ID: 1111723911

View in Genome Browser
Species Human (GRCh38)
Location 13:91980748-91980770
Sequence GGATCCTGGTGTGCTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111723911_1111723917 1 Left 1111723911 13:91980748-91980770 CCATTACCAGCACACCAGGATCC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1111723917 13:91980772-91980794 CTGTCATGTCCCTTTCAATCAGG 0: 1
1: 0
2: 0
3: 6
4: 164
1111723911_1111723920 23 Left 1111723911 13:91980748-91980770 CCATTACCAGCACACCAGGATCC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1111723920 13:91980794-91980816 GAACTGATTTCTAAGACTATAGG 0: 1
1: 0
2: 0
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111723911 Original CRISPR GGATCCTGGTGTGCTGGTAA TGG (reversed) Intronic
902617709 1:17632907-17632929 GGAGCCTGGTTTGCTGGTTCTGG + Intronic
903010641 1:20327794-20327816 GGCTGCTCGTGTGCTGGGAAAGG + Intronic
903071371 1:20728486-20728508 GGATCCTGGTGTTCTGGGCTGGG + Intronic
904336984 1:29804310-29804332 GCATCCTGTTGTCCTGGTAGAGG + Intergenic
904936658 1:34134934-34134956 TGATGCTGATGTGCTGGTCAAGG - Intronic
910505046 1:87940940-87940962 GGATCCTGGTGGGGTAGAAAGGG + Intergenic
913700054 1:121365652-121365674 GGTCCCTGGTTTGCTGCTAACGG - Intronic
914040603 1:144046105-144046127 GGTCCCTGGTTTGCTGCTAACGG - Intergenic
914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG + Intronic
917022296 1:170602315-170602337 GGTTACTCGTGTGCTGTTAAAGG - Intergenic
920506597 1:206519442-206519464 AGATCCTGGTGTGGTGGGAATGG + Intronic
1063121601 10:3108786-3108808 GGATCTTGGTGAGTTGGGAAGGG + Exonic
1065078472 10:22104127-22104149 GCATTCTGGTGTGCTGCTATTGG - Intergenic
1067789307 10:49275784-49275806 GCAACCTGGTATGCAGGTAAGGG - Intergenic
1068483014 10:57619449-57619471 GGTTGCTGATCTGCTGGTAATGG - Intergenic
1069656828 10:70096050-70096072 GACTTCTGGGGTGCTGGTAAGGG - Intronic
1069753621 10:70760539-70760561 GGGTCCTGGGGTCCTGGTAAGGG - Exonic
1077159639 11:1106844-1106866 CGATGCTGGTGAGCAGGTAATGG + Intergenic
1077832114 11:5884682-5884704 GGATCATGGTGTACTGGAGAGGG - Exonic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1084980193 11:72824827-72824849 GGCTCAGGATGTGCTGGTAAGGG + Exonic
1085534711 11:77211076-77211098 GGGTCTTGGTGTGGTGGGAAAGG + Intronic
1088495686 11:110429821-110429843 GGAACCTGGAGGGTTGGTAAAGG + Intergenic
1091489284 12:919104-919126 GGCTTCTGGGCTGCTGGTAAAGG + Intronic
1094586469 12:31781961-31781983 TGATACTGGAGTGCTGGAAAGGG + Intergenic
1094622681 12:32095241-32095263 AGACCCTGGGGTGGTGGTAATGG - Intergenic
1095595297 12:43951403-43951425 CGAGACTGCTGTGCTGGTAATGG - Intronic
1102499865 12:113344575-113344597 GCATCGTGGGGTTCTGGTAAGGG - Intronic
1102538601 12:113601353-113601375 TGATCTTGGTTTCCTGGTAAAGG + Intergenic
1107132773 13:36914046-36914068 GGATCCTAGTGAGCTGGCCAGGG - Intronic
1108112926 13:47096062-47096084 GGATACTGGTGAGCTGGGGAAGG - Intergenic
1109138594 13:58683752-58683774 TGATCCGGGAGTGCTGGGAAGGG - Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1116707032 14:48315566-48315588 GTCTCCTGGTGTGCCGGTAAAGG + Intergenic
1117646879 14:57862481-57862503 GGATCCAGGAGTGCAGATAAAGG - Intronic
1125608714 15:40956905-40956927 GAACCCTGGTGTCCTGCTAAAGG + Intergenic
