAGTTCTTTTTTAAATGTTTGG + Intronic
1097764409 12:63508651-63508673 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1097950655 12:65423912-65423934 TTAGTACTTCTTTAAAAGGTTGG + Intronic
1098060699 12:66558745-66558767 TTAGTTCTTCTTCAAATGTTTGG - Intronic
1098319542 12:69228067-69228089 TTAGTTCTTCTTCAAATGTTTGG - Intergenic
1098333376 12:69376779-69376801 TTAGTTCTTCTTCAAATGTTTGG + Intronic
1098396535 12:70024580-70024602 TTAGTTCTTCTTTGTAAGTTTGG - Intergenic
1098491722 12:71089201-71089223 TTAGTTCTTCTTTAAAAGTCTGG + Intronic
1098634234 12:72761469-72761491 TTAGGTATTCTTTGTAAGTTTGG - Intergenic
1098705924 12:73689212-73689234 TTAGTTCTTCTCTAAATGTTTGG - Intergenic
1098743381 12:74203382-74203404 TTATTTCTTCTTTGACATGTGGG + Intergenic
1099184378 12:79501721-79501743 TTAGTTCTTTTTTGAAAGTTTGG + Intergenic
1099230889 12:80023393-80023415 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1099289444 12:80757968-80757990 TTAGTTCTTCTTTAAATCTTTGG - Intergenic
1099408335 12:82290972-82290994 TAGGTTCTTTTTTGGTAGTTGGG - Intronic
1099587707 12:84542302-84542324 TTAGGTCTTCTTTGAAAGTTTGG + Intergenic
1099599162 12:84710131-84710153 TTAGTTCTTCTTACGTAGTAAGG - Intergenic
1099613120 12:84901184-84901206 TTCATTCTTCTTTAAAAGTTTGG + Intronic
1099613370 12:84904977-84904999 TTAATTCTTCTTTAAATGTTTGG - Intronic
1099808547 12:87550870-87550892 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1100046515 12:90387889-90387911 CTAGTTCTTATTTAAGAGTTTGG - Intergenic
1100123118 12:91392611-91392633 TTAGTTGTTCTTTAAATGTTTGG + Intergenic
1100360468 12:93874022-93874044 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1100409723 12:94303794-94303816 TTACTTCTTCTTTGTAGGTTGGG - Exonic
1100414738 12:94359696-94359718 TTAGTTCTTTTTTAAAAGTTTGG - Intronic
1100806352 12:98288313-98288335 TTAGTTGTTCTTTCCTAGTGTGG - Intergenic
1100873249 12:98935552-98935574 TTAATTCTTCTTTAAATGTTTGG + Intronic
1100914705 12:99406941-99406963 TTAGTTATTCTTTAAATGTTTGG - Intronic
1101070131 12:101065674-101065696 TTAGATCTTCTTTAAATGTTTGG - Intronic
1101167839 12:102056829-102056851 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1101227016 12:102698656-102698678 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1101227073 12:102699275-102699297 TGAGTTCTTCTTTTCTAATTTGG - Intergenic
1101378967 12:104196526-104196548 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1101552201 12:105773465-105773487 TTATTTCTTCTTTGGTGTTTTGG - Intergenic
1101562591 12:105872588-105872610 TTAGTCCTTCTTTAAATGTTTGG - Intergenic
1101745137 12:107534854-107534876 TTAATTCTTCTTTAAAAGTTTGG - Intronic
1102318327 12:111908410-111908432 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1102443544 12:112982752-112982774 TTAATTCTTCTTTATAAGTTTGG + Intronic
1104064057 12:125292090-125292112 TTAGTTCTTCTCTGATATGTTGG - Intronic
1104796081 12:131520012-131520034 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1104819840 12:131670130-131670152 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1105460149 13:20577930-20577952 TTAGTTCTTCTTTAAATGTCTGG + Intronic
1105592477 13:21806616-21806638 TTAATTATTCTTTGAATGTTTGG + Intergenic
1105603080 13:21904288-21904310 TTAGCCCTTCTTTTATAGGTAGG - Intergenic
1105733262 13:23241533-23241555 TTAATTCTTCTTTAAATGTTTGG - Intronic
1105906627 13:24817190-24817212 TTAATTCTTCTTTAAATGTTTGG + Intronic
1105938469 13:25124829-25124851 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1106072816 13:26429603-26429625 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
1106075108 13:26452848-26452870 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1106441311 13:29774926-29774948 TCAGTACTTCTTTAATTGTTAGG + Intronic
1106748873 13:32736287-32736309 TTAGTACTTTTTTTTTAGTTTGG + Intronic
1106860278 13:33899067-33899089 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1107092654 13:36498899-36498921 TTAGTTCTTGGTTGATGATTGGG + Intergenic
1107166184 13:37282690-37282712 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1107201990 13:37732500-37732522 TTACTTCTTCTTTTCCAGTTTGG - Intronic
1107211180 13:37856442-37856464 TCAGTTCTTCTTTAAATGTTTGG - Intronic
1107223710 13:38019818-38019840 TTAGTTTTTCTTTGAAAGTCTGG + Intergenic
1107228487 13:38080144-38080166 TTAGTTCTTCTTCAAACGTTTGG - Intergenic
1107265641 13:38550506-38550528 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1107369902 13:39733717-39733739 TTAGTTCTTCCTTAATTATTTGG + Intronic
1107387091 13:39923191-39923213 TTAGTTCTTCCTCAAAAGTTTGG + Intergenic
1107582597 13:41807252-41807274 TTAGTTCTTCTATAAATGTTTGG - Intronic
1107586432 13:41853454-41853476 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1108099641 13:46940789-46940811 TTAGTTCTTCTTTAAATGCTTGG - Intergenic
1108138314 13:47389921-47389943 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1108183087 13:47861333-47861355 TTAGTTCTTCTGTGTATGTTTGG - Intergenic
1108231898 13:48353506-48353528 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1108324457 13:49316388-49316410 TTAATTCTTCTTTAAATGTTAGG - Intronic
1108439323 13:50433952-50433974 TTAATTCTTCTTTGAATGTTTGG + Intronic
1108631375 13:52286537-52286559 TTCGTTCTTCTTTAAATGTTTGG + Intergenic
1108635377 13:52329163-52329185 TTAGTTTGTCTTTGTAAGTTTGG - Intergenic
1108652432 13:52494066-52494088 TTAGTTTGTCTTTGTAAGTTTGG + Intergenic
1108655316 13:52526061-52526083 TTCGTTCTTCTTTAAATGTTTGG - Intergenic
1108961873 13:56243718-56243740 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1109031563 13:57196593-57196615 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1109212716 13:59552672-59552694 TTAGTTCTTCCTTAAAAGTTTGG - Intergenic
1109218944 13:59621380-59621402 TTAATTATTCTTTAAAAGTTTGG - Intergenic
1109338209 13:61020013-61020035 TTAGGTATTCTTTCATTGTTAGG + Intergenic
1109427758 13:62189339-62189361 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1109548752 13:63864088-63864110 TTAGATTTTCTTTGTAAGTTTGG - Intergenic
1109826215 13:67725737-67725759 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1110331165 13:74274637-74274659 TTCTTTTTTCTTTGCTAGTTTGG + Intergenic
1110336778 13:74341787-74341809 TTAGTTCTTCTTGGTATGTTTGG + Intergenic
1110491560 13:76115587-76115609 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1110665451 13:78112013-78112035 TTAGTTCTTCTTTTAATGTTTGG + Intergenic
1110888879 13:80673525-80673547 TTAGTTCTTCTTTACATGTTTGG + Intergenic
1110966451 13:81704407-81704429 TTATTTTTTCTTTCATAGTGAGG - Intergenic
1110974472 13:81812216-81812238 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1111082433 13:83328801-83328823 TTAGTTCTGCTTTATAAGTTTGG - Intergenic
1111093544 13:83478677-83478699 TTATTTCCTCTTTGAAACTTAGG + Intergenic
1111130727 13:83972090-83972112 TTAGTTCTTCTTTCAGTGTTTGG - Intergenic
1111137141 13:84062705-84062727 TTAGTTATTCTTTGAAAGCCTGG + Intergenic
1111158441 13:84359765-84359787 TTATTTCTACATTAATAGTTTGG + Intergenic
1111416483 13:87953111-87953133 TTAGTTTTTCTTTTAAAGTTTGG - Intergenic
1111722150 13:91959457-91959479 TTAGTTCTTCTTTGATAGTTTGG - Intronic
1111792812 13:92880000-92880022 TTACTTCTTCTTTGTTAATCTGG - Intergenic
1112080319 13:95962609-95962631 TGTGTTCTTTTTTGAAAGTTTGG - Intronic
1112618506 13:101030546-101030568 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1112821475 13:103341878-103341900 TTAGTCATTCTTTGAAAGATTGG + Intergenic
1112846066 13:103645654-103645676 TTAGTTTTTCTTTGTATGTTTGG + Intergenic
1112901196 13:104359264-104359286 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1113002007 13:105651032-105651054 TTCCCTCTTCTTTGATATTTTGG - Intergenic
1113072195 13:106432915-106432937 TTAATTCTTCTTCCATAGTGGGG - Intergenic
1113344447 13:109461678-109461700 ATAGTTCTTCTTTCAGTGTTTGG + Intergenic
1114326547 14:21594846-21594868 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1114593108 14:23887039-23887061 TTAATTCTTCTTTTAATGTTTGG - Intergenic
1114761322 14:25318440-25318462 TTAGTTCTTCGTTAAATGTTTGG + Intergenic
1114762644 14:25333498-25333520 TTAGATCTTCTTTGAAAGTTTGG - Intergenic
1114937698 14:27563922-27563944 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1115108188 14:29786418-29786440 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1115338430 14:32266569-32266591 TTAATTCTGCTTTGAATGTTTGG - Intergenic
1115401408 14:32965129-32965151 TTAGTTTTTCTTTAAATGTTTGG - Intronic
1115477773 14:33832721-33832743 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1115578129 14:34731145-34731167 TTAGTTCTTCTTTAGATGTTTGG - Intergenic
1115661577 14:35499986-35500008 TTAGTTCTTCTCTAAATGTTTGG - Intergenic
1115815360 14:37158146-37158168 TTAGTTTTTCTTTGTATGTTTGG - Intronic
1115841772 14:37480101-37480123 TTAGTTCTTCATTAAATGTTTGG - Intronic
1115856668 14:37637108-37637130 TTCGTTCTTCTTTTTTGGTTTGG - Intronic
1115869085 14:37779602-37779624 TTTTTTGTTCTTTGAAAGTTTGG + Intronic
1115955917 14:38778986-38779008 TTAGTTCTTCTTTAAGTGTGTGG - Intergenic
1116027220 14:39529499-39529521 TTAGTTGTTCTTTAAATGTTTGG + Intergenic
1116110027 14:40566294-40566316 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1116140580 14:40988466-40988488 TTGGCTCGTCTTTGAAAGTTTGG + Intergenic
1116355121 14:43918673-43918695 TTATTTCTTCTTTAAAGGTTTGG - Intergenic
1116422291 14:44746248-44746270 TTAGTTCTTCTTTAAAGGTTTGG - Intergenic
1116505556 14:45674755-45674777 TTAGTTTTTCTTTAAAAGCTTGG + Intergenic
1116659254 14:47687553-47687575 TTAGTTCATCTTTTTAAGTTTGG + Intergenic
1116668549 14:47811191-47811213 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1116685838 14:48036966-48036988 ATAGTTCTTCATTGAAAATTTGG + Intergenic
1116750806 14:48881232-48881254 ATATTTCTTAATTGATAGTTTGG - Intergenic
1116894151 14:50299387-50299409 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1117158965 14:52969221-52969243 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1117442482 14:55773147-55773169 ATAGTTGTTCTTAGATACTTTGG + Intergenic
1117482741 14:56164616-56164638 TTAGTTCTTCTTTAAATGCTTGG + Intronic
1117512541 14:56468212-56468234 TTAGGTCTTTTTTGTAAGTTTGG - Intergenic
1117572765 14:57064453-57064475 TTAATTCTTCTTTGTAAGTCTGG + Intergenic
1117744694 14:58856972-58856994 TGAGTTCTTCTTTGAAAGTTTGG + Intergenic
1117842726 14:59877048-59877070 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1117928352 14:60809935-60809957 TTAATTCTTCTTTAAATGTTTGG + Intronic
1118080523 14:62353855-62353877 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
1118263796 14:64273869-64273891 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1118413773 14:65510505-65510527 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1118562759 14:67104436-67104458 TGAGTTCTTCTTTAAATGTTTGG + Intronic
1118798121 14:69163410-69163432 TTAGTTCTTCTTGAAATGTTTGG - Intergenic
1119699033 14:76738711-76738733 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
1120181509 14:81347485-81347507 TTAATTCTTCTTTATAAGTTTGG - Intronic
1120197308 14:81498850-81498872 TTACTTTTTCTTTGCTAATTTGG - Intronic
1120276092 14:82374668-82374690 TTAGTTCTTCTTTAAATGGTTGG - Intergenic
1120340398 14:83213376-83213398 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1120346102 14:83292296-83292318 TTAGTTCTTCTTTATATGTTTGG + Intergenic
1120394341 14:83949449-83949471 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1120431028 14:84415697-84415719 TTAGTTCTGCTTTAAAAGTTTGG + Intergenic
1120439381 14:84516591-84516613 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
1120573240 14:86147998-86148020 TTATTTCTTCTTTGAAAGAGAGG + Intergenic
1122367985 14:101207336-101207358 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1122435926 14:101698389-101698411 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1122528004 14:102402953-102402975 TTAGTTCTTCTTTAAATGCTTGG - Intronic
1122670727 14:103369825-103369847 TAATGTCTTCTTTGATAATTTGG + Intergenic
1122928381 14:104921344-104921366 TTAGTTCTTTTTTGTAAGTTTGG + Intergenic
1123111727 14:105872803-105872825 TTAGTTCTACTTTAAATGTTTGG + Intergenic
1123411230 15:20061633-20061655 TTAGTTCTTCTTTAAACATTTGG - Intergenic
1123462815 15:20489250-20489272 ATAGTTCTTCTTTAAATGTTTGG + Intergenic
1123520576 15:21068744-21068766 TTAGTTCTTCTTTAAACATTTGG - Intergenic
1123655244 15:22511169-22511191 ATAGTTCTTCTTTAAATGTTTGG - Intergenic
1123981044 15:25603534-25603556 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1124020425 15:25916966-25916988 TTAGTTCTTCTTTGACTGTTCGG + Intergenic
1124037379 15:26067726-26067748 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1124074084 15:26426101-26426123 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1124115633 15:26840995-26841017 TTATTTCTTCTTTGATCTATGGG - Intronic
1124182888 15:27494421-27494443 TTAATTCTTCTTTAAATGTTTGG + Intronic
1124265211 15:28226901-28226923 TTAATTCTTCTTTAAAGGTTTGG + Intronic
1124395551 15:29298155-29298177 TTATTTCTTCTTTGATTCATAGG - Intronic
1124843847 15:33270829-33270851 TTAGTTCTTCTTTAAATGCTTGG + Intergenic
1125090762 15:35789348-35789370 TTAGTTCTTCTTTGTAAGTTTGG + Intergenic
1125120300 15:36149676-36149698 TTAGTTCTTATTTAAATGTTTGG - Intergenic
1125432804 15:39613518-39613540 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1125445381 15:39749217-39749239 TTAATTCTTCTTGGAGAGTTTGG - Intronic
1125590450 15:40851485-40851507 TTTGTTCTTGTTTGGTTGTTGGG - Intronic
1126015927 15:44350535-44350557 TTAGTTTTTCTTTAAGTGTTTGG - Intronic
1126195907 15:45931314-45931336 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1126202344 15:46001231-46001253 TTAGTTCTTCTTTGTGAGTTTGG + Intergenic
1126252950 15:46589552-46589574 TAAGTTCTTCTGTGAAACTTGGG + Intergenic
1126305775 15:47255019-47255041 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1126488476 15:49209910-49209932 TTAGTTCTTCTTTAAAGGTTTGG + Intronic
1126516807 15:49548602-49548624 TTAGTTCTTCTTTGAATGTTTGG + Intronic
1126526259 15:49658017-49658039 TTAGTTCTTCTTTTAATATTTGG + Intergenic
1126534312 15:49744169-49744191 GTAGTTCTTCTTTCAATGTTTGG - Intergenic
1126612992 15:50548497-50548519 TTACTTCTTCTTTACTAGTGAGG + Intergenic
1126737394 15:51745176-51745198 TTAGTTTTTCTTTAAATGTTTGG - Intronic
1126745405 15:51821333-51821355 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1126944067 15:53798629-53798651 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1126998220 15:54470322-54470344 TTAGTTCTTCTTGAAATGTTTGG + Intronic
1127027726 15:54825785-54825807 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1127173909 15:56333083-56333105 TTACTTCTTCTTTAAATGTTTGG - Intronic
1127339408 15:58025570-58025592 TTAGTTATTCTTTGTATGTTTGG - Intronic
1127763084 15:62159829-62159851 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1128481163 15:68040057-68040079 TTAGCTCTTCTTTGAAAGTTTGG - Intergenic
