ID: 1111727611

View in Genome Browser
Species Human (GRCh38)
Location 13:92032412-92032434
Sequence CCATAGGTTTGGGGGGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 15, 3: 54, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111727611 Original CRISPR CCATAGGTTTGGGGGGAAAC GGG (reversed) Intronic
902544395 1:17179787-17179809 CCGTAGGTTTTTGGGGGAACAGG + Intergenic
904491692 1:30864470-30864492 GCATGGGTTTGGGGGCATACAGG - Intergenic
905504386 1:38465552-38465574 CCATGGCTTGGGGGGGACACAGG + Intergenic
910899141 1:92100939-92100961 CCATAGGTTTGTGGGGGAACAGG + Intronic
911318620 1:96384972-96384994 CCATACGTTTTTAGGGAAACAGG - Intergenic
915302526 1:154959576-154959598 CCATAGGATTGGGAGGGAAGGGG + Exonic
916203795 1:162296351-162296373 CAATGGGTTTGGGGAGTAACAGG - Intronic
917990928 1:180377985-180378007 CCATAAGTTTGAGGAGAAACAGG + Intronic
919293512 1:195664151-195664173 CCAGAGGTTTGGGCCAAAACTGG - Intergenic
923000892 1:230005546-230005568 CCATAGGTTTTTGGGGGAACAGG + Intergenic
923459267 1:234194572-234194594 CCATAGGTTTGAGGGGGAACAGG - Intronic
924408447 1:243777136-243777158 CCATGGGATTGGGGGGAGACGGG + Intronic
924567802 1:245212537-245212559 CCGTAGGATTGGGGGCAAAGAGG - Intronic
1064668694 10:17685682-17685704 CCATAGGTTTGGACCCAAACTGG - Intronic
1065652632 10:27909439-27909461 CCTAAGGTTTGGGGTGAAAATGG - Intronic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1066202875 10:33159004-33159026 CTATTGGTTTTGGGGGGAACAGG - Intergenic
1066706318 10:38182910-38182932 CCATAGGGTTTGGGGGAAACAGG + Intergenic
1066784411 10:38987307-38987329 CCATAGGTTTTTTGGGGAACAGG + Intergenic
1066983637 10:42443151-42443173 CCATAGGTTTTGGGGGAAACAGG - Intergenic
1067075430 10:43177431-43177453 GCCTAAGTTTGGGGGGAAAGAGG - Intronic
1067371488 10:45687731-45687753 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067388295 10:45838419-45838441 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067417830 10:46118864-46118886 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067445971 10:46346155-46346177 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067503186 10:46825426-46825448 CCTTAGGTTTCTGGGGGAACAGG + Intergenic
1067591411 10:47514590-47514612 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067638529 10:48022685-48022707 CCATAGGTTTCTGGGGGAACAGG - Intergenic
1067874960 10:49997647-49997669 CCATAGGTTTCTGGGGGAACAGG + Intronic
1069627964 10:69880125-69880147 CCATTGGAGTGGCGGGAAACAGG - Intronic
1070135128 10:73687102-73687124 CCATAGGTTTCTGGGGGAACAGG - Intronic
1072661572 10:97366693-97366715 CCCTTGGGTTGGGGGGACACCGG + Intronic
1075445911 10:122512715-122512737 TCATAGGTTTTTGGGGGAACAGG + Intronic
1076479257 10:130773968-130773990 CTATTGGTTTTGGGGGAGACGGG - Intergenic
