ID: 1111725019

View in Genome Browser
Species Human (GRCh38)
Location 13:91996274-91996296
Sequence GAACCCTGTTGGAGTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111725019_1111725023 13 Left 1111725019 13:91996274-91996296 CCACTAGGACTCCAACAGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1111725023 13:91996310-91996332 AAACATCTTCTCTCTAGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111725019 Original CRISPR GAACCCTGTTGGAGTCCTAG TGG (reversed) Intronic
914252838 1:145935894-145935916 ATACCCTGTTTGAGTCCAAGAGG + Exonic
916741879 1:167653392-167653414 GATTCCTGTTAGAGTCCTGGGGG + Intronic
917115506 1:171599356-171599378 CAACCCTCATGGAGCCCTAGGGG + Intergenic
924897151 1:248352026-248352048 GAACCATGTTGGACTCACAGTGG - Intergenic
1063991782 10:11573712-11573734 GAAACCTGTTGGATTTCTAGAGG - Intronic
1064242762 10:13646045-13646067 GAGACCTGTGGGAGTCGTAGAGG - Exonic
1071528390 10:86371671-86371693 GAACCTTGTTGGACTCCAGGGGG - Intergenic
1072193972 10:93099070-93099092 GAACCCTCTTGCACTGCTAGTGG - Intergenic
1074005924 10:109423124-109423146 AAACCCTGTTTGGGTCATAGTGG - Intergenic
1081708970 11:45204936-45204958 GCCCCCTGATGGAGGCCTAGGGG - Intronic
1084307896 11:68298703-68298725 GCTCCCTGGTGGAGTCCTAGAGG - Intergenic
1087974731 11:104530835-104530857 GAAGCTTGTTGAAGCCCTAGGGG + Intergenic
1091063677 11:132488931-132488953 GAACCCTGTTGGAATTTTCGAGG + Intronic
1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG + Intronic
1096469208 12:51865642-51865664 CAACCCTCTTGGAGTCCTGATGG - Intergenic
1103258249 12:119562076-119562098 GAACACTCTTGGACTCCTGGAGG + Intergenic
1104761457 12:131299576-131299598 GGACCCTGTTGGAGGCCACGTGG - Intergenic
1104818319 12:131661216-131661238 GGACCCTGTTGGAGGCCACGTGG + Intergenic
1104870191 12:131989341-131989363 GAGCCCCGTTGGAGGCCGAGTGG + Intronic
1106308488 13:28533286-28533308 GAAACCTTTTGGAGACCAAGTGG + Intergenic
1110826223 13:79974781-79974803 GGAACCTGTTGGAGTCCTGATGG - Intergenic
1111725019 13:91996274-91996296 GAACCCTGTTGGAGTCCTAGTGG - Intronic
1128127181 15:65201825-65201847 CAACCCTGTTGCAGACCCAGGGG + Intronic
1128335233 15:66781415-66781437 GGACGCTGTTGGGGTCGTAGGGG - Exonic
1132207594 15:99997331-99997353 GCACCGTGTTGGAGTCCCTGTGG + Intronic
1132598206 16:762700-762722 GACCCCTGTTGGGGTCCTGTGGG + Exonic
1140854761 16:78968292-78968314 GTTCCCTGTTGGATTCCTACGGG - Intronic
1148913080 17:50953784-50953806 GAACCCTGTTGGAGCCTGAGGGG - Intergenic
1150195145 17:63290188-63290210 GAACCTGGTTGGGCTCCTAGAGG + Intronic
1151655786 17:75495381-75495403 GTACCCGGTTGGAGTCCTCCAGG - Exonic
1156481534 18:37439597-37439619 GGACCATGTTGGAGCCCTTGGGG + Intronic
1158233498 18:55285807-55285829 GAACTCTTCTGGAGTGCTAGTGG + Intronic
1160017808 18:75157773-75157795 GAACCCTGTCGGTTTCCTACAGG - Intergenic
1160443847 18:78912582-78912604 GAACCCTCATGGAGTCCCACGGG - Intergenic