1129068391 15:72930219-72930241 TTAGTTCTTCTTTGTATGTTTGG + Intergenic
1129209844 15:74062062-74062084 TGAGTTCTTCTTTTAATGTTTGG - Intergenic
1129404182 15:75303343-75303365 TGAGTTCTTCTTTAAATGTTTGG + Intergenic
1129546115 15:76397400-76397422 TTAGTTGTTCTTTAAATGTTTGG + Intronic
1129638186 15:77344999-77345021 TTACTTCTTCCTTTCTAGTTTGG + Intronic
1129747745 15:78036702-78036724 CTATTTATTGTTTGATAGTTTGG - Intronic
1130204965 15:81867296-81867318 CTATTTCTCCTTTGGTAGTTTGG - Intergenic
1130400087 15:83543578-83543600 TTAGTTCCTCTTTAAATGTTTGG + Intronic
1130419287 15:83726970-83726992 TTAGTTCTTGTTTAAATGTTTGG + Intronic
1130454009 15:84086296-84086318 TTATTTGTTCTTTGAATGTTTGG - Intergenic
1130574087 15:85075128-85075150 TTATTTCTGCTCTGATATTTTGG + Intronic
1130718390 15:86360616-86360638 TTAATTCTTCTTTGAATGTTTGG + Intronic
1131064870 15:89427873-89427895 TTTGTTTTTCTTTTAGAGTTAGG - Intergenic
1131314896 15:91327072-91327094 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1131323203 15:91416853-91416875 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
1131658606 15:94488848-94488870 TTAGCTCTTCTTTGAAAATTTGG - Intergenic
1132127646 15:99242412-99242434 TTGTTTCTTCTTTAATGGTTTGG - Intronic
1132438970 15:101839958-101839980 TTAGTTATTCTTTAAATGTTTGG + Intergenic
1133482035 16:6180199-6180221 ATAATTCTTCTTTGAAATTTTGG + Intronic
1134051344 16:11139963-11139985 TTAGTCCTACTTTTATAGCTGGG + Intronic
1135030122 16:19031508-19031530 TTATTTCTTCTTTATTAGCTGGG + Intronic
1135828262 16:25749610-25749632 TTAGTCCTTCTATGTGAGTTTGG + Intronic
1135902872 16:26481755-26481777 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1136670973 16:31857058-31857080 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
1136703399 16:32164339-32164361 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1136764300 16:32763260-32763282 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1136803798 16:33107126-33107148 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1137362885 16:47836024-47836046 TTACTTCTTCTTTTCCAGTTTGG - Intergenic
1137451635 16:48580493-48580515 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1137892442 16:52176668-52176690 TTAGTTCTTTATTTATAGTAAGG - Intergenic
1137957736 16:52849769-52849791 TTATTTCTTCTTCAAAAGTTTGG + Intergenic
1138256139 16:55563289-55563311 TTAGTACTTCTTTCAATGTTTGG - Intronic
1138746950 16:59374684-59374706 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1138753365 16:59451398-59451420 TGAATTCTTCTTTGACAGATTGG + Intergenic
1138864997 16:60807155-60807177 TTAGTTCTTCTTTGAATATTTGG - Intergenic
1139023195 16:62778470-62778492 TTAATTCTTCTTTAATTTTTTGG + Intergenic
1139031666 16:62890155-62890177 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
1140157764 16:72451107-72451129 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1140828331 16:78727836-78727858 TCAGTGCTTCTTGGATATTTTGG + Intronic
1140970639 16:80009171-80009193 TTAATTCCTCTTCCATAGTTAGG - Intergenic
1141221693 16:82075779-82075801 TTAGTTCTTCTTTAAAAGTTTGG - Intronic
1141485548 16:84337181-84337203 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1141505296 16:84473135-84473157 TGAGTTCCTCTTTGCCAGTTGGG - Intergenic
1203066657 16_KI270728v1_random:1025384-1025406 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1142633633 17:1242823-1242845 TTGGTTTTTTTTTGGTAGTTTGG + Intergenic
1144124686 17:12191877-12191899 TTAGTTTTTATTTGAAAGTTTGG + Intergenic
1144132649 17:12262938-12262960 TTAGTTCTTCTAAGATGGTTAGG + Intergenic
1144276174 17:13670690-13670712 TTATTTATTTTTTGAAAGTTTGG - Intergenic
1144338298 17:14291967-14291989 TTTGTAATTCTTTGAGAGTTAGG - Intergenic
1145194291 17:20874700-20874722 TTAATTCAACTTTGAAAGTTTGG + Intronic
1145297749 17:21606408-21606430 TTAATTCAACTTTGAAAGTTTGG - Intergenic
1145352508 17:22097015-22097037 TTAATTCAACTTTGAAAGTTTGG + Intergenic
1146413142 17:32606266-32606288 TTATTTCTTCTTTAAATGTTTGG - Intronic
1146473733 17:33145119-33145141 TATGTTCTTCTTTGATGGTGGGG + Intronic
1146750035 17:35369927-35369949 TTAGTTCTTCTTTAACTGTTTGG - Intronic
1147920815 17:43915894-43915916 TTAGTTTTTCAAAGATAGTTTGG - Intergenic
1148536289 17:48441851-48441873 TTATTTCCTCATTTATAGTTGGG - Intergenic
1148671986 17:49417794-49417816 TTATTTCTTCTTTATAAGTTTGG + Intronic
1148710191 17:49674282-49674304 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1149054184 17:52343152-52343174 TTAGTTCTTATTTAAATGTTTGG + Intergenic
1149113135 17:53058944-53058966 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
1149147155 17:53508147-53508169 TTATTTGTTATTTGTTAGTTTGG - Intergenic
1149232345 17:54549739-54549761 TTAGTTGTTCTTTAAGTGTTTGG + Intergenic
1149235487 17:54585442-54585464 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1149240750 17:54645844-54645866 TTAGATCTTCTTTAAACGTTTGG - Intergenic
1149614136 17:57984126-57984148 TTAGTCTGTCTTTGAGAGTTTGG - Intronic
1149949020 17:60964615-60964637 TTAATTCTTCTTTAAATGTTTGG + Intronic
1150022607 17:61633698-61633720 TTCGTTCTTCTTTAAATGTTAGG + Intergenic
1150028462 17:61704357-61704379 TTATTTCTTCTTTAAATGTTTGG + Intronic
1150028469 17:61704551-61704573 TTATTTCTTCTTTAAATGTTTGG + Intronic
1150512281 17:65767935-65767957 TTAATTCTTTTTTGAAAGTTTGG - Intronic
1150545168 17:66149410-66149432 TTAATTCTTCTTTAAATGTTTGG + Intronic
1150697183 17:67415974-67415996 TTCATTCTTCTTTGTTCGTTAGG + Intronic
1152219697 17:79056452-79056474 TAAGGTCTTCTTTAACAGTTCGG - Intergenic
1153056036 18:947341-947363 TTAGTTTTTCTTTATAAGTTTGG + Intergenic
1153074993 18:1152178-1152200 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1153388562 18:4528424-4528446 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1153754662 18:8268491-8268513 TTAATTCTTCTTTAAATGTTTGG - Intronic
1154097923 18:11437176-11437198 GTATTTGTTCTTTGAAAGTTTGG - Intergenic
1154230824 18:12554554-12554576 TTAGTTCTTCTTTAAATGTTAGG - Intronic
1154938155 18:21082248-21082270 TTAATTCTTCTTTAAACGTTTGG - Intronic
1154989491 18:21587336-21587358 TTAATTCTTCTTTAAATGTTTGG + Intronic
1155013658 18:21809326-21809348 TTAGTTCTTTTTTAAATGTTTGG - Intronic
1155282577 18:24255265-24255287 TTAGTTCTCCTTTAAATGTTTGG - Intronic
1155443731 18:25888698-25888720 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1155810517 18:30227402-30227424 TTAGTTCTTCCTTATAAGTTTGG - Intergenic
1156005254 18:32432855-32432877 TTATTTCTTCTTTAAATGTTTGG - Intronic
1156055944 18:33003090-33003112 TTAGCTCTTCTTTAAATGTTTGG - Intronic
1156140909 18:34110065-34110087 TTAATTCTTCTTGGAATGTTTGG - Intronic
1156146767 18:34191695-34191717 TTAGCTCTTGTTTTATAGGTGGG + Intronic
1156243534 18:35276224-35276246 TTAATTCTTCTTTAAATGTTTGG + Intronic
1156441741 18:37196853-37196875 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1156653739 18:39258289-39258311 TCAGTTCTTCTTTGAAAGTTTGG - Intergenic
1156827768 18:41452600-41452622 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1157073357 18:44436277-44436299 TTGGTTCTTCTTTAAGTGTTTGG + Intergenic
1157398471 18:47364988-47365010 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1157886704 18:51374701-51374723 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1157917696 18:51683830-51683852 TTAGTTCTTCTTTAAAGGTTTGG - Intergenic
1158083390 18:53621078-53621100 TTACTTGTTATTTGAAAGTTTGG + Intergenic
1158096404 18:53777012-53777034 TGAGTTCTTCTTTAAATGTTTGG + Intergenic
1158267477 18:55676388-55676410 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
1158469037 18:57718422-57718444 TTAGTTCTTCTTTAAATGCTTGG - Intronic
1158577687 18:58653072-58653094 TTAGTTCTTGTTTGCATGTTTGG + Intergenic
1158735895 18:60078918-60078940 TTAGCTCTTCTTTGTAAGTTTGG - Intergenic
1158750638 18:60255469-60255491 TTTGCTATTCTTTGATATTTTGG - Intergenic
1158788751 18:60748851-60748873 TTACTTTTTCTTTGAGATTTTGG - Intergenic
1158853258 18:61517223-61517245 TTACTTTTTCTTTGGTAGGTTGG - Intronic
1159158482 18:64613443-64613465 TTAGTAGTTTTATGATAGTTTGG - Intergenic
1159229436 18:65587068-65587090 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
1159328533 18:66956197-66956219 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1159416679 18:68158782-68158804 TTAATTCTACTTTAAAAGTTTGG + Intergenic
1159802266 18:72916283-72916305 TTAGCTCTTCTTTAAACGTTTGG + Intergenic
1159908517 18:74120571-74120593 TTATTTCTTCTTTGATATATGGG - Intronic
1160138168 18:76292682-76292704 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1160141909 18:76331990-76332012 TTAGTTCTTCTTTAAATGATTGG - Intergenic
1161450103 19:4340820-4340842 TTAATTCTTCTTTGAACCTTTGG + Intronic
1162448672 19:10740813-10740835 TGATTTCTTCTTTGATACATAGG + Intronic
1162610911 19:11751126-11751148 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1163696551 19:18766904-18766926 TTAATTCCTCTTTAAAAGTTTGG + Intronic
1164547174 19:29177252-29177274 TTAGTCCTTCTTTAAATGTTTGG - Intergenic
1164568026 19:29343208-29343230 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1165523218 19:36330605-36330627 CTAGATCTTCTTTTATACTTTGG + Intergenic
1165615432 19:37195718-37195740 CTAATTCTTCTTTGTAAGTTTGG - Intronic
1166031234 19:40131412-40131434 TTAATTCTTCTTTAACTGTTAGG - Intergenic
1166772639 19:45293611-45293633 TTATTTCTTCTTTAAGTGTTTGG - Intronic
1167965958 19:53146927-53146949 TTAGTTCTTCTTCAAGTGTTTGG - Intronic
1168438968 19:56347158-56347180 TTAGATTTTCTTTTATACTTTGG + Intronic
1168653735 19:58111669-58111691 TTAATTCTTCTTTAATTGTTTGG - Intronic
1202646874 1_KI270706v1_random:150411-150433 TTAATTCTTCTTTAAATGTTAGG - Intergenic
924968857 2:104840-104862 TTATTTCTTCTCTGTAAGTTTGG + Intergenic
925087644 2:1122169-1122191 TTATTTCTTCTTTGAATATTTGG - Intronic
925106042 2:1292923-1292945 TTAATTCTTCTTTAAATGTTTGG + Intronic
925476087 2:4216616-4216638 TTAGTTCATTTTTGGGAGTTGGG - Intergenic
925483955 2:4307160-4307182 TGAGTTGTTCTTTAAAAGTTTGG + Intergenic
925697798 2:6599925-6599947 TTAATTTTTCTTTGAAAGTTTGG - Intergenic
926477123 2:13337502-13337524 TTATTTCTTTTTTGCTTGTTTGG + Intergenic
926494535 2:13568585-13568607 TTAATTCTTCTTTAAAAGTCGGG - Intergenic
926623015 2:15064677-15064699 TTCCCTCTTCTTTGATATTTTGG - Intergenic
926654499 2:15386367-15386389 TTATTTTTACTTTGATAGTTGGG + Intronic
926690764 2:15731789-15731811 TTAGTGCTTCTTTGCCATTTGGG + Intronic
926768170 2:16342493-16342515 TTATTTCTTCTTTGAAAGTTTGG - Intergenic
926833663 2:16993303-16993325 TTAGTTCTTCTTGAAAGGTTTGG + Intergenic
926900398 2:17745272-17745294 TTAATTCTTCTTTAAATGTTTGG + Intronic
927722240 2:25391230-25391252 CTAGTTTTTCTTTCATAGCTTGG - Intronic
927902827 2:26833671-26833693 TTATTTCTTCCTTGAATGTTTGG - Intergenic
927931398 2:27047599-27047621 TTATTTCTTCTTTTCTAGGTTGG + Intronic
928293884 2:30065106-30065128 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
928448724 2:31358330-31358352 TTAATTCTTCTTTAAATGTTTGG - Intronic
928459757 2:31459921-31459943 TTAGTTCTTCTTTAATTGTTTGG - Intergenic
928473616 2:31600626-31600648 TTAGTTGTTCTTTAAAAGTTTGG - Intergenic
928476934 2:31637049-31637071 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928494887 2:31821554-31821576 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928609614 2:32978786-32978808 TTAGTTCTTCTTTAAATGTTTGG + Intronic
928679466 2:33685297-33685319 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928720503 2:34115471-34115493 TTATTTCCTCTTTGGTTGTTGGG + Intergenic
928834413 2:35525932-35525954 TTAGCTCTTCTTTTAATGTTTGG + Intergenic
928932804 2:36642213-36642235 TTAGTTCTTCTTTAAATGTTTGG - Intronic
929026463 2:37608636-37608658 TTAATTCTTCTTTAAATGTTTGG - Intergenic
929045908 2:37789386-37789408 TTAATTCTTCTTTAAATGTTTGG + Intergenic
929371619 2:41231285-41231307 TTAGTTCTTCTTTATATGTTTGG + Intergenic
929388336 2:41438562-41438584 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
929626262 2:43411089-43411111 TTAATTCTTGTGTGATTGTTAGG - Intronic
929782844 2:44968528-44968550 ATAGTTCTTGTTTCATATTTTGG - Intergenic
929812626 2:45204304-45204326 TTAGTTCCTCTTTATAAGTTTGG - Intergenic
930141883 2:47959866-47959888 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930294731 2:49540828-49540850 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930413629 2:51060748-51060770 TTAATTCTTCTTTAAATGTTTGG - Intergenic
930429454 2:51255155-51255177 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
930442216 2:51423676-51423698 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930524698 2:52513277-52513299 TTAATTCTTCTTTAAATGTTTGG - Intergenic
930624698 2:53683554-53683576 TTAGTTCTTCTTTAAATATTTGG + Intronic
930935361 2:56943061-56943083 TTAGTTCTTGTTTAAATGTTTGG + Intergenic
931024794 2:58098906-58098928 TTTGTGCTTCATTGATAGGTAGG + Intronic
931134398 2:59380318-59380340 TCAGTTCTTCTTTATAAGTTTGG - Intergenic
931435734 2:62244470-62244492 TTATTTCTTCTTTCAATGTTTGG - Intergenic
931457221 2:62420661-62420683 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
931505845 2:62924764-62924786 TTAATTCTTCTTTAAGGGTTGGG - Intronic
931567905 2:63635284-63635306 TTAATTCTTCTTTGAACATTTGG - Intronic
931580807 2:63771456-63771478 TTATTTATTCTTTAATTGTTCGG - Intronic
931982215 2:67706108-67706130 TTTCTTCTTTTTTAATAGTTTGG - Intergenic
932085855 2:68759651-68759673 TTAGTTCTTCTTTAGACGTTTGG - Intronic
932342124 2:70970676-70970698 TTAATTCTTCTTTAAATGTTTGG + Intronic
932648178 2:73527348-73527370 TTAGTTCTTCTTTAACTATTTGG + Intronic
932786695 2:74611254-74611276 TTAGTTCTTCTTTAAATGTTTGG + Intronic
932889849 2:75583949-75583971 TTAATTCTTCTTTAAATGTTTGG - Intergenic
932905280 2:75742539-75742561 TTAATTCTTCTTTAAAGGTTTGG - Intergenic
932920755 2:75912125-75912147 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
932977508 2:76621771-76621793 TTAGTTCTTCTTTGTAGGTCTGG + Intergenic
932977960 2:76626827-76626849 TTAGCTCTTCTTTGTAAGTTTGG + Intergenic
933110307 2:78390897-78390919 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
933338416 2:80989770-80989792 TTAGTTCTTCTATAAATGTTTGG - Intergenic
933341141 2:81027534-81027556 TTAGTTCTTCTTGAAATGTTTGG + Intergenic
933388484 2:81641427-81641449 TTAGTTCTTCTTTCAATGTTTGG - Intergenic
933551209 2:83778530-83778552 TGAGTTCTTCTTTAAATGTTTGG + Intergenic
933601321 2:84334281-84334303 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
933617834 2:84501605-84501627 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
933852349 2:86379303-86379325 TTAATTCTTCTTTGCAAGTTTGG + Intergenic
934893949 2:98096198-98096220 TTAGTTCTTCTTTAAATGTTTGG + Intronic
934908858 2:98232068-98232090 GTAATTCTTCTTTGAATGTTTGG + Intronic
934932414 2:98437275-98437297 TGAGTTCTTCTTTGACCCTTTGG + Intergenic
935018429 2:99206540-99206562 TTAGTTCTTCTTTAAATGTTTGG + Intronic