1078470014 11:11579096-11579118 ACATAGGTTTGGCTGGGAACTGG + Intronic
1080202877 11:29693840-29693862 CAATAGGTTTTTGGGGAAACAGG + Intergenic
1080586818 11:33690079-33690101 CTTTGGTTTTGGGGGGAAACAGG - Intergenic
1080694899 11:34595000-34595022 CCACTGGTTTGGGGCAAAACCGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1087040409 11:93793583-93793605 ACATATGTTTTGGGGGAAAAGGG - Intronic
1089569230 11:119392005-119392027 CCATAGGTTTTTAGGGGAACAGG + Intergenic
1090003946 11:122984174-122984196 CCTTAGCTTTGGGGGAAAGCAGG - Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1091022823 11:132116231-132116253 CCATAGGGCTGGAGGGACACAGG + Intronic
1091273300 11:134332544-134332566 CCAGAGGCTTGGGAGGAAAAGGG - Intronic
1091460336 12:639567-639589 CCATAGGTTAGGGTGGCAATGGG - Intronic
1092506024 12:9101031-9101053 CCATAGGTTTTTGGGGGAACAGG - Intronic
1093549717 12:20393424-20393446 CCATAGTTCTGGGAGGGAACTGG - Intronic
1096014167 12:48252687-48252709 CTATAGGTTTTTGGGGAACCAGG + Intergenic
1096203937 12:49706549-49706571 CCAGATGTTTGGGGGGAGAGGGG - Intronic
1096518280 12:52170320-52170342 CCATAGGTGTGGGGGGTTCCTGG + Exonic
1096917175 12:55045831-55045853 CCATGGGTTTTGGGGAGAACAGG + Intergenic
1097765147 12:63517966-63517988 CCATAGGTTCCTGGGGGAACAGG - Intergenic
1098689640 12:73470814-73470836 CCATAGGTTTTGGGGCCAACAGG - Intergenic
1102434858 12:112913960-112913982 CAATAGGTTTTTGGGGGAACAGG + Intronic
1102831568 12:116006604-116006626 CCATAGGATTGAGGGGAAAGTGG - Intronic
1108587221 13:51880920-51880942 CCATAGGTTTTTGGGGGAACAGG - Intergenic
1110173654 13:72531799-72531821 CCATAGGTTTTTGAGGGAACAGG - Intergenic
1110370136 13:74730386-74730408 CCATATGTTGGGGGGGAACATGG - Intergenic
1111162242 13:84410315-84410337 TCATAGGTTTTGGGGGGAACAGG - Intergenic
1111492570 13:89001659-89001681 CCATAGTTTTTTGGGGGAACAGG + Intergenic
1111690446 13:91556946-91556968 CCACAGGTTTTGGGGGGAACAGG - Intronic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1111736470 13:92146525-92146547 CCTTAGGTTTTGGGGAAAACAGG + Intronic
1112617139 13:101017368-101017390 CCAAGGGTTGGGTGGGAAACAGG + Intergenic
1114504915 14:23202993-23203015 CCATAGGTTTTTTGGGGAACAGG + Intronic
1115341657 14:32299226-32299248 CAGTAGGTTTTTGGGGAAACAGG + Intergenic
1116744534 14:48799977-48799999 CCAGAGGTTGGGGGGGTAAGGGG - Intergenic
1117594654 14:57314040-57314062 TGATAGGTTTGGGGGGAAATTGG - Intergenic
1120958248 14:90101859-90101881 CCATAGGTTTTCGGGGGAACAGG - Intronic
1121063064 14:90934761-90934783 CCAAAGGTTGGGGGGTAAATAGG - Intronic
1123067305 14:105625172-105625194 CCTTGGGTTTTGGGGGGAACAGG + Intergenic
1123799584 15:23806074-23806096 CCATAGGTTATTGGGAAAACAGG + Intergenic
1124211643 15:27769619-27769641 CAATAGGTTTTAGGGGGAACAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1127041191 15:54978723-54978745 CCATAGGTTTTTGGGAGAACAGG - Intergenic