1160918109 19:1507216-1507238 TGACCCTGTTGGAGGCCCAGTGG + Intronic
1168535935 19:57171015-57171037 GAGCACTTTTGGAGCCCTAGGGG - Intergenic
926001622 2:9338102-9338124 GGACCCTGTTGGGGTGCTGGCGG + Intronic
928286039 2:29990833-29990855 TAACTCTGTTGGTGTCCTAAAGG + Intergenic
934120440 2:88832760-88832782 GCACACTGTGGGAGCCCTAGTGG - Intergenic
934157707 2:89218612-89218634 GGACCCTGTTGGAGCCAAAGAGG + Intergenic
934209558 2:89963814-89963836 GGACCCTGTTGGAGCCAAAGAGG - Intergenic
935071270 2:99696001-99696023 GAGCCCTGTTGGAGTGGTTGGGG - Intronic
936648999 2:114404767-114404789 CAACCCTGTTGGAGCTCCAGAGG - Intergenic
940637022 2:156309764-156309786 GAATCTTTTTGGAGTACTAGGGG - Intergenic
941905358 2:170713860-170713882 GAACCGCGTTGGAGGCCTCGCGG - Exonic
942629824 2:177943332-177943354 GAACCCTTGTGAAGTACTAGTGG - Intronic
945541434 2:211092212-211092234 AAGCCCTGCTGGAGTACTAGAGG + Intergenic
947342950 2:229159255-229159277 GAGGCCAGATGGAGTCCTAGTGG - Intronic
1169135514 20:3194899-3194921 GAACCCTGTGGGCTTGCTAGGGG - Intronic
1178193499 21:30315056-30315078 GAAACCTGTGGGATCCCTAGAGG + Intergenic
1178935661 21:36859475-36859497 GGACCCTGTGGGGGTCCCAGTGG - Intronic
1179251900 21:39677778-39677800 GAACACTGTTGGAGGCCTGGGGG - Intergenic
1179409660 21:41153033-41153055 GGACCCTGTTGGACTCAGAGTGG + Intergenic
1180992019 22:19942399-19942421 GCTCCCTGTTGGAGGCCTTGGGG + Intronic
1182897229 22:33868912-33868934 GAATTCTGTTGAAGTACTAGTGG - Intronic
1183629178 22:39022765-39022787 GAGCCCTCCTGGAGTCCTCGGGG - Intronic
957202701 3:77157567-77157589 GAAGGCTGTTGGAGTCCATGGGG + Intronic
962532080 3:136291846-136291868 GAACCTTGTTGAGTTCCTAGAGG + Intronic
967214552 3:187199354-187199376 GGAACCTGCTGTAGTCCTAGGGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968682204 4:1929001-1929023 GAACACTGGTGGAGTGCTGGGGG + Intronic
974508657 4:62808571-62808593 GAAGCCAGTCGGAGTCCCAGAGG + Intergenic
981167061 4:141573107-141573129 GAACCCTTTTGCACTGCTAGTGG + Intergenic
986560867 5:9059922-9059944 TAACCCTGTTGGGTTCATAGTGG - Intronic
996884276 5:128337725-128337747 GAGCCCTGTGGAAGTCCTTGTGG - Intronic
1002998782 6:2311726-2311748 GAACCCACTTGGAGTCCCACCGG - Intergenic
1016542584 6:145182351-145182373 GAACCCTGTTGTGGGGCTAGGGG + Intergenic
1028953831 7:96666706-96666728 GTACCAGGTTGAAGTCCTAGAGG - Intronic
1037300399 8:17445418-17445440 GAAATCTGTTTGGGTCCTAGCGG + Intergenic
1038389002 8:27177407-27177429 GAACCCTCGTGGACTGCTAGTGG + Intergenic
1185488822 X:503801-503823 GAACCCTGATGTTATCCTAGGGG - Intergenic
1187046927 X:15656029-15656051 CAGCCCTGTTCAAGTCCTAGGGG + Intronic
1190565895 X:51730084-51730106 GAACCTGGTGGGATTCCTAGTGG + Intergenic
1192215770 X:69157037-69157059 GAACCCAGTAGGAGTCATGGGGG - Intergenic
1197892098 X:131278398-131278420 GAGCAGTGTTGGAGTCCCAGGGG + Intronic
1198406619 X:136319204-136319226 GAGCCCTGCTGGAGGCCCAGAGG + Intronic