935125384 2:100218159-100218181 TTAGTTTTTCTATGATATTGGGG - Intergenic
935143179 2:100373864-100373886 TTAATTCTTCTTTAAATGTTTGG - Intergenic
935393167 2:102575797-102575819 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
935478299 2:103553234-103553256 TTAGTTCTTCTGTAAATGTTTGG + Intergenic
935480245 2:103578909-103578931 TTAATTATTCTTTAAAAGTTTGG + Intergenic
935532915 2:104257097-104257119 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
935683664 2:105663413-105663435 TGATTTCTTCTTTGATATATGGG + Intergenic
935688115 2:105703909-105703931 TTCGTTTTTCTTTCAAAGTTTGG - Intergenic
935813288 2:106821582-106821604 TTAGTTCTTCTTTAAATGTTTGG - Intronic
935900761 2:107790023-107790045 TTAGTTCTTTTTTAAGTGTTTGG - Intergenic
935928083 2:108092251-108092273 TTACTTCTTCTTTAAATGTTGGG + Intergenic
935938392 2:108211953-108211975 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
936167384 2:110134403-110134425 TTAATTCTTCTTTAAAGGTTTGG - Intronic
936431485 2:112467623-112467645 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
936445848 2:112594564-112594586 TTAATTTTTGTTTTATAGTTTGG + Intergenic
936892292 2:117386050-117386072 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
936939438 2:117869161-117869183 TTAGTTCTTCTTTTAATGCTCGG + Intergenic
937180218 2:119988758-119988780 TTAATTCCTCTTTGAATGTTTGG - Intergenic
937194341 2:120137766-120137788 TTAGTTCTTCTTTAAATATTTGG - Intronic
937372622 2:121311363-121311385 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
937448589 2:121980518-121980540 TTATTTCTTCTTTAAATGTTTGG + Intergenic
937635149 2:124147218-124147240 TAACTTCTTCTTTAATACTTTGG + Intronic
937789947 2:125948863-125948885 TTAGTCCTTCTTTAAAACTTTGG - Intergenic
937805700 2:126141422-126141444 TTATTTCTTCTTTAAATGTTTGG + Intergenic
937830374 2:126414505-126414527 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
937863051 2:126727853-126727875 TTAATTCTTCTTTGAATGTTTGG - Intergenic
938095865 2:128462918-128462940 TTAATTTTTCTTTAAAAGTTTGG - Intergenic
938165779 2:129025181-129025203 TTAGTTCTTCTTTGTATGTCTGG + Intergenic
938548368 2:132355706-132355728 TTAATTCTTCTTTAAATGTTAGG + Intergenic
938575650 2:132601035-132601057 TTAGTTCTGATTTAAAAGTTTGG - Intronic
938822313 2:134971501-134971523 TTAGTTCTTCTTTATGAGTTTGG + Intronic
939244471 2:139605839-139605861 TTAGTTCTTCTTTAAAGATTTGG + Intergenic
939482355 2:142765256-142765278 TTTATTCTTCCTTGAAAGTTTGG - Intergenic
939503869 2:143019734-143019756 TTAGTTCTTCTTTAAGTGTTTGG + Intronic
939539260 2:143473491-143473513 TTGGTTCTGCTTTGACAGTTTGG + Intronic
939724998 2:145708047-145708069 TTAATTCTTCTTTAAATGTTTGG + Intergenic
939913411 2:148010752-148010774 TTAGTTCTTCTTTAAATGTTTGG - Intronic
940186425 2:150989609-150989631 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
940336280 2:152531307-152531329 TTAGATCCTATTTGAAAGTTTGG + Intronic
940362273 2:152808816-152808838 TTAGTTTTTCTTTGAAAGTTTGG + Intergenic
940387791 2:153093755-153093777 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
940503426 2:154523359-154523381 TTAGGTCTTCTTTAATTGTTTGG + Intergenic
940570379 2:155425216-155425238 TTAATTCTTCTTTAAAAGTTTGG + Intergenic
940757741 2:157702969-157702991 TCAGTTCTTCTTTGTGTGTTTGG - Intergenic
940785645 2:157978488-157978510 TTAGTTCTTCCTTAAATGTTTGG + Intronic
940920599 2:159301797-159301819 TTAGTTCTTCTCTAAATGTTTGG + Intergenic
941467804 2:165850810-165850832 TTAATTCTTCTGTGTAAGTTTGG + Intergenic
941500402 2:166267636-166267658 TTAGTTCTTCTTTAAATGTTTGG + Intronic
941530021 2:166656702-166656724 TTAGTTCATCTTTAAATGTTTGG + Intergenic
941589991 2:167407891-167407913 TTAGTTTTTCTTTAAGTGTTTGG - Intergenic
941631165 2:167885810-167885832 TTAATTCTTCTTTGAATGTCTGG - Intergenic
941672174 2:168306204-168306226 TTAGTTCTTCATTAAATGTTTGG + Intergenic
941749942 2:169124486-169124508 TTAGTTCTTCTTTGTACGTTGGG - Intergenic
941780197 2:169435696-169435718 TTAGTTCTTTTTTAAAAGTTTGG - Intergenic
941842647 2:170103564-170103586 TTATTTCTTCTTTAAAGGTTAGG + Intergenic
942175551 2:173330418-173330440 TTAATTCTTCTTTAATTTTTTGG + Intergenic
942265272 2:174218195-174218217 TTGGTTCTTCATTGATAGTAAGG - Intronic
942350406 2:175046623-175046645 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
942352517 2:175067139-175067161 TTAGTTCTTCTTTGAACATTTGG - Intergenic
942375921 2:175337608-175337630 TTAATCCTTCTTTGAAAGTTTGG + Intergenic
942813996 2:180030091-180030113 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
942814018 2:180030409-180030431 TTATTTCTTCTTTGTTATTCTGG + Intergenic
942834116 2:180272194-180272216 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
942863152 2:180640217-180640239 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
942899622 2:181098856-181098878 TTAATTCTTCTTTAAATGTTTGG - Intergenic
942971878 2:181966884-181966906 TTAGTCCTTCTTTAATTGTTTGG + Intronic
943126542 2:183800239-183800261 TTAATTTTTCTTTGAATGTTGGG + Intergenic
943215863 2:185033385-185033407 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
943236722 2:185331160-185331182 CTAGTTCTTCTTTAAAAGTTTGG + Intergenic
943294882 2:186125469-186125491 TTAGTTCTTTTTAGATATATAGG + Intergenic
943331526 2:186565475-186565497 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
943349738 2:186783205-186783227 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
943429902 2:187786217-187786239 TTTGTTCTTCTTTAGTTGTTTGG - Intergenic
943472109 2:188306892-188306914 TTATTTCTTCTTTAATATCTTGG - Intronic
943475983 2:188355589-188355611 TTATTTCTTCTTTACAAGTTTGG - Intronic
943484391 2:188461244-188461266 TTAGCTCTTCTTTAAATGTTTGG + Intronic
943659306 2:190540806-190540828 TTAGTTTTTCTTTCAATGTTTGG + Intergenic
943757516 2:191572056-191572078 TTAATTCATCTTTGATAGTTTGG + Intergenic
943857922 2:192822643-192822665 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
943987048 2:194636431-194636453 TTAGTTCTTCTTTTAAAGGTTGG - Intergenic
944043649 2:195383923-195383945 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
944073402 2:195698890-195698912 TTAGTTCTTCTTTAAATGTTAGG + Intronic
944096117 2:195969644-195969666 ATAGTTCTACTATGATAGTTGGG - Intronic
944215911 2:197255440-197255462 TTGGTTTTTCTTTCAGAGTTGGG - Intronic
944385216 2:199155722-199155744 TTTGTTTTTCTTTCATAGTCAGG - Intergenic
944629598 2:201610526-201610548 TTAGTTCTTCTTCGAGAGTTTGG - Intronic
944640514 2:201720028-201720050 TTATTTCTTCTTTGAATGTTTGG - Intronic
944751277 2:202713106-202713128 TTAGTTCTTCTTTAAATGTTTGG + Intronic
944922756 2:204432655-204432677 TTAGTTCTTCTTTGAAAATTTGG + Intergenic
945110910 2:206358539-206358561 TTAGTTCTTCTTTAAAGATTTGG - Intergenic
945149623 2:206775698-206775720 TTAGTTCTTCCTTAAATGTTTGG + Intronic
945334481 2:208576031-208576053 TTAGTTCTTCTTTGAATGTTTGG - Intronic
945484966 2:210383905-210383927 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
945659222 2:212664963-212664985 TTATTTCTTCTTTGAGTGCTAGG - Intergenic
945738611 2:213633046-213633068 TTAGTTCTTCTTTGAATGTTTGG + Intronic
945754158 2:213825834-213825856 TTAGGTCTTCTTTAAATGTTTGG + Intronic
945757941 2:213873137-213873159 TTAATTCTTCTTAAATATTTGGG + Intronic
945764782 2:213961958-213961980 TTAATTCTTCTTTGAATGTTTGG + Intronic
945789014 2:214279887-214279909 TTATTTCTTCTTTGATCCATGGG - Intronic
945970859 2:216229954-216229976 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
946508707 2:220330763-220330785 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
946957420 2:224946369-224946391 TTACTTTTTCTTTCATATTTTGG + Intronic
946975547 2:225145542-225145564 TTAGTACTTCTTTAAAAGTTTGG - Intergenic
947008834 2:225542843-225542865 TTAGTTCTTCTTTAAATGTTTGG + Intronic
947039331 2:225897667-225897689 TGAGTTGTACTTTAATAGTTTGG - Intergenic
947039552 2:225900849-225900871 TTAGTTCTTATTTAAATGTTTGG - Intergenic
947311901 2:228812655-228812677 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
947515714 2:230802331-230802353 CTAGTTCTTTTGTGATATTTGGG - Intronic
947686734 2:232093466-232093488 TTAATTCTTCTTTAAATGTTTGG + Intronic
948045867 2:234944527-234944549 TTAGTTATTCTTTAAATGTTTGG + Intergenic
948557920 2:238828358-238828380 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1168817582 20:750674-750696 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
1168823605 20:793766-793788 TTAGGTCTGCTATGGTAGTTTGG + Intergenic
1168871580 20:1133694-1133716 TTAATTCTTCTTTGAATGTTTGG + Intronic
1168899541 20:1350765-1350787 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1169587349 20:7100397-7100419 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1169607661 20:7340498-7340520 TTATTTCTTCTTTGAAAGTTTGG - Intergenic
1169624211 20:7544727-7544749 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1169628994 20:7604543-7604565 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1169989023 20:11479073-11479095 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1170240455 20:14160299-14160321 TTAGTTCTTCTTTGGAAGTTTGG + Intronic
1170401984 20:15996422-15996444 TTAATTCTTCTTTAAATGTTTGG + Intronic
1170402094 20:15998256-15998278 TTAATTCTTCTTTAAATGTTTGG + Intronic
1170410520 20:16085344-16085366 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
1170491659 20:16882506-16882528 TTAGTTCTTCTTTGTATATTTGG + Intergenic
1170657383 20:18301827-18301849 TTAGTTCTTCTCTAAATGTTTGG - Intronic
1170695125 20:18651135-18651157 TTAGTTTTTGTTTGTTTGTTTGG + Intronic
1171000670 20:21412518-21412540 TTAGTTCTTCTTTGCACATTTGG + Intergenic
1171132847 20:22670260-22670282 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1171726739 20:28629515-28629537 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1171751525 20:29055095-29055117 TTAGTTCTTCTTTGAATATTTGG + Intergenic
1171786791 20:29473619-29473641 GAAGTTCTTCTTTGAAAGTAGGG + Intergenic
1171790807 20:29522780-29522802 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1171877238 20:30588482-30588504 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1172203457 20:33144374-33144396 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1172419352 20:34801962-34801984 TTAGTTCTTCCTTAAATGTTTGG - Intronic
1173099277 20:40069555-40069577 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1173720070 20:45250267-45250289 TTAACTCTTCTTTAAAAGTTTGG - Intergenic
1174640684 20:52041273-52041295 TTAGTCCTTCTTTGGTAGGGAGG + Intergenic
1174981830 20:55404648-55404670 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1175536187 20:59715690-59715712 TTATTTCTTCCTTGAGAGCTTGG + Intronic
1176604993 21:8822363-8822385 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1176873480 21:14102860-14102882 TTATTGCTTCTTTGAAAGGTGGG + Intergenic
1176918154 21:14651092-14651114 TTAATTCTTCTTTAAAGGTTTGG - Intronic
1176995083 21:15545273-15545295 TTAGTTATTCTTTAAATGTTTGG - Intergenic
1177083032 21:16665534-16665556 TTAGTTTTTCTTTAAAAGTTTGG - Intergenic
1177090500 21:16761335-16761357 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1177108224 21:16988194-16988216 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
1177456603 21:21347566-21347588 TTAGCTCTTCTTTAAATGTTTGG - Intronic
1177487766 21:21781303-21781325 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1177727035 21:24983250-24983272 TAAATTCTTCTGTGACAGTTTGG - Intergenic
1177771640 21:25523168-25523190 TTAGTTTTTCTTTAAAACTTTGG - Intergenic
1177910802 21:27029278-27029300 TTATTTCATTTTTGATACTTTGG + Intergenic
1178003358 21:28189530-28189552 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1179090402 21:38259979-38260001 TTAGTTCTCCTTTTAAAGGTAGG - Intronic
1179118202 21:38515485-38515507 TTAGTTCTTCTTTCTAAGTTTGG - Intronic
1180249668 21:46574244-46574266 TTATTTCTTCTTTGATCCATTGG - Intergenic
1180290194 22:10842951-10842973 TTATTTCTTCTTTGACACATCGG + Intergenic
1180347284 22:11713968-11713990 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1180355036 22:11832055-11832077 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1180360759 22:11893458-11893480 TTATTTCTTCTTTGAGACCTTGG + Intergenic
1180383214 22:12160276-12160298 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1180492992 22:15872372-15872394 TTATTTCTTCTTTGACACATCGG + Intergenic
1180607602 22:17071486-17071508 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1180761645 22:18214448-18214470 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1180774022 22:18410162-18410184 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1180805372 22:18709702-18709724 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1180860609 22:19078901-19078923 TTAATTCTTCTTTAAACGTTTGG + Intronic
1180974095 22:19836446-19836468 TTATTTCTTCTTTAAATGTTTGG - Intronic
1181070132 22:20329175-20329197 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1181193126 22:21157113-21157135 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1181216320 22:21335488-21335510 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1181717765 22:24746019-24746041 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1182201573 22:28576562-28576584 TTAGTTCTTCTTTAAATGCTTGG + Intronic
1182406737 22:30140361-30140383 TTAATTCTTCTTTAAATGTTTGG + Intronic
1182703433 22:32259772-32259794 TTAATTCTTCCTTAATTGTTGGG + Intergenic
1183562571 22:38587643-38587665 TTAATTCTTCCTTAATGGTTTGG - Intronic
1184050036 22:41997631-41997653 TTAGTTTTTGTTTGTTTGTTTGG - Exonic
1184305301 22:43595660-43595682 TTAGTTCTTCTCTAAATGTTTGG - Intronic
1184862788 22:47184326-47184348 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1184905297 22:47480211-47480233 TTAATTCTTCTTAGAATGTTTGG - Intronic
1185298528 22:50066792-50066814 TGAGCTCGTCTTTTATAGTTTGG + Intronic
949595641 3:5543492-5543514 TTAATTCTTCTTTAAATGTTTGG + Intergenic
949828921 3:8192973-8192995 TTATTTCTTCTTTAAATGTTTGG + Intergenic
950238434 3:11345049-11345071 TTATCTGTTCTTTGATGGTTAGG + Intronic
950341422 3:12248630-12248652 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
950625093 3:14239729-14239751 TTAATTCTTCTTTGAACGTTTGG + Intergenic
950701121 3:14748051-14748073 TTAGTTCTTCTTTAAATTTTAGG + Intronic
950823551 3:15790210-15790232 TTAGTTCTTCTTTAAATGTTTGG - Intronic
950843601 3:15992223-15992245 TGATTTCTTCTTTGAATGTTTGG + Intergenic
950960684 3:17103163-17103185 TTAATTCTTCTTTAAATGTTTGG - Intergenic
950992418 3:17453679-17453701 TTAGTTCTTCTTTAAATGTTTGG - Intronic
951028580 3:17856353-17856375 TTAGTTCTTCATTAAATGTTTGG + Intronic
951271150 3:20626071-20626093 TTAGTTCTTTTTTATAAGTTAGG - Intergenic
951282420 3:20768883-20768905 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
951382575 3:22002492-22002514 TTAGTTCTTATTTAACAGTTTGG - Intronic
951423439 3:22514830-22514852 TTAGTTCTGCTTTAAATGTTTGG - Intergenic
951716446 3:25653197-25653219 TTAATTCTTCTTTGATTATTTGG - Intronic