1127973936 15:63983490-63983512 CCACAGGGTTGGGGGGCAGCAGG - Intronic
1128743617 15:70099067-70099089 CCATCGGTTTGCGGGCAAGCTGG - Intergenic
1129767459 15:78179274-78179296 CCATAGGTTCAGGGGGCACCTGG + Intronic
1132247467 15:100308911-100308933 CCAGAAGTTTGGGAAGAAACAGG - Intronic
1132947722 16:2541243-2541265 GCACAGTTTTGGGGAGAAACAGG + Intronic
1132966717 16:2660100-2660122 GCACAGTTTTGGGGAGAAACAGG - Intergenic
1133595006 16:7282598-7282620 CCATAGGTTATTGGGGGAACAGG + Intronic
1133608018 16:7407078-7407100 TCATAGGTTTTTGGGGGAACGGG + Intronic
1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG + Intronic
1135274833 16:21103287-21103309 CCATAGGTTTTTGGGGGAACAGG - Intronic
1135704143 16:24660092-24660114 CTGTAGGTTTTGGGGGGAACAGG + Intergenic
1137494236 16:48957341-48957363 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1137552824 16:49452369-49452391 CCTGATGTCTGGGGGGAAACGGG - Intergenic
1137639773 16:50018468-50018490 CAATAGGTTTTTGGGGGAACGGG - Intergenic
1139630635 16:68230037-68230059 CCATTGTCTTTGGGGGAAACAGG + Exonic
1139942428 16:70615098-70615120 CCAGAGATTTGGGGGGTAACAGG - Intronic
1140357752 16:74320631-74320653 CCAAAGGTTTGGGGGTGAAATGG + Intergenic
1141011470 16:80404390-80404412 TCATAGGATTGGGGGGAAGAGGG + Intergenic
1143103264 17:4515410-4515432 CCATAGGCTGGGGGGGAGCCTGG + Intronic
1143496150 17:7313798-7313820 ACTTAAGTTTAGGGGGAAACGGG - Intronic
1148966074 17:51437279-51437301 CCATAGGTTATTGGGGGAACGGG + Intergenic
1149399773 17:56283866-56283888 CCATAGGTTTTTGGGGGAACTGG - Intronic
1150469939 17:65428664-65428686 CTATAGGTTTTTGGGGGAACAGG - Intergenic
1150648069 17:66992263-66992285 CCATAGATTGGGGAGGAGACGGG + Intronic
1150657426 17:67049215-67049237 CCATAGATTTGGGGAAAAATTGG - Intronic
1151281873 17:73082089-73082111 CAGTAGGTTTTGGGGGGAACAGG - Intronic
1153040421 18:807989-808011 CCCTAGATTTGGGGGGGAAAAGG + Intronic
1153079408 18:1204748-1204770 CCACAGGTTATTGGGGAAACAGG + Intergenic
1155308328 18:24500256-24500278 CCATGGCTTAGTGGGGAAACTGG + Intergenic
1155641337 18:28019269-28019291 CAATAGGTTTTTGGGGGAACAGG - Intronic
1156270074 18:35522611-35522633 CCATAGCTGTGGAGGGCAACAGG - Intergenic
1156425351 18:37005212-37005234 CTATAGGTTTTGGGGAAAACAGG - Intronic
1157810095 18:50688863-50688885 CCATAGGTTTTTGGGAGAACAGG - Intronic
1158287917 18:55905176-55905198 CTATAGGTTTTGGAGGAAAGGGG + Intergenic
1159907071 18:74103080-74103102 CCACAGGTTTTTGGGGGAACAGG - Intronic
1163433035 19:17279658-17279680 CCATTGGTTGGGGGGTAAGCAGG - Intronic
1164636349 19:29794298-29794320 CCATAGGTTTTTGGGGGAATAGG - Intergenic
1164889495 19:31811120-31811142 CCATAAGTTTTTGGGGGAACAGG + Intergenic
