ID: 1111725019

View in Genome Browser
Species Human (GRCh38)
Location 13:91996274-91996296
Sequence GAACCCTGTTGGAGTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111725019_1111725023 13 Left 1111725019 13:91996274-91996296 CCACTAGGACTCCAACAGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1111725023 13:91996310-91996332 AAACATCTTCTCTCTAGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111725019 Original CRISPR GAACCCTGTTGGAGTCCTAG TGG (reversed) Intronic