951733845 3:25840836-25840858 TTAATTCTTCTTTGAATGTTTGG - Intergenic
951818300 3:26780642-26780664 TTATTTCTTCTTTAAATGTTTGG + Intergenic
952143609 3:30506564-30506586 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
952162033 3:30703490-30703512 TTAGTTTTTCAAAGATAGTTTGG - Intergenic
952222280 3:31336038-31336060 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
952243270 3:31556993-31557015 TTTCTTCTACTTTTATAGTTTGG + Intronic
952415576 3:33087675-33087697 TTAATTCTTCTTTAAATGTTTGG - Intronic
952592840 3:34978266-34978288 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
952995333 3:38875374-38875396 TTAATTCTTCCTTGGAAGTTTGG + Intronic
953088494 3:39698540-39698562 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
953217532 3:40934568-40934590 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
953229136 3:41048482-41048504 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
953267265 3:41403187-41403209 TTAATTCTTCTGTAATTGTTTGG + Intronic
953273645 3:41472685-41472707 TTAGTTTTTCTTTAAAAGTTTGG - Intronic
953280590 3:41551684-41551706 TTAATTCTTCTTTGAAAGTTTGG - Intronic
953542073 3:43829647-43829669 TTAATTCTTCTTTAAATGTTTGG + Intergenic
953593026 3:44278453-44278475 TTAGTTCTTCTTCGAAAGTTTGG + Intronic
953803000 3:46042736-46042758 TTAATTCTTCTTTAAATGTTTGG - Intergenic
953864025 3:46568107-46568129 TTAGCTCTTCTTTAAATGTTTGG - Intronic
954487553 3:50868001-50868023 TTAGTTCTTCTTTAAATGTTAGG + Intronic
954507130 3:51087038-51087060 TTAGTTCTTCCTTATAAGTTTGG - Intronic
954551813 3:51488167-51488189 TTAATTCTTCTTTAAATGTTTGG - Intronic
954963478 3:54587891-54587913 TTAATTCTTCTTTAAATGTTTGG - Intronic
955249619 3:57266272-57266294 TTAGTTCTTCTTTAAATGTTTGG + Intronic
955460453 3:59176751-59176773 TTAGTTCTTCTTTAAATATTTGG + Intergenic
955622703 3:60882291-60882313 TTAGTTCTTCTTTAAATGTTTGG - Intronic
955641590 3:61091621-61091643 TTAGTTTTACTTTGATTTTTAGG - Intronic
955748066 3:62159625-62159647 TTATTTCTTCTTTGAGCGTATGG - Intronic
955782066 3:62495291-62495313 TTTGTTCTTCTTGGAGAGTCAGG - Intronic
955932262 3:64068860-64068882 TTAGTCCCTCTTTGAAAGTTTGG + Intergenic
956391829 3:68781675-68781697 TTAATTCTTCTTTAAATGTTAGG - Intronic
956400709 3:68876996-68877018 TCAGTTCTTCTTTCATTCTTGGG - Intronic
956912836 3:73837943-73837965 TTAGTTCTTCTTTAAAAGCTTGG - Intergenic
957241397 3:77665321-77665343 CTAGTTCTTCTATGCTAGTTCGG - Intergenic
957267880 3:77990404-77990426 TTAGTTCTTCTTTAAATGTGTGG + Intergenic
957506580 3:81129045-81129067 TTAGTTCTCCTTTGAATATTTGG - Intergenic
957755951 3:84487741-84487763 TTAATTCTTCTTTAAATGTTTGG + Intergenic
957907223 3:86573051-86573073 TTAGATCTTCTTTCAATGTTTGG + Intergenic
957974784 3:87429581-87429603 TAAGGTCTTCTCTGATTGTTAGG - Intergenic
957995579 3:87685384-87685406 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958063445 3:88512116-88512138 TTAATTATTCTTTGAATGTTTGG - Intergenic
958078629 3:88716302-88716324 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958084746 3:88792359-88792381 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
958100849 3:89007783-89007805 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
958100971 3:89009874-89009896 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958150103 3:89681412-89681434 GTAGTTCTTCTCAGATAGTGAGG + Intergenic
958617849 3:96518650-96518672 TTAATTCTTCTTTAAATGTTTGG - Intergenic
958637998 3:96770150-96770172 TTAATTCTTCTTTAAATGTTTGG - Intergenic
958639795 3:96791115-96791137 TTAGTTATTCTTTGAAAGTTTGG + Intergenic
958686298 3:97401224-97401246 TTAGTTCTTCTTTAACAGGGTGG + Intronic
958825879 3:99030379-99030401 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
958862094 3:99456843-99456865 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
958921153 3:100107000-100107022 GTATTTATTCTTTGAGAGTTAGG - Intronic
958976691 3:100675685-100675707 TTAGTTCTTCTTTAAATGTTTGG + Intronic
959118189 3:102202323-102202345 TTAATTCTTCTTTAAATGTTTGG + Intronic
959124626 3:102275721-102275743 TTAGTTCTTCTTTAAATGTTTGG + Intronic
959200618 3:103242016-103242038 TTAGTTCTTGTATAATATTTTGG + Intergenic
959229221 3:103626180-103626202 TTAGTTCTTCATTAAATGTTTGG + Intergenic
959285643 3:104405492-104405514 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
959328439 3:104969825-104969847 TTAGTTCTTCTCTAAATGTTTGG + Intergenic
959679948 3:109083575-109083597 TTAGTTCTTCTTTAAATGTTTGG - Intronic
960094924 3:113680176-113680198 TTAGTTCTTCTTTAGATGTTTGG + Intronic
960123512 3:113971753-113971775 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
960415706 3:117382813-117382835 TTTGTTCTTCTTTAAAAGTTTGG - Intergenic
960478119 3:118156126-118156148 TTAATTCCTCTTTAAAAGTTTGG - Intergenic
960481959 3:118202601-118202623 TTAATTTTTCTTTTTTAGTTTGG - Intergenic
960491098 3:118317424-118317446 TTAGTTCTTCTTTCCATGTTTGG - Intergenic
960607328 3:119520649-119520671 TTAATTCTTCTTTAACTGTTTGG - Intronic
960729042 3:120703969-120703991 TTATTTCTTCTTTGAAGGTTTGG - Intronic
960894056 3:122482972-122482994 TTCCTTCCTCTTTGATATTTTGG - Intronic
960929777 3:122835123-122835145 TAAATTCTTCTTTGAAAGTCCGG - Intronic
961416473 3:126761730-126761752 TTAATTCTTCTTTAAATGTTTGG + Intronic
961610898 3:128137603-128137625 TTAGTTCTTCTTTAAATGTTTGG - Intronic
961912597 3:130335490-130335512 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
962078428 3:132110686-132110708 TTAGCTCTTCTTTAAATGTTTGG + Intronic
962099958 3:132331377-132331399 TAAGTGCTTAGTTGATAGTTGGG - Intronic
962182176 3:133218960-133218982 TTAGTTCTTCTTTAAATGTTTGG + Intronic
962193901 3:133340480-133340502 TTAGTTGTTCTTTAAATGTTTGG - Intronic
962473403 3:135733549-135733571 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
962483654 3:135820403-135820425 TTAGTTCTTCTTGAAAAGTTCGG - Intergenic
962548333 3:136460735-136460757 TTAGTTCTTCTTTAAATGCTTGG - Intronic
962592120 3:136901456-136901478 TTAGTTCTTCTATGAGTGTTTGG + Intronic
962598612 3:136972384-136972406 TTAATTCTTCTTTGTATGTTTGG + Intronic
962638518 3:137357725-137357747 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
962650698 3:137486563-137486585 TAAGTTCTTCTTGGAAAGTTTGG + Intergenic
962734329 3:138311306-138311328 TTAGTTATTCTTTAAATGTTTGG - Intronic
962758854 3:138489783-138489805 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
963170437 3:142245021-142245043 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
963178452 3:142327183-142327205 TTAGCTCTTCTTTCAGCGTTTGG + Intronic
963448403 3:145444121-145444143 TTAGTTCTTCCTTCAATGTTTGG - Intergenic
963457313 3:145560570-145560592 TTACTTCTTCCTTTATAATTTGG + Intergenic
963514808 3:146294728-146294750 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
963626021 3:147673671-147673693 TTCCTTCTTCTATGATAGTAAGG - Intergenic
963687418 3:148454610-148454632 TTATTTGTTCTTTGATAATCAGG + Intergenic
963692612 3:148523560-148523582 TTAATTCTTCTTTAAATGTTTGG - Intergenic
963758754 3:149263429-149263451 TTAATTCTTCTTTGTAAGTTCGG - Intergenic
964140456 3:153392831-153392853 TTATTTCTTCTTTAAATGTTTGG + Intergenic
964179950 3:153871396-153871418 TTAGTTATTCTTTAAATGTTTGG - Intergenic
964456403 3:156872016-156872038 TTAGTTCTTCTTTGAAAGTTAGG + Intronic
964565184 3:158042530-158042552 TTAATTCTTCTTTGAATGTCTGG - Intergenic
964635695 3:158856245-158856267 CCAGTTCTTCTTTGAATGTTTGG + Intergenic
964901694 3:161667428-161667450 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
965010027 3:163075691-163075713 TTAGTTCTTCTTAAAATGTTTGG - Intergenic
965050764 3:163644272-163644294 TTTGTTCTTCTTTAAGTGTTTGG - Intergenic
965118036 3:164516367-164516389 TTATTTTTTCTTTGAATGTTTGG + Intergenic
965173974 3:165306454-165306476 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
965236593 3:166132484-166132506 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
965388136 3:168070890-168070912 TTCGCTCTTCTTTGTTAGTGGGG + Intronic
965444359 3:168756669-168756691 TTATTTCTTCCTTTATATTTTGG + Intergenic
965496712 3:169407196-169407218 TTATTTGTCATTTGATAGTTTGG - Intronic
965526698 3:169727708-169727730 TTAGTTCTTCTTTAAATGATTGG + Intergenic
965660480 3:171036675-171036697 TTACTTGGTCTTTGATAGGTAGG + Intergenic
965860930 3:173149217-173149239 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
966054234 3:175663084-175663106 TTGGTTCTTCTTTAAATGTTTGG + Intronic
966106630 3:176343560-176343582 TTAGTTCTTCTTTATCAGTTTGG + Intergenic
966250945 3:177864717-177864739 TGATTTCTTCTTTGATAAATAGG - Intergenic
966275826 3:178167137-178167159 TTATTTCTTCTTTTCTAATTTGG - Intergenic
966329713 3:178797298-178797320 TTAGTTGTTCTTTAAGTGTTTGG - Intronic
966499476 3:180622998-180623020 TTAGTTCTTCTTTGTATGCTTGG + Intronic
966694341 3:182774552-182774574 GGTGTTCTTCTTTGAAAGTTTGG + Intergenic
967006231 3:185385481-185385503 TTAGTTCTTCTTTATAAGATTGG - Intronic
967401383 3:189066231-189066253 TTAGTTCTTCTTTAAATATTTGG - Intronic
967631091 3:191743456-191743478 TAAGTACTTCCTTAATAGTTGGG - Intergenic
967668913 3:192208546-192208568 ATAGTTTTTCTTTTATAATTTGG - Intronic
967696627 3:192539727-192539749 TTAGTTCTTCTTTAAATGTTTGG + Intronic
967779713 3:193423276-193423298 TTAGTTCTTCTTTAAATGTTTGG - Intronic
967848829 3:194066309-194066331 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
967944576 3:194793089-194793111 TTAGTTCTTCTTTGTAAGTTTGG + Intergenic
968344783 3:197992695-197992717 TTAGTTCTTCTTTAAACATTTGG - Intronic
969473590 4:7406312-7406334 TCAGTTCTTCTTTAAATGTTTGG + Intronic
970070391 4:12152404-12152426 TTATTTCTTCTTTAAAAGTTTGG + Intergenic
970209350 4:13691973-13691995 TTAATTCTTCTTTGTAAGTTTGG + Intergenic
970784429 4:19779527-19779549 TTAGTTTTTCTTTAAAGGTTTGG + Intergenic
971161447 4:24137844-24137866 TTAGCTCTTGTTTGATTGTTTGG - Intergenic
971491913 4:27221966-27221988 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
971558696 4:28046523-28046545 TTGTTTCTTCTTTAAAAGTTTGG + Intergenic
971617856 4:28816072-28816094 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
971665671 4:29480552-29480574 TTAATTCTGCTTAGATAGTATGG + Intergenic
971690661 4:29830859-29830881 TTAGTTCTTCTTTCAATGTTTGG - Intergenic
972007485 4:34128805-34128827 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
972109944 4:35545036-35545058 TCAGTTCTTCTTTGAGCATTTGG - Intergenic
972225858 4:37011024-37011046 TTAGTTCTTCTTTAAATATTTGG - Intergenic
972270466 4:37505862-37505884 TTAGTTCTTCTTTAAATGTTTGG + Intronic
972271969 4:37520333-37520355 TTAGTTCTTCTTTAAACATTTGG + Intronic
972278078 4:37577161-37577183 TTAGTTCTTCTTTAAATATTTGG + Intronic
972554776 4:40170890-40170912 TTGGTTCCTCTTTGATATGTTGG + Intergenic
972851970 4:43061521-43061543 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
972928723 4:44044553-44044575 TTAATTCTTCTTTAAATGTTTGG - Intergenic
972967341 4:44527019-44527041 TTAGTTCTTCTTTACATGTTTGG + Intergenic
972996803 4:44889808-44889830 TTAGTTCTTCTTTAAATGTTCGG + Intergenic
973020859 4:45204896-45204918 TTAGTTGTTCTTTGTATGTTTGG + Intergenic
973185246 4:47319760-47319782 TTAGTTCTTCTCTGAATGTTTGG + Intronic
973196308 4:47446280-47446302 TTAATTCTTCTTTAAATGTTTGG - Intergenic
973327077 4:48873474-48873496 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
973373129 4:49268575-49268597 TTAATTCTTCTTTAAATGTTAGG - Intergenic
973387873 4:49526524-49526546 TTAATTCTTCTTTAAATGTTAGG + Intergenic
973579512 4:52328000-52328022 TTAGTTCTTCTTTAAATGTTAGG + Intergenic
973667044 4:53171579-53171601 TTAGTTCTTTTTTAAATGTTTGG + Intronic
973724381 4:53759506-53759528 TTAGTTCTTCTTTAAATGTTTGG - Intronic
973779546 4:54275695-54275717 TTAAGTCTTCTTAGAGAGTTAGG + Intronic
973877668 4:55236474-55236496 TTAGTTCTTCTTTAAATGCTTGG + Intergenic
973960660 4:56106688-56106710 TTGGTTCCTCTGTAATAGTTTGG + Intergenic
974243084 4:59277534-59277556 TTAGTTCTTCTGTGTAAGTTTGG - Intergenic
974302821 4:60091512-60091534 TTATTTCTTCTTTTCCAGTTTGG - Intergenic
974352571 4:60768878-60768900 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
974569390 4:63625558-63625580 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
974888889 4:67854828-67854850 TTAGTTCTTCTTTTAAGGTTTGG - Intronic
974892997 4:67904313-67904335 TTAGTTTTTCTTTAAGTGTTTGG + Intergenic
975053424 4:69895650-69895672 TTAGATTTTCTTTGATTTTTTGG + Intergenic
975223761 4:71845222-71845244 TTAATTCTTCTTTAAATGTTTGG + Intergenic
975388930 4:73793716-73793738 TTAGTTCTTTTGTGATATTAGGG - Intergenic
975454034 4:74567937-74567959 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
975463256 4:74679483-74679505 TTAATTCTTCTTTAAATGTTGGG + Intergenic
975502013 4:75097078-75097100 TTAGTTCTTGTTTAAATGTTTGG + Intergenic
975538167 4:75474022-75474044 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
975538322 4:75475796-75475818 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
975672065 4:76789923-76789945 TTAGTCCTTCTTTAAATGTTTGG - Intergenic
975949471 4:79751221-79751243 TCAGTTTTTCTTTAATTGTTTGG - Intergenic
976029728 4:80737364-80737386 TTATTTCTTCTTTAAAAGTATGG + Intronic
976323465 4:83743988-83744010 TTAATTCTTCTTTAAATGTTTGG - Intergenic
976347685 4:84024183-84024205 ATAGTTCCTCTTTTATTGTTTGG + Intergenic
976371766 4:84297970-84297992 TTAGTTCTTCTTTGTAAGTTTGG - Intergenic
976598768 4:86918651-86918673 TAAGTTCCCCTTTGGTAGTTGGG - Intronic
976702908 4:87990475-87990497 TTAATTCTTCTGTGAATGTTTGG - Intergenic
976742602 4:88372257-88372279 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
976776719 4:88714718-88714740 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
976900177 4:90164471-90164493 TGAGATCTTTTTTGATAGTCAGG + Intronic
976909679 4:90286212-90286234 TTTGTTCTTCTTTAAATGTTTGG + Intronic
977026269 4:91822472-91822494 TGATTTCTTCTTTGATTATTGGG + Intergenic
977044771 4:92055376-92055398 TTAGTTTTTCTTTAAGTGTTTGG - Intergenic
977185867 4:93935263-93935285 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977307761 4:95346344-95346366 TTAGTTCTTCTTTAAATGTTTGG - Intronic
977325889 4:95574152-95574174 TTTGTTCTTCTTTGAAAGTTTGG + Intergenic
977381064 4:96274272-96274294 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977522048 4:98097035-98097057 TTAGTTCTTCTTTTAATGTTTGG - Intronic
977719201 4:100219596-100219618 TTAGTTCTTTTTTGTAAGTCTGG + Intergenic
977872586 4:102110299-102110321 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977926798 4:102709559-102709581 TTAGTTCTTCGTTGTAACTTTGG - Intronic
977966008 4:103148975-103148997 TTAGTTCTTCTTTGGTTTGTAGG + Exonic
978176567 4:105739436-105739458 TTAGATCTTCTTTGAATGTTTGG + Intronic
978288004 4:107100741-107100763 TTAGTTCTTTTTTAAATGTTTGG - Intronic
978297941 4:107230472-107230494 TTAGTTCTTCTTTAAATGTTTGG - Intronic
978417795 4:108496277-108496299 TTATTTCTTCTTTAACTGTTGGG - Intergenic