1164928132 19:32147209-32147231 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1165160896 19:33815556-33815578 GCAGGGGTTTGGTGGGAAACGGG - Intronic
1165165950 19:33856515-33856537 CAATAGGTTTTGTGGGGAACAGG - Intergenic
1166264004 19:41665723-41665745 CCATAAGTTTTTGGGGGAACAGG - Intronic
1166387158 19:42388866-42388888 AGATGGGTTTGGGGGGAATCAGG - Intronic
1168073951 19:53968836-53968858 CCACAGGTTTGGGGAAAAACAGG + Intronic
1168128520 19:54301135-54301157 CCATAGGTTTTTGGGGAACGTGG - Intergenic
1168467850 19:56618623-56618645 CCGTGGGGTTGTGGGGAAACAGG + Intronic
925532666 2:4882252-4882274 CCATAGGTTTTGGGGGGAACTGG - Intergenic
926772560 2:16391413-16391435 CCATAGGTTTTTGGGGGAACAGG + Intergenic
927036208 2:19179413-19179435 CAATAGGTTTTTGGGGTAACCGG + Intergenic
927722717 2:25396691-25396713 CAATAGGTTTTGGGGGAACATGG - Intronic
928495549 2:31828481-31828503 CCATATGTTTGGGAGAAAATAGG - Intergenic
929300800 2:40301758-40301780 CCATAGGTTTTGGGGAAAACAGG + Intronic
929823103 2:45289372-45289394 GCATAGGTTTTGGGGGATAGAGG - Intergenic
931554203 2:63481867-63481889 CCATAGGTTTTTGGGGGAACAGG - Intronic
931712547 2:65001451-65001473 CCACAAGATTGGAGGGAAACAGG - Exonic
935180744 2:100689167-100689189 CCATAGGTTTTGGGGGGAACGGG - Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
938628141 2:133134425-133134447 ACAAAGCTTTTGGGGGAAACAGG - Intronic
938669904 2:133576993-133577015 CCAGAGGCTTAGGTGGAAACTGG - Intergenic
939496029 2:142929626-142929648 CCATAGGTTTGGGGGAGAGGAGG + Intronic
940544989 2:155071859-155071881 CCAGGGATTTGGGGGTAAACTGG + Intergenic
940802763 2:158151514-158151536 CCATAGGTTATTGGGGGAACAGG - Intergenic
940812987 2:158266485-158266507 CCATAGTTTTTTGGGGAAACAGG + Intronic
941924687 2:170883484-170883506 CCATAGGTTTTGGGGGAACAGGG + Intergenic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
945579983 2:211581244-211581266 CCATAGGTTATTGGGGGAACAGG - Intronic
945902534 2:215555075-215555097 CCATAGGGTTGGGAGGAACTGGG + Intergenic
946002397 2:216493487-216493509 CCATAGGTTAGGGTGGAAGATGG - Intergenic
946462673 2:219883174-219883196 CCATAGGTTTTTTGGGGAACAGG + Intergenic
949057215 2:241934664-241934686 ACACTGGTTTTGGGGGAAACTGG - Intergenic
1169188006 20:3635337-3635359 CAATAGGTTTTTGGGGGAACAGG - Intronic
1176886071 21:14257007-14257029 CTATAGGTTTTTGGGGGAACAGG + Intergenic
1176983542 21:15410160-15410182 TCATAGGTTTGGGGGAAAAATGG - Intergenic
1177098209 21:16866015-16866037 GTTTAGGTTTGGGGGGAAAAGGG + Intergenic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1178881991 21:36457010-36457032 CCAAAGATTTGGGTGGATACAGG + Intergenic
1179260862 21:39757210-39757232 CAATAGGTGTGGGGAGAAACAGG - Intronic
1180211437 21:46297432-46297454 CCACAGGGTTTGGGGGAAGCCGG - Intronic