1125743850 15:41986023-41986045 GGCACCAGGTGTGTTGGTAACGG - Intronic
1132266690 15:100479380-100479402 GGATCTTGGTGTTCAAGTAAGGG + Intronic
1137446652 16:48536215-48536237 GGATCCTGAGGGGCTGGCAAGGG + Intergenic
1139690688 16:68640129-68640151 GGATCCTTGTGTGCTGTTGGTGG - Intronic
1141621731 16:85239909-85239931 TGGTCTTGGTCTGCTGGTAACGG + Intergenic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1148567892 17:48644479-48644501 GGATCTTGGGGTGCTGGTGGGGG + Intergenic
1149283218 17:55131320-55131342 GAATTCTGGTATGCTGGTATGGG + Intronic
1151933301 17:77246898-77246920 GGACCCAGGTGTGCTGAGAAGGG + Intergenic
1156133640 18:34008647-34008669 GCATCATGGCGGGCTGGTAAAGG - Intronic
1156641177 18:39100891-39100913 GGATACTAGTGTGCAGATAAAGG - Intergenic
1157158093 18:45287398-45287420 TGAACCTAGTGTGCTGGTCAAGG + Intronic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1159959742 18:74546299-74546321 TGAGGCTGGTGTGATGGTAACGG - Intronic
1168251505 19:55144944-55144966 GGAGGCTGGGGTGATGGTAAAGG + Intronic
926443660 2:12918271-12918293 GGGGACTGGTGTGCTGGTATGGG - Intergenic
928120521 2:28580741-28580763 GGACCCTGGTGTGTGGGAAAGGG + Intronic
928757851 2:34547357-34547379 GGTGCCAGGTGTGGTGGTAAGGG + Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
934931690 2:98430944-98430966 GGATCTTGTTTTGCTGGAAACGG + Intergenic
939735965 2:145845628-145845650 GCATTCTGCTGTGATGGTAATGG - Intergenic
939906257 2:147919663-147919685 AGATCCTGGTGTTCTGAAAAGGG - Intronic
942316668 2:174702710-174702732 GGAGCCTGGTGTGGTGGTGCCGG - Intergenic
943876825 2:193076800-193076822 GAATACTTGTTTGCTGGTAAAGG - Intergenic
944408621 2:199414377-199414399 GGATCTTGTTGTACTGGTACGGG + Intronic
945447482 2:209955244-209955266 CCATCTTGCTGTGCTGGTAAGGG + Intronic
948237806 2:236403455-236403477 GGAGCCTGGTGTGAAGGGAATGG + Intronic
949053399 2:241910091-241910113 GGAACCTGGTGGCCTGGTTAGGG + Intergenic
1168849828 20:968955-968977 GGGTCCTGGGGTGATGGTCAGGG - Intronic
1171034498 20:21704877-21704899 GGATCCCGATCTGCTGCTAAGGG - Intergenic
1176237433 20:64060201-64060223 AGATCCTGAGATGCTGGTAAGGG - Intronic
1177621798 21:23604915-23604937 GGTGACTGGTGTGCTGTTAAAGG + Intergenic
1178351054 21:31873393-31873415 GGATCCTGGTGTCCTGAAAGGGG + Exonic
1181620146 22:24085423-24085445 GGACCCTGGTGTGCAGGGCAAGG + Intronic
1181646196 22:24232854-24232876 GGATGCTGTTGTGCAGGAAACGG + Exonic
1184610296 22:45599076-45599098 GGATCCGGGTTAGCGGGTAAGGG - Intronic
1185081820 22:48713745-48713767 GGATCCTGGTGGCCTGGACAAGG - Intronic
950473632 3:13202183-13202205 GAATCCTTGTGTACTGGTGATGG + Intergenic
950527616 3:13533549-13533571 GGATCTTGGGGTGTTGGCAAGGG + Intergenic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
950907138 3:16549439-16549461 GGAGCCAGGTGTGGTGGTTACGG + Intergenic
951692055 3:25406799-25406821 AGCTCCTGGTGTGATGGTAGTGG - Intronic
954609548 3:51937131-51937153 GGATCCGGGAGGGCTGGTCAGGG - Intronic
954663409 3:52237880-52237902 GGATCCTAGTGTGGTGGGAGGGG + Intronic
957935386 3:86935476-86935498 GGTTACTTGTGTGCTGTTAAAGG - Intergenic
958660142 3:97056598-97056620 TGCTCCTGGTGTCTTGGTAAAGG + Intronic
960715167 3:120568098-120568120 GGATGCTGCTGTGCTGGTCAGGG - Intergenic