978425148 4:108574327-108574349 TCATTTCTTCTTAGATATTTAGG - Intergenic
978519954 4:109605096-109605118 TTAGTTCTTCTTTAAATGTTTGG + Intronic
978733861 4:112063065-112063087 TTAGTTCTTCTTTAAATGTGTGG - Intergenic
978888435 4:113794438-113794460 TTAGTTCTTCTTTAAACATTTGG - Intergenic
978933939 4:114353222-114353244 TTAGTTCTTCTTCAAATGTTTGG + Intergenic
978968877 4:114777354-114777376 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
979004788 4:115279687-115279709 TTACTTCTTCTTTTCCAGTTTGG - Intergenic
979122171 4:116917557-116917579 TTATTTCTTCCTTTATAATTTGG + Intergenic
979212982 4:118128764-118128786 TTAGTTCTTCTTTAAATGTTTGG + Intronic
979364822 4:119809003-119809025 TTATTTCTTCTTTTCTAATTTGG + Intergenic
979372879 4:119910622-119910644 TTAAATCTTCTTTGAATGTTTGG + Intergenic
979437174 4:120706982-120707004 TTAATTCTTCTTTAAATGTTTGG - Intronic
979470076 4:121085213-121085235 TTAATTCTTCTTTAAATGTTTGG - Intergenic
979493287 4:121355148-121355170 TTAGTTCTTCTTTAAGTGTTTGG + Intronic
979496074 4:121384139-121384161 TTAATTCTTCTTTAAATGTTTGG + Intergenic
979496076 4:121384173-121384195 TTAATTCTTCTTTAAATGTTTGG + Intergenic
979594618 4:122520932-122520954 TTAGTTCTTCTTTAAATATTTGG + Intergenic
979775736 4:124586347-124586369 TTTTTTCTTCTTTGTTAGTCTGG - Intergenic
979781525 4:124657152-124657174 TTAATTCTTCTTTGAATGATTGG - Intergenic
979850822 4:125569162-125569184 TTAGTTCTTTGTTGAAAATTTGG + Intergenic
979879260 4:125934041-125934063 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
979975077 4:127185979-127186001 TTAGTTCTTCTTTAAATGGTTGG - Intergenic
980096841 4:128500649-128500671 TTAGTTCTTATTTAAAAGTTTGG + Intergenic
980185378 4:129454739-129454761 TGAGTTGGTCTTTGATAGGTTGG + Intergenic
980250441 4:130308248-130308270 TTGGTTCTTCTTTGAATGTATGG - Intergenic
980268774 4:130556221-130556243 TTAGATCTTCTTTAAATGTTTGG - Intergenic
980339251 4:131521363-131521385 TTAATTCTTCTTCAAAAGTTTGG + Intergenic
980409135 4:132391562-132391584 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
980413285 4:132451123-132451145 TTAGATTTTCTTTGAATGTTTGG - Intergenic
980437283 4:132793848-132793870 TTAGTTATTCTTTGTATGTTTGG - Intergenic
980594588 4:134936666-134936688 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
980850579 4:138376032-138376054 TTAATTCTTCTTTAAATGTTTGG - Intergenic
981180647 4:141739524-141739546 TTAGTTCTTGTTTCAATGTTTGG - Intergenic
981297733 4:143151994-143152016 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
981444112 4:144815262-144815284 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
981446457 4:144844754-144844776 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
981907453 4:149938264-149938286 TTAATTTTTCTTTGAATGTTTGG - Intergenic
981951086 4:150408452-150408474 TTATTTCTTCTTTAAATGTTTGG - Intronic
982106943 4:152019570-152019592 TTATTTCTTTTTTTACAGTTTGG + Intergenic
982290443 4:153776368-153776390 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
982340195 4:154289500-154289522 TTAGTTCTTCTGTAAATGTTTGG - Intronic
982501141 4:156156832-156156854 TTATTTCTTCTTTGATTCATTGG - Intergenic
982531795 4:156554472-156554494 TTAGTTCTTCTTTGAATGTTTGG + Intergenic
982532252 4:156559441-156559463 TTAATTCTTCTTTAAATGTTTGG + Intergenic
982839408 4:160163925-160163947 TAAATTCTTCTTTGAATGTTTGG + Intergenic
983421533 4:167524719-167524741 TTAATTCTTCTTTAGTGGTTTGG + Intergenic
983552468 4:169031777-169031799 TTAGTTCTCCCTTGATTTTTTGG + Intergenic
983579936 4:169298912-169298934 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
983594392 4:169449589-169449611 TTAGTTTTCCTTTAATAGTCAGG - Intronic
983599826 4:169514451-169514473 TTAATTCTTCTTTGAATGTTTGG + Intronic
983669645 4:170221368-170221390 TTTGTTCTTCTTTAAGTGTTTGG - Intergenic
983676365 4:170298724-170298746 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
983767452 4:171502803-171502825 TTAGTTCTTTTTTTAAAATTTGG - Intergenic
983849724 4:172565682-172565704 TTAATTCTTCTTTTAATGTTTGG + Intronic
983860776 4:172703771-172703793 TTAGTTCTTCTTTAACAGTGTGG + Intronic
983876770 4:172886121-172886143 TTAGTTCTTCCTTAAAAGTTTGG + Intronic
983983902 4:174034770-174034792 TTAATTCTACTTTGGTACTTTGG + Intergenic
984079528 4:175228774-175228796 GTTGTTCTTCTTTGATATATGGG - Intergenic
984425300 4:179576946-179576968 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
984519201 4:180780780-180780802 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
984564255 4:181308803-181308825 TTGGTTCTTATTTGATTTTTTGG + Intergenic
984627856 4:182028047-182028069 TTACTTCTTCTTTAAATGTTTGG + Intergenic
984692605 4:182745153-182745175 TTGGTTTTTGTTTGCTAGTTTGG - Intronic
985433912 4:189909414-189909436 TTAGTTCTTCTTTGACTGTTTGG + Intergenic
985919057 5:2953511-2953533 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
986544282 5:8878843-8878865 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
986629793 5:9760259-9760281 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
986660490 5:10055649-10055671 TTATTTCTTCTTTGAAATGTGGG + Intergenic
986698605 5:10381443-10381465 TTATTACATCTTTTATAGTTTGG + Intronic
986904233 5:12473957-12473979 TTAATTCTTCTTTAAATGTTTGG - Intergenic
987189284 5:15457570-15457592 TTAGTTCTTCTTAAAATGTTTGG + Intergenic
987439311 5:17936303-17936325 TTAGTTCTTCTTCGTAATTTTGG - Intergenic
987459296 5:18188485-18188507 TTAGTACTTCTTTAAATGTTTGG + Intergenic
987496294 5:18649127-18649149 TTAGTTCTTCTTTAAGGATTTGG + Intergenic
987613297 5:20237359-20237381 TTATTTCTTCTTTTCTAATTTGG - Intronic
987615185 5:20264798-20264820 TTAGTGCTTCTTTGACAGACTGG + Intronic
987824761 5:23016064-23016086 TTTGTTTTTCTTTGATTTTTTGG - Intergenic
988236608 5:28553605-28553627 TTAGTTCTTCTTTATATGTTTGG + Intergenic
988607980 5:32697568-32697590 TTAGTTCTTCTTTAAATGTTTGG + Intronic
988820881 5:34883819-34883841 TTAATTCTTCTTTAAATGTTTGG - Intronic
988862153 5:35293560-35293582 TTATTTCTTCTTTTAGTGTTTGG + Intergenic
989081456 5:37626695-37626717 TTAATTCTTCTTTAAAGGTTTGG + Intronic
989139231 5:38186426-38186448 TTAATTCTTCTTTGAATGTTTGG - Intergenic
989148804 5:38276976-38276998 TTAGTTCTTCTTTAAATGTATGG - Intronic
989297127 5:39842038-39842060 GTGGCTCTTCTTTGATTGTTGGG - Intergenic
989338839 5:40351348-40351370 TTAGTTCTTCTTTGTACATTTGG - Intergenic
989354149 5:40522593-40522615 TTAGTTCTTCTTTAAATATTTGG - Intergenic
989428145 5:41320173-41320195 TTAGTTTTTCTTTAAATGTTTGG - Intronic
989436802 5:41423226-41423248 TTATATGTTCTTTGATGGTTTGG + Intronic
989440692 5:41469439-41469461 TTAGTTCTTCTTTAAATGTTTGG + Intronic
989672948 5:43940508-43940530 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
989970384 5:50517310-50517332 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
990014705 5:51045607-51045629 AGTGTTCTTCTTTGAAAGTTGGG - Intergenic
990433217 5:55758469-55758491 TTATTTGTCCTTTGAGAGTTTGG + Intronic
990577978 5:57141923-57141945 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
990846936 5:60152330-60152352 TTAATTCTTCTTTAAATGTTTGG + Intronic
990921070 5:60967919-60967941 TTAGGTCTTCTTTAAATGTTTGG + Intronic
990928994 5:61065265-61065287 TTAATTCTTCTTTGACTGTGTGG - Intronic
991106417 5:62848239-62848261 TTAGTTCTTCTTTGTACATTTGG + Intergenic
991107156 5:62857210-62857232 TTAGTTATTCTTTAAATGTTTGG + Intergenic
991238649 5:64429943-64429965 TTAGTTCTTCTTTAAATATTTGG - Intergenic
991277477 5:64866642-64866664 TGAGTTCTTCTTTGATCCATTGG + Intronic
991310299 5:65232761-65232783 TTAATTCTTCTTTAAATGTTTGG - Intronic
991574958 5:68093069-68093091 TTAGTTCTGAGTTGAGAGTTTGG - Intergenic
991672233 5:69059825-69059847 TTAGTCCTTCTTTAAATGTTTGG + Intergenic
991681416 5:69143578-69143600 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
992026891 5:72679202-72679224 TTATTTCTTCTTTGTGTGTTTGG + Intergenic
992344099 5:75858679-75858701 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
992437081 5:76764999-76765021 TTAGTTATTCTTTAAATGTTTGG + Intergenic
992516232 5:77495681-77495703 TTAATTCTTCTTTAAATGTTTGG - Intronic
992518973 5:77528445-77528467 TTATTTCTTCCTTGACTGTTTGG - Intronic
992579121 5:78152256-78152278 TTAGTTCTTCTTTAAATGTTTGG + Intronic
992587545 5:78256583-78256605 TTAATTCTTCTTTAAATGTTTGG - Intronic
992714098 5:79492482-79492504 TTTTTCCTTCTTTCATAGTTAGG - Intronic
992824418 5:80534171-80534193 TTAGTTCTTCTTTAAATGTTTGG - Intronic
992945612 5:81806531-81806553 TTAATTCTTCTTTAAAGGTTTGG - Intergenic
992984028 5:82209079-82209101 TTATTTCTTCTTTAAATGTTTGG + Intronic
993056089 5:82981145-82981167 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
993113851 5:83694829-83694851 TTATTTCTTCTTTAAATGTTTGG - Intronic
993138614 5:84001820-84001842 TTAGCTCTTCTTTAAATGTTTGG - Intronic
993170942 5:84418249-84418271 TTAATTCTTCTTTAAATGTTTGG + Intergenic
993268882 5:85767343-85767365 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
993433061 5:87856010-87856032 TTATTTTTTCTTTGAATGTTTGG - Intergenic
993474111 5:88343730-88343752 TTAATTCTTCTTTAAATGTTTGG + Intergenic
993644504 5:90445752-90445774 TTAATTCTTCTTTAAATGTTTGG - Intergenic
993683267 5:90906306-90906328 TTAGTTCTTCTTTAAATGGTTGG + Intronic
993801258 5:92341189-92341211 TTAGTTATTCTTTAAATGTTTGG + Intergenic
993846417 5:92949776-92949798 TTAGTTCTACTTTGAATGTTTGG + Intergenic
993869207 5:93231506-93231528 TTAATTCTTCTTTAGAAGTTTGG - Intergenic
993895442 5:93527982-93528004 TTAGATCCTGTTTGTTAGTTTGG - Intergenic
993954144 5:94212115-94212137 TTAGTACTTATTAGATAGTAAGG + Intronic
994138097 5:96310506-96310528 TTAGTTATTCTTTAAACGTTTGG + Intergenic
994217544 5:97155340-97155362 TTAGTACTTCTTTAAATGTTTGG + Intronic
994428387 5:99624080-99624102 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
994503385 5:100608573-100608595 CTATTTTTTCTTTGATAGTTTGG + Intergenic
994654327 5:102571174-102571196 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
994660297 5:102645656-102645678 TTAGTTCTTCTTTAAGTTTTTGG - Intergenic
994792731 5:104251371-104251393 TTAGTTCTACTTTAAATGTTTGG + Intergenic
994893272 5:105667175-105667197 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
995258863 5:110077923-110077945 TTAATTCTTCTTTAAATGTTTGG + Intergenic
995268808 5:110196871-110196893 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
995278266 5:110303402-110303424 TTAATTCTTCTTTAAATGTTTGG + Intronic
995450850 5:112298725-112298747 TTAATTCTTCTTTGAATGTCTGG + Intronic
995826995 5:116311660-116311682 TTGGTTCTTCTTTAAATGTTTGG + Intronic
996043328 5:118842292-118842314 TTACATCTTCTTGGATAGATTGG - Intronic
996116105 5:119620832-119620854 TTAGTTTTTCTTTAAATGTTTGG + Intronic
996143657 5:119946721-119946743 TTAGTTCTTCTTTACAAGTTTGG - Intergenic
996145436 5:119969208-119969230 TTAATTCTTCTGTGAATGTTTGG - Intergenic
996150256 5:120025976-120025998 TTAATTCCTCTTTGAATGTTTGG + Intergenic
996259647 5:121450320-121450342 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
996279768 5:121715037-121715059 TGAGTTCTTATTTGATATTCAGG - Intergenic
996392402 5:122975372-122975394 TTTTTTGTTCTTTGATAGCTTGG + Intronic
996451870 5:123634869-123634891 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
996453381 5:123653272-123653294 TAAGTTCATCTTTGAAATTTTGG + Intergenic
996462513 5:123762501-123762523 CTAGTTCTTCTTTAAATGTTTGG + Intergenic
996597128 5:125217961-125217983 TTACTTCTTCTTTTCTAGTTTGG - Intergenic
996659558 5:125985048-125985070 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
996780371 5:127179906-127179928 TTAGTAAATTTTTGATAGTTGGG + Intergenic
996828773 5:127716465-127716487 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
996890850 5:128417904-128417926 TTAGTTCTTCTTTATAATTTTGG + Intronic
997002408 5:129777384-129777406 TTAGTTCTTTTTTGAATGTTTGG - Intergenic
997060300 5:130493012-130493034 TTAGTTCTTCTTGAAATGTTTGG - Intergenic
997155965 5:131558067-131558089 TTATTTCTTCTTTAAATGTTTGG + Intronic
997180250 5:131820600-131820622 TTAGTTCTTCTTCAAATGTTTGG + Intronic
997477233 5:134150793-134150815 TGAGCTCTTCTCTAATAGTTTGG + Exonic
997664390 5:135617035-135617057 TTATTTCTTCTTTGAAAATTTGG + Intergenic
997664851 5:135622037-135622059 TCCGTTCTTCTTTTATGGTTTGG - Intergenic
998281477 5:140812089-140812111 TTGATTCTTCTTTAAAAGTTTGG + Intronic
998290881 5:140913163-140913185 TTAGTTCTTCTTTAAATGTTTGG + Intronic
998752952 5:145344070-145344092 TTAGTTCTTCTTTGTATGTTTGG - Intergenic
998913531 5:146989165-146989187 TTTGTTCTTCTTTAAATGTTTGG - Intronic
998926564 5:147132715-147132737 TTGGTTCATCTTTGTCAGTTTGG + Intergenic
999025275 5:148222656-148222678 TTAATTCTTCTTTAAATGTTTGG + Intergenic
999106995 5:149081832-149081854 TTAATTCTTCTCTGACTGTTTGG - Intergenic
999109150 5:149102238-149102260 TGAGTTCTCCTTTGAAAGTTTGG - Intergenic
999186229 5:149711779-149711801 TTAGCAATTCTTTGATAGGTAGG - Intergenic
999235422 5:150088346-150088368 TTAATTCTTCTTTAAATGTTTGG - Intronic
999235506 5:150089251-150089273 TTACTTCTTCTTTTTTAATTTGG - Intronic
999485211 5:151988561-151988583 TTAGTTCTTAATTAAAAGTTTGG + Intergenic
999650252 5:153759616-153759638 TTAGTTCTTCTTTAACTATTTGG - Intronic
999660171 5:153853213-153853235 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1000032301 5:157413799-157413821 TTAAATCTTCTTTGTAAGTTTGG - Intronic
1000392323 5:160736825-160736847 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1000400372 5:160820454-160820476 CTAGTTCTTCTTTAAATGTTTGG - Intronic
1000417803 5:161001917-161001939 TCAGTTCTTCTTTAAAAGTTTGG + Intergenic
1000583914 5:163071145-163071167 ATAGTTCTTCTTTAAATGTTTGG + Intergenic
1000805882 5:165791386-165791408 TTAGTTCTTCTTCAAATGTTTGG + Intergenic
1000860125 5:166447407-166447429 TTTTTTCTTCTTTGTTAGTCTGG + Intergenic
1001177936 5:169489973-169489995 ATAGTTCTTCTTTAAATGTTTGG - Intergenic
1001371401 5:171207339-171207361 ATAGTTCTTCTTTGACACTGAGG - Intronic
1001790250 5:174450115-174450137 TTAGTTCTTTTTTAAAGGTTTGG - Intergenic
1001918321 5:175580523-175580545 TTACATCATTTTTGATAGTTTGG - Intergenic
1002551533 5:179996891-179996913 TTAGCTCTTCTTTAAATGTTTGG + Intronic
1002673278 5:180887583-180887605 ATAATTCTTCTTTGAATGTTTGG + Intergenic
1002680460 5:180959100-180959122 TTAATTCTTCTTTTAAAGTTTGG + Intergenic
1002681962 5:180972284-180972306 TTATTTCTTCTTTGAATGTTTGG - Intergenic
1003371791 6:5535464-5535486 TTACTTCTTCTTTTTCAGTTGGG + Intronic
1004204435 6:13578652-13578674 TTAGTTCTGCTTTAAATGTTTGG + Intronic
1004305071 6:14493206-14493228 TTAGTTCTTTTATTATAATTTGG + Intergenic
1004764222 6:18706999-18707021 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1004843984 6:19618501-19618523 TTAGTTCTTCTTTGCATGATTGG - Intergenic
1005036991 6:21565034-21565056 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1005558855 6:27016926-27016948 TTACTTCTTCTTTTACAATTTGG - Intergenic