1181551262 22:23640158-23640180 CCATAGGGTCTGGGGGAAGCGGG - Intergenic
1183154058 22:36060774-36060796 CCATAGGTTTTGGAGGGAACAGG - Intergenic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1185158676 22:49209458-49209480 CCATAGGTGTGGGGGTTAAACGG - Intergenic
949316905 3:2766721-2766743 CCATAGGATTTGGGGGAACAGGG - Intronic
949799691 3:7890092-7890114 CAATAGATTTTGGGGGGAACAGG - Intergenic
949892995 3:8747020-8747042 AGATAGGATTGGGGGGATACTGG - Intronic
951144106 3:19205830-19205852 CCATAGGTTTTGGGGGAACAGGG + Intronic
951353496 3:21635580-21635602 CCATAGGTTTGGGGGAACAGGGG + Intronic
951487405 3:23229306-23229328 CCATAGGTTTTTTGGGGAACAGG + Intronic
952373974 3:32749862-32749884 CCATAGGTATGTGGGGGAACAGG - Intronic
953544430 3:43853942-43853964 CCATAGATCTGAGGGCAAACAGG - Intergenic
954421829 3:50422979-50423001 CCCTGGGTCTGGGGGGAACCTGG - Intronic
956208044 3:66774116-66774138 GCACAGGTTTGGGAGGAAACTGG + Intergenic
956771159 3:72527163-72527185 CCCTTGGTTTGGGGGAAAGCTGG - Intergenic
956846658 3:73189797-73189819 CCATTTGTTTGGGGTGAGACTGG + Intergenic
957025229 3:75173916-75173938 CAATAGTTTTTGGGGGGAACAGG + Intergenic
957312503 3:78539130-78539152 CTATAGGTTTTTGGGGGAACAGG - Intergenic
958012184 3:87894027-87894049 CCATAGGTTTTGGGGGGAACAGG + Intergenic
958014315 3:87920377-87920399 CCATAGGTTATTGGGGGAACAGG - Intergenic
958480264 3:94636613-94636635 TCATAGGGTTGGGGGGATAGGGG + Intergenic
958661355 3:97071739-97071761 CCATAGGTTTTGAGGGGAACAGG + Intronic
958969396 3:100594750-100594772 CCATAGGTTATTGGGGATACAGG + Intergenic
959561441 3:107787677-107787699 CAATAGGTTTGTGAGGGAACGGG + Intronic
959760072 3:109951484-109951506 CTAGAGGTTTGGAGGGAAATAGG + Intergenic
960064458 3:113355196-113355218 CAATAGGTTTTTGGGGGAACAGG - Intronic
963958856 3:151285659-151285681 CAATAGGTTTTTGGGGGAACAGG - Intronic
963996246 3:151712400-151712422 CAACAGATTTGGGGGGGAACAGG - Intergenic
964388848 3:156177189-156177211 GCAAAAGTTTGGGAGGAAACTGG + Intronic
964620975 3:158719739-158719761 CAATCAGTTTGGAGGGAAACAGG + Intronic
965378167 3:167953296-167953318 CCATAGGTTTTTTGGGGAACAGG + Intergenic
966334695 3:178854895-178854917 CCATTGGTTGAGGGTGAAACTGG + Intergenic
966363249 3:179152326-179152348 CCAAATGTTTGTGGTGAAACAGG - Intronic
969835416 4:9836276-9836298 CCATAGGTTTTTTGGGGAACAGG - Intronic
970544342 4:17112106-17112128 CCATAGGGCTGGGGGAACACAGG + Intergenic
975535071 4:75441557-75441579 CAATAGGTTTTTGGGGGAACAGG - Intergenic
976086915 4:81416199-81416221 CAATAGGTTTTGGGGGAAACAGG - Intergenic
976791836 4:88887262-88887284 CAATAGGTTTTTGGGGGAACAGG - Intronic
978058488 4:104305649-104305671 TAATAGGTTTTGGGGGGAACAGG + Intergenic
978250602 4:106627405-106627427 CAATAGGTTTTTGGGGCAACAGG + Intergenic
978923973 4:114220040-114220062 CCATAGGTTATTGGGGGAACAGG + Intergenic
