ID: 1111722154

View in Genome Browser
Species Human (GRCh38)
Location 13:91959500-91959522
Sequence TTCCAAAAACATGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2531
Summary {0: 1, 1: 17, 2: 250, 3: 667, 4: 1596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111722149_1111722154 30 Left 1111722149 13:91959447-91959469 CCAAATTCTACCAAACTATCAAA 0: 1
1: 11
2: 37
3: 155
4: 954
Right 1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG 0: 1
1: 17
2: 250
3: 667
4: 1596
1111722150_1111722154 20 Left 1111722150 13:91959457-91959479 CCAAACTATCAAAGAAGAACTAA 0: 1
1: 9
2: 73
3: 514
4: 1316
Right 1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG 0: 1
1: 17
2: 250
3: 667
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111722154 Original CRISPR TTCCAAAAACATGAGGAGGA AGG Intronic
Too many off-targets to display for this crispr