1005907960 6:30281753-30281775 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1005925050 6:30437130-30437152 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1006242216 6:32693108-32693130 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1006553718 6:34847383-34847405 TTAGTTCTTCTTTAAATGTTCGG + Intronic
1007001186 6:38314537-38314559 TTAGTTCTTCTTTAAGTATTTGG + Intronic
1007233590 6:40371724-40371746 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1007921189 6:45611223-45611245 TTAATTCTTCTGTGATTCTTTGG - Intronic
1008249344 6:49219579-49219601 TTAGTTTTTCTTTAAATGTTTGG - Intergenic
1008302688 6:49861155-49861177 TTAGTTCATCTTTGAAGATTCGG - Intronic
1008445999 6:51591623-51591645 TTACTTATTCTTTGAATGTTTGG + Intergenic
1008702383 6:54116656-54116678 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1008733837 6:54517717-54517739 TTTTTTCTTCTTTTTTAGTTAGG - Intergenic
1008882156 6:56391922-56391944 TTAGTTCTTCTTTAAGTGTCTGG - Intronic
1009245756 6:61235522-61235544 ATAGTTGTTCTTTGAATGTTTGG - Intergenic
1009282154 6:61766055-61766077 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1009284089 6:61792485-61792507 TTAGTTTTTCTTTACTAATTTGG + Intronic
1009306454 6:62096302-62096324 CCAGTTCTTCTTTAAAAGTTTGG + Intronic
1009329381 6:62397429-62397451 TTAGTTCTTCTTTATATGTTTGG + Intergenic
1009542763 6:64984314-64984336 TTAGTTTTCAGTTGATAGTTTGG - Intronic
1009783805 6:68304542-68304564 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1009903440 6:69838339-69838361 TTCTTTCTTCTTGGATAATTTGG - Intergenic
1009969312 6:70609746-70609768 TTAATTCTTCTTTGAATGTCTGG - Intergenic
1009979667 6:70712515-70712537 TTAATTCTTCTTTGAGTGTTTGG + Intronic
1010061831 6:71631796-71631818 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1010110942 6:72230729-72230751 TTATTTCTGCACTGATAGTTGGG + Intronic
1010182281 6:73101050-73101072 TTAGTTCTTCTTTCATTGTTTGG - Intronic
1010342653 6:74773783-74773805 ATAATTCTTCTTTGAATGTTTGG + Intergenic
1010455965 6:76055308-76055330 TTATTTCTTCTTTGACATATGGG - Intronic
1010481946 6:76366024-76366046 TTAGTTCTTCTTTAAATGGTTGG + Intergenic
1010556576 6:77287730-77287752 TTAATTCTTCTTTGAATATTTGG - Intergenic
1010645037 6:78376859-78376881 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
1010692667 6:78929089-78929111 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1010888243 6:81270667-81270689 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1010901192 6:81430070-81430092 TTAGTTATTCTTTGAAAATTTGG + Intergenic
1010932999 6:81825511-81825533 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1010957724 6:82109387-82109409 TTAGTTCTCCTTTATAAGTTTGG - Intergenic
1011033523 6:82948427-82948449 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1011152986 6:84295843-84295865 TTAGTTCTTATTTAAATGTTGGG + Intergenic
1011327438 6:86165000-86165022 TTAATTCTTCTTTGAATGTCTGG - Intergenic
1011328793 6:86180746-86180768 TTAATTCTTCTTTGAATGTCTGG + Intergenic
1011332986 6:86230788-86230810 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1011404515 6:87004171-87004193 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1011586982 6:88936832-88936854 TTAGTTCTTCCTTAAAAGTTTGG + Intronic
1011682463 6:89796515-89796537 TTAATTCTTCTTTTAATGTTTGG - Intronic
1011901709 6:92306531-92306553 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1011908718 6:92408117-92408139 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1011958516 6:93055609-93055631 TTAGTTCTTCTTTGTATGTTTGG + Intergenic
1012025787 6:93989177-93989199 TTAGTTATTTTTTAAAAGTTTGG - Intergenic
1012055712 6:94407108-94407130 TTACTTATTTTTTGATAGTGTGG + Intergenic
1012197660 6:96364104-96364126 TTAGTTATTCTTTAAAAGTTTGG - Intergenic
1012303132 6:97614809-97614831 TTAGTTCTTTTTTTAATGTTTGG + Intergenic
1012485545 6:99717942-99717964 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1012512463 6:100019260-100019282 TTAGTTCTTCTTTAAATGTTGGG - Intergenic
1012717498 6:102695098-102695120 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1012845984 6:104389324-104389346 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1012892608 6:104913710-104913732 TTCGTTCTTCTTTAAATGTTTGG - Intergenic
1013672441 6:112420034-112420056 TTACTTCTTCTTTAAGTGTTTGG + Intergenic
1013702607 6:112791542-112791564 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1013939102 6:115639194-115639216 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1014047432 6:116907436-116907458 TTAGTTCCTCTTTAAATGTTTGG + Intronic
1014118079 6:117688794-117688816 TTTGTTCATCATGGATAGTTTGG + Intronic
1014118762 6:117698584-117698606 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014186285 6:118437896-118437918 TTAGTTCTTCTTTAACTATTTGG + Intergenic
1014353213 6:120370130-120370152 TTAATTCTTCTTTAAAACTTTGG - Intergenic
1014542047 6:122688530-122688552 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1014643929 6:123950376-123950398 CTAGTTCTTCTTTGAAAGTTTGG + Intronic
1014692802 6:124582523-124582545 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014928795 6:127308056-127308078 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014932729 6:127353169-127353191 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1014950693 6:127551478-127551500 TTTGTTCTTCTTTAAAAGTTTGG - Intronic
1015052544 6:128859621-128859643 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
1015171157 6:130254834-130254856 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1015578339 6:134697019-134697041 TTAGTTCTTCTGTAAATGTTTGG + Intergenic
1015765104 6:136707872-136707894 TTGGTTCTTCATTGTTTGTTTGG - Intronic
1015808492 6:137137298-137137320 TTCATTCTTCTTTGAGAGTTTGG - Intergenic
1015825813 6:137310362-137310384 ATAGCTCTACTTTGCTAGTTTGG + Intergenic
1015959782 6:138635586-138635608 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1016127580 6:140424492-140424514 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1016247338 6:141998625-141998647 TGTGTTCTTCTTTGAAAGCTTGG - Intergenic
1016251844 6:142052539-142052561 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1016257736 6:142128932-142128954 TTCATTCTTCTTTGAATGTTTGG + Intergenic
1016351187 6:143170165-143170187 TTAGTTCTTCTTTGTAAGTTTGG + Intronic
1016423142 6:143906109-143906131 TTAGTTTTTCTTTAAATGTTTGG + Intronic
1016660542 6:146573790-146573812 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1017242956 6:152191359-152191381 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1017332803 6:153219158-153219180 TTACCTATTCTTTGAAAGTTTGG - Intergenic
1017356537 6:153516299-153516321 TTAGTTGTTCTTTAAATGTTTGG + Intergenic
1017387776 6:153906255-153906277 TTAGTTCTTCTTTAAATGTATGG - Intergenic
1017397858 6:154024118-154024140 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1017730317 6:157310246-157310268 CTTTTTCTTCTTTGATAGTTAGG + Intronic
1017998089 6:159551668-159551690 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1018235759 6:161722026-161722048 TTACTCCTTCTTTCATAGTCTGG + Intronic
1018316991 6:162566697-162566719 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1018526789 6:164720310-164720332 TTAGTTCTTCCTTAATCATTTGG + Intergenic
1019084407 6:169461511-169461533 TTATTTCTTCTTTGATCCCTTGG - Intronic
1019905732 7:4062520-4062542 TTAGTTCTTCCTTGAAAGTATGG - Intronic
1020574396 7:9907252-9907274 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1020574487 7:9908839-9908861 TTAGTTCTTATTTAATAGTTCGG + Intergenic
1020664206 7:11019312-11019334 TTAGTTCTTCTTTAAGTGTTTGG + Intronic
1020824148 7:13005968-13005990 TTAATTCTTCTTTAAGTGTTTGG + Intergenic
1020906639 7:14071532-14071554 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1021035253 7:15790175-15790197 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
1021230267 7:18078689-18078711 TTAGTTCTTATTTAAATGTTTGG + Intergenic
1021251261 7:18328884-18328906 TTAGGTCTTCTTTAAATGTTTGG + Intronic
1021309522 7:19076181-19076203 TTAGTTCTTCTTTATAAGTTTGG - Intronic
1021339664 7:19448872-19448894 TTAGTTCTTCTTTGTATATTTGG + Intergenic
1021529279 7:21625112-21625134 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1021557534 7:21936243-21936265 TTTGTTCTTCTTTAAATGTTTGG - Intronic
1022080631 7:27017264-27017286 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1022365797 7:29714845-29714867 TGAGCTCTTTTTTGATAGTGTGG + Intergenic
1022610809 7:31870666-31870688 TTAGTCCTTCTTTGAAAGTTTGG - Intronic
1022870062 7:34468290-34468312 TTATTTCTTCTTTATAAGTTTGG + Intergenic
1022883461 7:34616428-34616450 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1022898325 7:34775416-34775438 TTAGTTCTTCATTAAATGTTTGG + Intronic
1022899500 7:34789938-34789960 TTAGTTCTTCTCTAAGTGTTTGG - Intronic
1023208623 7:37778306-37778328 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1023716497 7:43049596-43049618 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
1023880390 7:44316592-44316614 TTAATTCTTCTTTAAATGTTTGG + Intronic
1023997388 7:45169348-45169370 TTAATTCTTCTTTCAGTGTTTGG + Intronic
1024032663 7:45477147-45477169 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1024110352 7:46139762-46139784 TTAATTCTTCTTTAAAACTTTGG + Intergenic
1024411127 7:49043102-49043124 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1024484156 7:49897235-49897257 TTAATTCTTCTTTCAATGTTTGG - Intronic
1024494290 7:50026226-50026248 TTATATCTTCTTTAATAGATTGG - Intronic
1024621861 7:51166517-51166539 TTAGTTCTTGTTTAAATGTTTGG - Intronic
1024660887 7:51493258-51493280 TTAGTTCTTGTTTAAATGTTTGG + Intergenic
1024679426 7:51669294-51669316 TTACTTCTCCTTTGAATGTTTGG - Intergenic
1024879081 7:54065175-54065197 TTATATCATCTTTGATAGTTGGG - Intergenic
1024892120 7:54215856-54215878 TTAGTTCTTCTTAAAATGTTTGG - Intergenic
1025063679 7:55834105-55834127 TTAAATTTTCTTTGAAAGTTTGG - Intronic
1025274968 7:57573113-57573135 TTAATTCAACTTTGAAAGTTTGG - Intergenic
1025969105 7:66305540-66305562 TTGGTTCTTCCTTGATAATCGGG + Intronic
1026039790 7:66858500-66858522 TAAGTTTTTCTTTTATAGTATGG + Intergenic
1026049872 7:66936632-66936654 TTAGTTCTTCTTTTAGTGTTTGG + Intronic
1026860265 7:73782177-73782199 TTAATTCTTCTTTAAACGTTTGG + Intergenic
1026887304 7:73959387-73959409 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1027511281 7:79083745-79083767 TTAATTCTTCTTTAAAAGCTTGG + Intronic
1027628451 7:80573131-80573153 TTAGTTCTTCTTTACAAGTTTGG + Intronic
1027866382 7:83652760-83652782 TTATTGCTATTTTGATAGTTTGG - Intergenic
1028119253 7:87039322-87039344 TTAGTTCTTCTTGAAATGTTTGG - Intronic
1028140776 7:87272879-87272901 TTAGGTCTTCTTTGTAAGTTTGG + Intergenic
1028186573 7:87793260-87793282 TTACTTCTTCTTTAAATGTTTGG - Intronic
1028383039 7:90220211-90220233 TTAGGTCTGTTTTGAAAGTTTGG + Intronic
1028519289 7:91711905-91711927 TTAGTTCTTCTTTGCACATTTGG - Intronic
1028522822 7:91751156-91751178 TTTGTTATTCTTTAAAAGTTTGG - Intronic
1028612495 7:92727357-92727379 TTGGTTCTTCCTTTAGAGTTCGG + Intronic
1028626589 7:92884412-92884434 TTAGTTCTTCTTTGAAAGTTTGG - Intergenic
1028816598 7:95153716-95153738 TTAGTTCTTGCTTGAAAGTTTGG + Intronic
1028964831 7:96790515-96790537 TGTGTTCTTCTTTGATGGTTAGG - Intergenic
1029009575 7:97244638-97244660 TTAGATCTTCTTTAAATGTTTGG - Intergenic
1029053939 7:97720340-97720362 TTAGTTCTTCTTTAAATGTGTGG - Intergenic
1029796789 7:102904072-102904094 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1029869894 7:103679691-103679713 TTAGTTCTTTTTTTTTTGTTTGG + Intronic
1030407945 7:109138556-109138578 TCAGTTCTTCTTTAAGTGTTTGG + Intergenic
1030431129 7:109450627-109450649 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1030604797 7:111628778-111628800 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1030661307 7:112222263-112222285 TTAGTTCATCTTTAAATGTTTGG + Intronic
1030748259 7:113195789-113195811 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1030752840 7:113252086-113252108 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1030990667 7:116295838-116295860 TTATTTCTTCTTTAAATGTTTGG - Intronic
1031098815 7:117452870-117452892 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1031204284 7:118735121-118735143 TTAGTTCTTCTTTTAAATATTGG - Intergenic
1031215619 7:118886853-118886875 TTAGTTCTTCTTCGAATGTTTGG - Intergenic
1031270170 7:119638988-119639010 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1031489918 7:122373812-122373834 TTAATTCTTCTTTAAATGTTTGG - Intronic
1031568890 7:123333533-123333555 TTATTTCTTCTTGGAAAATTTGG - Intergenic
1031683663 7:124706143-124706165 TTAGTTCTTTTTTGTATGTTTGG + Intergenic
1031746271 7:125502401-125502423 TTAGTTCTTCTTTAAATGTCTGG + Intergenic
1031782927 7:125992568-125992590 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1031906059 7:127460739-127460761 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1032138334 7:129302930-129302952 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1032773629 7:135086925-135086947 TTTGTTCTTCTTTAAATGTTTGG + Intronic
1032779643 7:135153916-135153938 TTAGTTTTTCTTTGTATGTTTGG + Intronic
1032939514 7:136772510-136772532 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1032972091 7:137176114-137176136 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1033081216 7:138299687-138299709 TTAATTTTTCTTTCAAAGTTTGG + Intergenic
1033180254 7:139170274-139170296 TTAGTTTTTCTTTAAATGTTTGG - Intronic
1033183720 7:139205753-139205775 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1033237183 7:139647477-139647499 TTAGTTCTTCTCTGATAATAAGG + Intronic
1033488824 7:141820502-141820524 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1033819700 7:145119799-145119821 TTAGTTCTTCTGTAAATGTTAGG + Intergenic
1033930362 7:146511854-146511876 TTGGTTCTTCTTTAAAAATTTGG + Intronic
1033946071 7:146719275-146719297 TTAGTTATTCTCTCATATTTTGG - Intronic
1034033471 7:147794110-147794132 TTAATTCTTCTTTTATAATCTGG + Intronic
1034246951 7:149652292-149652314 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1034602093 7:152268597-152268619 TTAGTTCATTTTTGATAGAAAGG + Intronic
1035136334 7:156707299-156707321 TTAGTTCTTCTTTGTACATTTGG - Intronic
1035139399 7:156742675-156742697 TTAGTTCTTTTTTAAATGTTTGG - Intronic
1035195288 7:157214178-157214200 TTACTTCTTTTTTCATATTTAGG + Intronic
1035357681 7:158286927-158286949 TTAGTCCTTCTTTAAATGTTAGG + Intronic
1035485715 7:159224075-159224097 TTAATTCCTCTTTGAATGTTTGG - Intergenic
1036926111 8:12907699-12907721 TTAATTCTTCTTTTAGAGATGGG - Intergenic
1037000418 8:13710767-13710789 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
1037011045 8:13842913-13842935 TTTGTTCTTCTTTCCTACTTGGG - Intergenic
1037255793 8:16951646-16951668 TTACTTCTTCTTTAAATGTTTGG - Intergenic
1037364781 8:18109797-18109819 TTAGTTATTCTTTAACTGTTTGG + Intergenic