961222356 3:125211364-125211386 GGATCCTGGTGATCTGGACAGGG + Exonic
964030046 3:152127475-152127497 ATATCCTGGTGTGCTGGTAGGGG - Intergenic
966571137 3:181444812-181444834 GGATCATGGTGTGATGGATATGG + Intergenic
967137153 3:186522064-186522086 GGAGCATGATGTGCTGGAAAGGG - Intergenic
969116435 4:4873220-4873242 GGCCCCTGCTGTGCTGGGAAAGG + Intergenic
970763849 4:19523107-19523129 GGATCTTGGTGAGGTGGTGAGGG - Intergenic
975428051 4:74253793-74253815 GGGTCCTGGTGTTCTGGTGCTGG - Intronic
977177746 4:93836750-93836772 CTATTCTGCTGTGCTGGTAATGG + Intergenic
978483863 4:109227885-109227907 AGATTCTGGGATGCTGGTAATGG + Intronic
978895189 4:113878444-113878466 GGATCCTCCTGTGATGGTAAGGG - Intergenic
982250390 4:153400277-153400299 GGATCCTGGAGAACTTGTAATGG + Intronic
985908808 5:2863436-2863458 GGAGCCTGGTGTCCTGGCACTGG + Intergenic
991127126 5:63081805-63081827 GGATCATGGTGGTCTGGTGATGG + Intergenic
994427166 5:99605793-99605815 GGATCCTGTTATGCAAGTAAAGG + Intergenic
998026151 5:138818528-138818550 GGATTTTAGTGTGCTGGTTAGGG + Intronic
1002668885 5:180848995-180849017 GGATCCTTTTGTGCTGGTCAAGG + Exonic
1002668919 5:180849244-180849266 GGATCCTCTTGTGCTGAGAAAGG + Exonic
1003106199 6:3218123-3218145 GGATCTTGGTTTGCAGGAAAGGG - Intergenic
1004071533 6:12302512-12302534 GCAGCCTGGTCTGCAGGTAAAGG - Intergenic
1007238877 6:40410995-40411017 GGACCCTGGTGTGCAATTAATGG - Intronic
1010355533 6:74928325-74928347 GAATCCAGGTGTGCTGCTCAGGG + Intergenic
1011167467 6:84465117-84465139 GGGTGGTGGTGTGCTAGTAAAGG - Intergenic
1016060636 6:139626433-139626455 GGATCCTGGCGTGTGGGTGAGGG + Intergenic
1020447464 7:8284086-8284108 GGAACTTGGTCTGCTGGTAGTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1029255655 7:99267749-99267771 GCATCCTGGTGGGGTTGTAAAGG + Intergenic
1032466413 7:132148427-132148449 GGAACATGGAGTGCTGGTGAGGG + Intronic
1034230639 7:149524791-149524813 GGTTTCTGGGGTGCTGGTAATGG + Intergenic
1035208506 7:157310471-157310493 TGCTCCTTGTGTGCTGTTAATGG - Intergenic
1035477703 7:159155345-159155367 GGAGCCGAGTGTGCTGGGAAAGG + Intergenic
1036040809 8:5078840-5078862 GGGTTCAGGTGTGCTGGGAAGGG - Intergenic
1036194209 8:6699740-6699762 GCCTCCTGGTGTGCTGGGAAGGG + Intergenic
1036438713 8:8760659-8760681 GGATCAAGGTGTGCTGGCACTGG + Intergenic
1042660187 8:71145970-71145992 AGTTCCTGGTGAGCTGGCAATGG - Intergenic
1042866668 8:73362712-73362734 GGATCCAGGCGTGGTGGTAGTGG - Intergenic
1043486131 8:80701066-80701088 GGATTCAGGGATGCTGGTAAAGG - Intronic
1043756197 8:84006170-84006192 GGTTCCTAGTGTGCTTGTGATGG - Intergenic
1043807902 8:84696793-84696815 ACATACTGCTGTGCTGGTAATGG + Intronic
1048555306 8:135470197-135470219 GCATCCTGGCGTGCTGATAAAGG + Intronic
1048852610 8:138659261-138659283 GGATCCTGGTCTGCCATTAAGGG - Intronic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1060389338 9:123266407-123266429 GGATCCTGGAATGATGTTAATGG - Intronic
1060995171 9:127871779-127871801 GGATCCTGGTGGGCTGGGGCAGG - Intronic
1188199514 X:27281858-27281880 GGATCCTACTGTGTTTGTAAGGG - Intergenic
1189427689 X:40916237-40916259 GGATGCTGAGGTGCTGGTAATGG - Intergenic
1202175341 Y:22093852-22093874 GGATCATGGTGTCCTTGTAGGGG - Intronic
1202216021 Y:22492531-22492553 GGATCATGGTGTCCTTGTAGGGG + Intronic