1037375935 8:18228194-18228216 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1037973006 8:23187942-23187964 TTTGTTCTTCTGTAATAGGTAGG + Intergenic
1038074810 8:24059937-24059959 TTAGTTCTTCTTTAAATGGTTGG - Intergenic
1038100381 8:24367090-24367112 TTTTTTATTCTTAGATAGTTTGG - Intergenic
1038353242 8:26800670-26800692 TTAGTTCTTCTTTGAATATTTGG - Intronic
1039155419 8:34550913-34550935 TGATTTCTTCTTTGAAAGATTGG + Intergenic
1039629547 8:39094500-39094522 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1039667361 8:39548387-39548409 TTAATTCTTCTTTGAATGGTTGG + Intergenic
1039934303 8:42027362-42027384 TTAGTTCTTCTTCTTAAGTTTGG + Intronic
1040442908 8:47463437-47463459 TTAATTCTTCTTTAAATGTTTGG - Intronic
1040536000 8:48310532-48310554 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1040895092 8:52358775-52358797 TTAATTCTTCTTTAAATGTTTGG - Intronic
1041027447 8:53701551-53701573 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1041294690 8:56343116-56343138 TTAGTCCTTCTTTATAAGTTTGG - Intergenic
1041305896 8:56459520-56459542 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
1041365437 8:57098223-57098245 TTAACTCTTCTTTAATTGTTTGG + Intergenic
1041471572 8:58215552-58215574 TTAGTTCTTCTTTATTTGTTTGG - Intergenic
1041534551 8:58911554-58911576 GTAAGTCTTCATTGATAGTTAGG + Intronic
1041563813 8:59252013-59252035 TTAGGTCTTCTTTGCAAGTTTGG + Intergenic
1041616340 8:59911434-59911456 TTAGTTCTTCCTTAAATGTTTGG - Intergenic
1041827654 8:62114903-62114925 TTAGTTCTTCCTTAAGTGTTTGG + Intergenic
1042078418 8:65021792-65021814 TTACTTCTTCCTTTATAATTTGG + Intergenic
1042428631 8:68678135-68678157 TTAGTTCTTCTTCAAATGTTTGG - Intronic
1043102445 8:76062889-76062911 CTAATTATTCTTTGAAAGTTTGG - Intergenic
1043133751 8:76494607-76494629 TTAGTTCTTCTTTAAATGTCTGG + Intergenic
1043169190 8:76942977-76942999 TTAGTTTTTCTTTAAGTGTTTGG + Intergenic
1043258489 8:78166216-78166238 TTAGTTATTCTTTAAATGTTTGG - Intergenic
1043277923 8:78424005-78424027 TTAATTCTCCTTTAATTGTTTGG + Intergenic
1043567662 8:81566230-81566252 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1043569653 8:81588605-81588627 TGACTTTTTCTTTTATAGTTTGG + Intergenic
1043588031 8:81792736-81792758 TGACTTCTTCTTTTCTAGTTTGG + Intergenic
1043600567 8:81932406-81932428 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1043654669 8:82647563-82647585 TCAGTTCTTCTTTAAAAGTGTGG - Intergenic
1043728746 8:83648156-83648178 TCATTTTTTCTTTTATAGTTAGG + Intergenic
1043750117 8:83924329-83924351 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1043840895 8:85103120-85103142 TTGGTTCTTCTTTGAAAAATTGG + Intergenic
1043945599 8:86248353-86248375 TTAATTCTTCTTTAAATGTTTGG + Intronic
1043964072 8:86451939-86451961 TGAGTTCTTCTATTCTAGTTAGG + Intronic
1043998367 8:86847299-86847321 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1044072669 8:87781881-87781903 TTAGTTCTACATTGTAAGTTTGG - Intergenic
1044144489 8:88694446-88694468 TTAGGTCTTCTTTAAATGTTTGG + Intergenic
1044190883 8:89316036-89316058 TTAGTTATTCTTGGATACTTTGG - Intergenic
1044192697 8:89338163-89338185 TTAGTTATTCTTTAAATGTTGGG + Intergenic
1044218466 8:89641490-89641512 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1044241797 8:89897122-89897144 TTAGTTCTTCTCTAAATGTTTGG - Intergenic
1044393920 8:91686509-91686531 ATAATTTTTCTTTGATGGTTTGG - Intergenic
1044498052 8:92914654-92914676 TTAGCACTTCTCTGATAATTAGG - Intronic
1044765183 8:95564508-95564530 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1045239976 8:100391632-100391654 CTAGTTCTTGTTTGTTTGTTTGG + Intronic
1045321972 8:101088909-101088931 TTAGTCCTTCATTGATATTTAGG - Intergenic
1045812079 8:106233469-106233491 TTAGTGCTTCTTTAAATGTTTGG - Intergenic
1045887853 8:107121606-107121628 TTACATTTTCTCTGATAGTTTGG + Intergenic
1045938203 8:107707117-107707139 TTATTTATTCATTGAAAGTTAGG + Intergenic
1046113850 8:109761354-109761376 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1046116578 8:109791724-109791746 TTAGTACTTCTTTGCTCCTTGGG + Intergenic
1046119213 8:109824064-109824086 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1046356412 8:113091347-113091369 TTAGTTCTCCTTTAAATGTTTGG + Intronic
1046665167 8:116994110-116994132 TTATTTCTTCTTTAAAATTTTGG - Intronic
1046817673 8:118602643-118602665 TTAGTTCTTTTTTAATAGGCTGG - Intronic
1046884541 8:119350691-119350713 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1046886357 8:119371577-119371599 TTTGTTCTTCTTGGATATTTGGG - Intergenic
1047083288 8:121488610-121488632 TTAGTTCTTCTTTAAGCGTTTGG - Intergenic
1047089989 8:121563329-121563351 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1047187814 8:122650222-122650244 TTAGTTCTCCTTTAAATGTTCGG + Intergenic
1047352090 8:124084834-124084856 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1047388805 8:124433017-124433039 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1047460519 8:125059959-125059981 TTATTTCTACTTTGCTTGTTTGG - Intronic
1047599186 8:126409302-126409324 TTAGTACCTCTTGGATGGTTTGG - Intergenic
1047936260 8:129782772-129782794 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1048102771 8:131372592-131372614 TTAATTCTTCTTTCAATGTTTGG - Intergenic
1048714136 8:137248415-137248437 TTAGTTCTTTTTTGTATGTTTGG - Intergenic
1049490031 8:142892640-142892662 TTAGTTCTTCTTTAAATGCTTGG + Intronic
1050192478 9:3042631-3042653 TTAGTTCTTATATGATTTTTTGG - Intergenic
1050319967 9:4442029-4442051 TTAGTCCTTCTTTAAACGTTTGG + Intergenic
1050356435 9:4787835-4787857 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1050409112 9:5343132-5343154 TTAATTCTTCTTTGAAAGTTTGG - Intergenic
1050505470 9:6343932-6343954 TTAGTTCTTCGTTAAATGTTTGG - Intergenic
1050956165 9:11663449-11663471 ATAATTCTTCTTTGAATGTTTGG + Intergenic
1051047550 9:12893108-12893130 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1051111333 9:13640621-13640643 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1051131869 9:13871153-13871175 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1051324791 9:15953752-15953774 TTAATTCTTCTTTAAATGTTTGG + Intronic
1051362978 9:16298013-16298035 CCAATTCTTCTTTGAAAGTTTGG - Intergenic
1051454803 9:17242922-17242944 TTAGCTCTTATTTAAAAGTTTGG + Intronic
1051465497 9:17372539-17372561 TTAGTTCTTCTTTAAATGTCTGG - Intronic
1051558898 9:18417787-18417809 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1051713102 9:19952822-19952844 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1051795043 9:20858169-20858191 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1051920920 9:22263011-22263033 TTAGATCTTCTTTAAACGTTTGG + Intergenic
1052063652 9:23990939-23990961 GTAGTTCTTCTTTAAATGTTTGG - Intergenic
1052199481 9:25761047-25761069 TTAATTTTTCTTTGATAGCTTGG - Intergenic
1052302402 9:26968170-26968192 TTAGTTCTTTTTTAAATGTTTGG + Intronic
1052683879 9:31730010-31730032 TTAGTTCTTCTTAAAATGTTTGG + Intergenic
1052903127 9:33812023-33812045 TTAGTTTGTCTTTGTTAGTTTGG - Intergenic
1053028471 9:34752599-34752621 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1053046456 9:34923404-34923426 TTAGTCCTTCTTTAAATGTTTGG + Intergenic
1053454451 9:38222012-38222034 TTAGTTCTTCTTTGAATGTTTGG + Intergenic
1053520616 9:38774169-38774191 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
1053723000 9:40967586-40967608 TTAGTTCTTCTTTGAATGTTTGG + Intergenic
1053752525 9:41270998-41271020 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1054192863 9:61999643-61999665 TTAGTTCTTCTTTAAATGTCTGG + Intergenic
1054258052 9:62835330-62835352 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1054342967 9:63884410-63884432 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1054351759 9:64023459-64023481 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1054645544 9:67589048-67589070 TTAGTTCTTCTTTAAATGTCTGG - Intergenic
1054802831 9:69368724-69368746 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1054964584 9:71008327-71008349 ATAGTTCTTCTTTAAATGTTTGG - Intronic
1055232406 9:74081636-74081658 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1055329243 9:75165071-75165093 TGATTTCTTCTTTGATCTTTTGG + Intergenic
1055682251 9:78728040-78728062 TTAGTTCTCCTTTAAAAGTTTGG - Intergenic
1055779190 9:79800867-79800889 TTAGTTCATCTTTAAAGGTTTGG - Intergenic
1055820844 9:80261396-80261418 TTAATTCTTCTTTTAATGTTTGG - Intergenic
1055857742 9:80711110-80711132 TTTGTTACTCTTAGATAGTTTGG + Intergenic
1056059289 9:82866971-82866993 TTATTTCTTCTTTAAAGGTTTGG - Intergenic
1056130251 9:83578242-83578264 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1056325148 9:85471675-85471697 ATATATCTTCTTTGTTAGTTTGG + Intergenic
1056421334 9:86430067-86430089 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1056614872 9:88155818-88155840 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1056994152 9:91440092-91440114 TTAGTTCCTCTTTGAATGTTTGG + Intergenic
1057193873 9:93104494-93104516 TTAGTTCTTCTTTAAATGTATGG + Intronic
1057296086 9:93842225-93842247 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1057636017 9:96767794-96767816 TTAGTTTTTCTTTAAATGTTTGG - Intronic
1057639619 9:96805376-96805398 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1057685007 9:97223959-97223981 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1057932543 9:99207583-99207605 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1057970235 9:99548655-99548677 TTAGTTCTTCTGTAAATGTTTGG + Intergenic
1058133506 9:101280351-101280373 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1058316707 9:103576950-103576972 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1058352689 9:104044686-104044708 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1058741893 9:107951966-107951988 TTACTTCTTCTTTTACACTTTGG - Intergenic
1059019693 9:110561954-110561976 TTAGTTCTTCTTTGACCCTCTGG - Intronic
1059082261 9:111262579-111262601 TTAGTTCTTATTTCAGAGTATGG + Intergenic
1059370592 9:113829450-113829472 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1059622114 9:116018082-116018104 TGAATTCTTCTTTGAATGTTTGG + Intergenic
1059743683 9:117179944-117179966 TTGGTTCTCATTTGATAGATGGG + Intronic
1059807902 9:117824280-117824302 TTTCTTATTCTTTGATATTTTGG - Intergenic
1059824577 9:118013911-118013933 TTAGTTGTTTTTTGAGTGTTTGG + Intergenic
1059888463 9:118773454-118773476 TTACTTCTTCCTTGATAATGAGG - Intergenic
1060081358 9:120649690-120649712 TTGGTCTTTTTTTGATAGTTTGG + Intronic
1060097434 9:120804514-120804536 TTAATTCTTCTTTAAGTGTTTGG + Intergenic
1060246846 9:121953678-121953700 TTGGTTCTTTCTTGGTAGTTGGG - Intronic
1060332864 9:122691189-122691211 TTAGTTCTTCTTTGTATGTTTGG - Intergenic
1060571856 9:124648630-124648652 TGACTTCTTCTTTTACAGTTTGG - Intronic
1061638613 9:131932680-131932702 TTAATTCTTCTTTAAATGTTTGG - Intronic
1062307353 9:135915853-135915875 TTAGTTCTTCTTTACACGTTTGG - Intergenic
1062728071 9:138089038-138089060 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1203696841 Un_GL000214v1:106580-106602 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1203452142 Un_GL000219v1:128394-128416 TTAGTTCTTCTTTGAATGTTTGG - Intergenic
1203552372 Un_KI270743v1:174449-174471 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1186691951 X:11986967-11986989 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1186911309 X:14170026-14170048 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1187182927 X:16959733-16959755 TTAACTCTTCTTTGAATGTTTGG - Intronic
1187579175 X:20590564-20590586 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1187660153 X:21536437-21536459 TAAGTTATTCTTTAAAAGTTTGG + Intronic
1187744753 X:22396747-22396769 TTAGATCTTCTTTGAAAGACAGG - Intergenic
1187787064 X:22903714-22903736 TTATTTCCTCTTTGACTGTTTGG + Intergenic
1188014589 X:25094348-25094370 TTAATTTTTCTTTGAATGTTTGG + Intergenic
1188158250 X:26768911-26768933 TTAGGCCTTCTTTGCAAGTTAGG - Intergenic
1188348756 X:29101415-29101437 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1188386028 X:29559403-29559425 TTAATTCTTCTTTAAAAGTTTGG + Intronic
1188726676 X:33592856-33592878 TTGGTTTTTTTTTTATAGTTAGG - Intergenic
1188767141 X:34107894-34107916 ATAGTTCTTCTTTAAATGTTTGG + Intergenic
1188832102 X:34911600-34911622 TTAATTCTGCTTTAAAAGTTTGG + Intergenic
1188853901 X:35168130-35168152 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1188866728 X:35322177-35322199 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1189199435 X:39179667-39179689 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1189450554 X:41124992-41125014 TTATTTCTTCATTAATTGTTTGG + Intronic
1189541404 X:41994529-41994551 TTATTTCTTCTTTGATCTATTGG - Intergenic
1189564313 X:42224717-42224739 TTAGTTCTTCTTTGTATGTTTGG + Intergenic
1189628508 X:42925435-42925457 TTAGTTCCTCTTTAAATGTTTGG - Intergenic
1189690153 X:43608652-43608674 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1190079393 X:47343905-47343927 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1190151207 X:47950836-47950858 TTAATTCTTCTTTGAATGTTTGG - Intronic
1190158327 X:48011545-48011567 TTAATTTTTCTATGAGAGTTTGG + Intronic
1190174098 X:48134427-48134449 TTAATTTTTCTATGAGAGTTTGG + Intergenic
1190371324 X:49744393-49744415 TTAATTCTTCTTTGAAAGTTTGG - Intergenic
1190535757 X:51425780-51425802 TTAGTTCTTCTTTAAATGTCTGG + Intergenic
1190585557 X:51936691-51936713 TTAGTTTTTCTTTTAAAGTTTGG - Intergenic
1190811242 X:53886131-53886153 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1190840670 X:54141084-54141106 TTATTTCTTCTTTAATTGTTTGG - Intronic
1190899418 X:54655227-54655249 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1190912156 X:54782755-54782777 TTAGTTATTCTTTAACTGTTTGG - Intronic
1190943180 X:55064135-55064157 TTAGTTCTTCTTTAACAGCTTGG + Intergenic
1190944674 X:55079989-55080011 TTAGTCCTTCTTTAAATGTTGGG + Intergenic
1190945915 X:55093922-55093944 TTAGTCCTTCTTTAAATGTTGGG + Intronic
1190964459 X:55285301-55285323 TTAGTCCTTCTTTAAATGTTGGG + Intronic
1190978938 X:55437721-55437743 TTAGTTCTTATTTAAATGTTTGG - Intergenic
1191002596 X:55676885-55676907 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
1191052127 X:56205733-56205755 TTAGATCTTCTTTAAATGTTTGG + Intergenic
1191069520 X:56384947-56384969 TTAGTTCTTATTTAAATGTTTGG + Intergenic
1191102235 X:56743370-56743392 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1191118770 X:56880491-56880513 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1191198895 X:57756437-57756459 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1191634917 X:63365140-63365162 GTAGTTCTTCTTTAAATGTTTGG - Intergenic
1191642321 X:63440227-63440249 TTAATTCTTCTTTGTAGGTTTGG - Intergenic
1191767677 X:64716748-64716770 TTAGCTCTTCTTTAAATGTTTGG - Intergenic
1191799400 X:65060842-65060864 TTTGTTCTTCTTTCAATGTTTGG + Intergenic
1191909742 X:66136383-66136405 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1191911332 X:66153531-66153553 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1191915402 X:66195919-66195941 TCAGTTTTTCTTTTATAGTTTGG - Intronic
1191964147 X:66738437-66738459 TTCATTCTTCTTTAAAAGTTTGG + Intergenic
1191983850 X:66957257-66957279 TTACTTCTTCTTTGAAAATTTGG + Intergenic
1191993645 X:67066545-67066567 TTAGTTCATCTTTAAGTGTTTGG + Intergenic
1192027973 X:67475462-67475484 TCAGTTCTTCTTTAAATGTTTGG - Intergenic
1192029660 X:67495659-67495681 TTAGTTCTTTTTTAAATGTTTGG - Intergenic
1192079825 X:68036792-68036814 TTAGCTCTTCTTTATAAGTTGGG - Intergenic
1192088393 X:68125744-68125766 TTAGCTCTTCTTTAAATGTTTGG - Intronic
1192135442 X:68594674-68594696 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1192137985 X:68622762-68622784 TTAGTCCTTCTTTAAATGTTTGG + Intergenic
1192138440 X:68628580-68628602 TTAATTCTTCTTTGATTTATTGG + Intergenic
1192241637 X:69335120-69335142 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1192279259 X:69666867-69666889 TTAATTCTTCTTTGAGTGTTTGG + Intronic
1192399394 X:70819006-70819028 TTAATTCTTCTTTGAATGTTTGG - Intronic
1192417444 X:70994900-70994922 TTAGTTCTTCTTAAAATGTTTGG + Intergenic
1192506575 X:71689004-71689026 TTAATTCTTCTTTGAATGTTTGG + Intergenic
1192520122 X:71792542-71792564 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1192526008 X:71845193-71845215 TTAGTTCTTCTTTGAATGTTTGG + Intergenic
1192530439 X:71878320-71878342 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
1192559825 X:72120269-72120291 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1192635960 X:72818015-72818037 TTTGTTCTTCTTTAAATGTTTGG + Intronic
1192645754 X:72902790-72902812 TTTGTTCTTCTTTAAATGTTTGG - Intronic
1192671446 X:73146864-73146886 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1192712963 X:73610654-73610676 TTAGTTTTTATTTGATAGTTTGG + Intronic
1192717049 X:73654608-73654630 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
1192724785 X:73737764-73737786 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
1192749412 X:73973202-73973224 TTGTTTCTTCCTTGATTGTTTGG + Intergenic
1192769689 X:74175321-74175343 TTAGTTCTTATTTAAATGTTTGG - Intergenic
1192771236 X:74194382-74194404 TTAGTTCTTCCTTAAATGTTTGG + Intergenic
1192825790 X:74694524-74694546 TTAGTTCTTCTTTAAACATTTGG + Intergenic
1192842276 X:74868894-74868916 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1192853149 X:74979480-74979502 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1192908210 X:75574815-75574837 TTAGTTCTTCTTTAAACATTTGG + Intergenic
1192958556 X:76101539-76101561 TAAGTTCTTCTTTAAATGTTTGG + Intergenic
1192989945 X:76440008-76440030 TTAGTTCTTCTTTAGAGGTTTGG + Intergenic
1193003159 X:76585482-76585504 TCAGTTTTTCTTTAATTGTTTGG + Intergenic
1193003761 X:76592108-76592130 TTAGTTCATCATTGAATGTTTGG + Intergenic
1193012700 X:76695618-76695640 TTAGTTCTTTTTTCAAAGTTTGG - Intergenic
1193013200 X:76701521-76701543 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
1193017181 X:76748911-76748933 TTACTTTTTCTTTAAAAGTTTGG - Intergenic
1193028583 X:76873628-76873650 TTAGTTCTTCTTTCAATGTTTGG - Intergenic
1193093240 X:77517585-77517607 TTAGTTCTTCTTTAAACGTTTGG - Intronic
1193100532 X:77606353-77606375 TTAGTACTTCTTGGAATGTTTGG - Intronic
1193111056 X:77731396-77731418 TTAGATCTTCTTTAAATGTTTGG - Intronic
1193172715 X:78355438-78355460 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
1193180136 X:78445352-78445374 TTAATTCTTCTTTGAACATTAGG + Intergenic
1193196824 X:78642110-78642132 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1193211697 X:78813934-78813956 TTAATTCTTCTTTGTAAGTTTGG - Intergenic
1193215771 X:78862432-78862454 TTAGTTCTTTTTTAAACGTTTGG - Intergenic
1193219617 X:78908373-78908395 TTAGTTCTCCTTTAAACGTTTGG + Intergenic
1193282778 X:79673578-79673600 TTAGTTCCTCTTTTAATGTTTGG + Intergenic
1193293134 X:79801765-79801787 TTAGTTCTTCTTTAAATGATTGG + Intergenic
1193296238 X:79834720-79834742 TTAGTTCTTCTTTGTAAATTTGG - Intergenic
1193549605 X:82874524-82874546 TTAGTTTTTCCTTAAAAGTTTGG - Intergenic
1193610469 X:83625702-83625724 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1193620107 X:83742112-83742134 TTAGTTGTTCTTTAAATGTTTGG - Intergenic
1193626371 X:83826187-83826209 TTAGTTATTCTTTAAATGTTTGG - Intergenic
1193642741 X:84031683-84031705 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1193650680 X:84127382-84127404 TTAATTCTTCTTTAAATGTTTGG - Intronic
1193756359 X:85413806-85413828 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1193793553 X:85845885-85845907 TGAGTTCTTCTTTGTAATTTTGG - Intergenic
1193842556 X:86425256-86425278 TTAGTTCTTCTATAAATGTTTGG + Intronic
1193854415 X:86581131-86581153 TTATTTCTCCTTTCTTAGTTTGG - Intronic
1193877572 X:86880209-86880231 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
1193887405 X:86999586-86999608 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1193900576 X:87171499-87171521 ATATTTCTTTTTTTATAGTTTGG - Intergenic
1194083294 X:89494975-89494997 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194151016 X:90325133-90325155 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1194228331 X:91290198-91290220 TTAGTTCTTTTTTAAAAGTTTGG - Intergenic
1194274515 X:91862176-91862198 TTAGTTCTTGTTTGAATGTTTGG + Intronic
1194287913 X:92033315-92033337 TTAGTTCTTCTATAAATGTTTGG + Intronic
1194348678 X:92797946-92797968 TTAGTTCTTATTTAAATGTTTGG - Intergenic
1194368512 X:93039357-93039379 TTAGTTTTTCTTTGTATGTTTGG + Intergenic
1194371267 X:93075304-93075326 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
1194372046 X:93086053-93086075 TTAGATCTTCTTTAAATGTTTGG + Intergenic
1194401386 X:93441150-93441172 TTAGTTCTTCTTTGTAGGTTTGG - Intergenic
1194439085 X:93907191-93907213 TTGGTTCTTCTTTAAAAGTTTGG + Intergenic
1194495317 X:94609519-94609541 TTAGTGCTTCTTTAAATGTTTGG + Intergenic
1194529823 X:95032372-95032394 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194553239 X:95326993-95327015 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1194567130 X:95503885-95503907 TTAGTCCTTCTTTAAATGTTTGG + Intergenic
1194569770 X:95541154-95541176 TTAATTCTTCTTTAAACGTTTGG - Intergenic
1194574871 X:95600236-95600258 CTAGTTCTTCTTTAAATGTTTGG - Intergenic
1194689171 X:96961162-96961184 TTAGTTCTTTTTTACAAGTTTGG + Intronic
1194774675 X:97947566-97947588 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194834641 X:98667065-98667087 TTAGTTTTTCTTTAAATGTTTGG + Intergenic
1194857689 X:98954487-98954509 TTAGTACTTCTTTTAGTGTTTGG + Intergenic
1194877253 X:99204508-99204530 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
1194921072 X:99765277-99765299 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1194929684 X:99871123-99871145 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195015219 X:100772206-100772228 TTTGTTCTTCTTTAAAACTTTGG + Intergenic
1195062350 X:101208588-101208610 AGAGTTCTCCTTTGATAGTGTGG - Intergenic
1195075183 X:101320146-101320168 TTACTTCTTCTTTTAATGTTTGG + Intergenic
1195116132 X:101700023-101700045 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195165127 X:102212266-102212288 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1195171901 X:102277283-102277305 TCAGTTCTTCTTTAAGTGTTTGG + Intergenic
1195186959 X:102409810-102409832 TCAGTTCTTCTTTAAGTGTTTGG - Intronic
1195193731 X:102474825-102474847 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195199820 X:102537515-102537537 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1195236832 X:102908399-102908421 TTAGTTCTCCTTTGAAGGTTTGG - Intergenic
1195312654 X:103647496-103647518 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195396561 X:104416875-104416897 GTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195582568 X:106524362-106524384 TTAATTTTTCTTTGAATGTTTGG + Intergenic
1195601616 X:106755321-106755343 TTAGTTCTTCTTTAAACGTTTGG - Intronic
1195795087 X:108637982-108638004 TTAATCCTTCTTTAATTGTTTGG - Intronic
1195806817 X:108782035-108782057 TTACTTTTTCTTTGAATGTTAGG + Intergenic
1195815931 X:108887614-108887636 TTAATTGTTCTTTGAATGTTTGG - Intergenic
1195897029 X:109756332-109756354 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1195983000 X:110600453-110600475 TTAGTTCTTCTTTAAATATTTGG + Intergenic
1196019761 X:110978901-110978923 TTAATTCTTCTTTGAATATTTGG + Intronic
1196110265 X:111939471-111939493 TTAGTTCTTCTTCAAATGTTTGG + Intronic
1196157283 X:112444599-112444621 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1196182609 X:112709398-112709420 TTAATTCTTCTTTAAAAATTTGG + Intergenic
1196232164 X:113236745-113236767 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1196233176 X:113249097-113249119 TTAGTTCTTCTTTAAGTGTTTGG + Intergenic
1196248813 X:113433358-113433380 TTAGTTCTTCTTTAAATATTTGG - Intergenic
1196249455 X:113442874-113442896 TTATTTTTTCTTTGATACATTGG - Intergenic
1196264413 X:113625702-113625724 TTAGTTCATCTTTAAATGTTTGG + Intergenic
1196305006 X:114091280-114091302 TTAGCTCTTCTTTAAATGTTTGG - Intergenic
1196461074 X:115931763-115931785 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1196475641 X:116081461-116081483 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1196478535 X:116117989-116118011 TTAGTTCTTATTTAAATGTTTGG + Intergenic
1196557837 X:117111344-117111366 TTAGTGCTTCTTTAAATGTTTGG - Intergenic
1196564972 X:117194432-117194454 TTAGTTCTTCATTAAAAGTTTGG - Intergenic
1196592234 X:117499379-117499401 TTAGCTCTTCTTTAAATGTTTGG - Intergenic
1196599658 X:117587229-117587251 TTAGTTCTTATTTAAATGTTTGG + Intergenic
1196626407 X:117882004-117882026 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1196922451 X:120598716-120598738 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1196980276 X:121205370-121205392 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1196986463 X:121278515-121278537 ATAGTTCTTCTTTAAATGTTCGG - Intergenic
1197010384 X:121554511-121554533 TTAGGTCTTCTTTAAGTGTTTGG - Intergenic
1197021838 X:121699701-121699723 TTAGCTCTTCTTTAAATGTTTGG + Intergenic
1197062485 X:122197687-122197709 TTAATTCTTCCTTAATTGTTTGG - Intergenic
1197068391 X:122262979-122263001 TTAGTTCTTTTTTAAATGTTTGG + Intergenic
1197076053 X:122354041-122354063 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197081912 X:122428481-122428503 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1197099270 X:122632938-122632960 TTAGTTCTTCTTTAAATGATTGG + Intergenic
1197109109 X:122751439-122751461 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1197143791 X:123147920-123147942 TTAGTGCTTCTTTAAAAGTTTGG - Intergenic
1197166921 X:123388007-123388029 TTAGTTCTTCTTTGTGAGTTTGG + Intronic
1197307967 X:124867052-124867074 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1197465557 X:126800240-126800262 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1197492280 X:127132473-127132495 TTAGTTCCTCTTTCAATGTTTGG - Intergenic
1197497085 X:127197355-127197377 TTAGTTCTTCTTTAAATGATTGG - Intergenic
1197508846 X:127345316-127345338 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1197545095 X:127814821-127814843 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1197553415 X:127923441-127923463 TTAGTTCTTATTTGAAAAATTGG - Intergenic
1197554836 X:127940282-127940304 TTAGTTATTCTTTAAAAGTTTGG + Intergenic
1197564458 X:128064689-128064711 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197644848 X:129006194-129006216 GTATTTCTTTTTTGATTGTTTGG + Intergenic
1197672190 X:129290153-129290175 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197677971 X:129351253-129351275 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197797987 X:130318504-130318526 ATAGTTTTTCTTTCATATTTGGG - Intergenic
1198027605 X:132723239-132723261 TTAGCTCTTCTTTAAATGTTTGG - Intronic
1198430516 X:136561652-136561674 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1198584321 X:138103366-138103388 TTAGTTCTTCTTTTTATGTTTGG - Intergenic
1198652764 X:138881488-138881510 TTAATTCTTCTTTAAATGTTTGG + Intronic
1198696904 X:139351084-139351106 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1198702261 X:139410090-139410112 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
1198781453 X:140240838-140240860 TTAGTTCTTCTCTGAATATTTGG + Intergenic
1198795964 X:140394993-140395015 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1198938607 X:141927629-141927651 TTAGTTCTGCTTTAAATGTTTGG + Intergenic
1199035701 X:143048254-143048276 TTAGTTGTTCTTTAAACGTTTGG + Intergenic
1199048653 X:143208399-143208421 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199096029 X:143740222-143740244 TTAGTTCTTCTTTAAATGGTTGG - Intergenic
1199148505 X:144399847-144399869 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199162638 X:144631996-144632018 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199261956 X:145785105-145785127 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1199291844 X:146113720-146113742 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1199358552 X:146889701-146889723 TTAGATCTTCTTTAAATGTTTGG - Intergenic
1199459175 X:148064184-148064206 TCAGTTCTTCTTTAAATGTTTGG + Intergenic
1199485458 X:148342551-148342573 TCAGTTCTTCTTTAAATGTTAGG - Intergenic
1199901928 X:152183137-152183159 TTAGTTCTTCTTTAAGTGCTCGG + Intronic
1199909092 X:152266048-152266070 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1200345727 X:155445840-155445862 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1200379820 X:155823788-155823810 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1200435944 Y:3150849-3150871 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1200497384 Y:3901886-3901908 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1200591753 Y:5083582-5083604 TTAGTTCTTGTTTGAATGTTTGG + Intronic
1200605440 Y:5257870-5257892 TTAGTTCTTCTATAAATGTTTGG + Intronic
1200657005 Y:5914569-5914591 TTAGTTCTTATTTAAATGTTTGG - Intergenic
1200676715 Y:6155634-6155656 TTAGTTTTTCTTTGTATGTTTGG + Intergenic
1200679066 Y:6187185-6187207 TTAGTTCTTCTTTAAGTGTTTGG - Intergenic
1200680094 Y:6200094-6200116 TTAGATCTTCTTTAAATGTTTGG + Intergenic
1200967217 Y:9108451-9108473 TTAGTTATTGTTTTATGGTTAGG + Intergenic
1200972929 Y:9175994-9176016 TGATTTCCTCCTTGATAGTTTGG + Intergenic
1201358698 Y:13122919-13122941 TTACTTCTTCTTTGAATGTTTGG + Intergenic
1201599322 Y:15710704-15710726 TTTTTTCTTCTTTGTTAGTTTGG + Intergenic
1201612102 Y:15854513-15854535 TTTATTCTTCTTTGTTAGTCTGG - Intergenic
1202093992 Y:21225422-21225444 TTAGTTTTTCTTTAAAAGTTTGG + Intergenic
1202576015 Y:26326129-26326151 TTAATTCTTCTTTAAGTGTTTGG - Intergenic