979483127 4:121240887-121240909 CCATAGGTTTTAGGGGAACAGGG + Intergenic
979831513 4:125311156-125311178 ACAAAGGTTTGGAGGAAAACTGG + Intergenic
980431421 4:132703287-132703309 CAATAGGTTTTTGGGGGAACAGG - Intergenic
981492780 4:145358153-145358175 CCAGGGGTTTAGGGGGAAAAGGG + Intergenic
982242672 4:153316249-153316271 CCATAGATTTACAGGGAAACTGG + Intronic
982450845 4:155550740-155550762 CCAGGGGTTGGGGGTGAAACAGG + Intergenic
982955958 4:161766532-161766554 TCATGGGTTTGGGGCCAAACTGG - Intronic
983350560 4:166582471-166582493 CCATAGGTTTTTGGGGGAACAGG + Intergenic
983747171 4:171215876-171215898 CCATATGTTTTGGGGGAAAAGGG + Intergenic
987753033 5:22066176-22066198 CCATAGGTTTTTGGGGGAACAGG + Intronic
987832610 5:23115516-23115538 TCACAGGTTTTGGGGGGAACAGG - Intergenic
988119674 5:26944476-26944498 TTAAAAGTTTGGGGGGAAACGGG - Intronic
988620779 5:32821339-32821361 CCATTTGCTTTGGGGGAAACTGG + Intergenic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
989414794 5:41161146-41161168 GGATATGTTTGGGGGAAAACAGG + Intronic
989723596 5:44559707-44559729 CCATAGTTTTTTGGAGAAACAGG - Intergenic
990918190 5:60933592-60933614 CAATAGGTTTTGGGGGGAACAGG + Intronic
992086533 5:73282985-73283007 CCCTAGGGTTGTGGGGGAACTGG - Intergenic
992129805 5:73680640-73680662 CAATAGGTTTTTGGAGAAACAGG - Intronic
992339559 5:75808640-75808662 CCATAGGTTATTGGGGGAACAGG + Intergenic
995895200 5:117003328-117003350 TAATAGGTTTTGGGGGGAACAGG + Intergenic
996128812 5:119755997-119756019 CCATAGGATTTTGGGGGAACAGG - Intergenic
997780169 5:136649596-136649618 CAATAGGTTTTTGGGGGAACAGG + Intergenic
999982658 5:156972757-156972779 CAATAGATTTGGGGGTAAGCTGG - Intergenic
1001176646 5:169475274-169475296 CCATAGGTTTGGTGAGGAACAGG + Intergenic
1001757663 5:174183085-174183107 CTATGGGTTTTGGGGGTAACAGG - Intronic
1003137836 6:3446687-3446709 CCAGAGGTTCTGGAGGAAACTGG - Intronic
1004592610 6:17068444-17068466 CCCTAGGTTTTTGGGGGAACAGG + Intergenic
1004858650 6:19778039-19778061 CCATAGGTTTTTGGGGGAACAGG + Intergenic
1006914981 6:37588182-37588204 CCAGAGATTTGGGGGAAAACTGG + Intergenic
1007063207 6:38963101-38963123 CAACAGGTTTTGGGGGGAACAGG - Intronic
1007520473 6:42448204-42448226 AGATAGCTTTGGGGAGAAACTGG - Intronic
1007979356 6:46134845-46134867 CCAGGGGTTGGGGGGGAAATGGG - Intronic
1009744639 6:67797178-67797200 CCATAGGTTTTTGGTGGAACAGG - Intergenic
1010141546 6:72620421-72620443 CCAGAGGCTTGGGGGGAAGGAGG + Intergenic
1010512662 6:76739666-76739688 CCATAGATTTTTTGGGAAACAGG + Intergenic
1011290300 6:85770056-85770078 TCATAGGTTTTGGGGGGAATGGG + Intergenic
1011965886 6:93156872-93156894 CCATGGGAGTGGGGGAAAACTGG + Intergenic
1012060770 6:94477058-94477080 CCATAGGTTATTGGGGGAACAGG - Intergenic
1014539773 6:122661347-122661369 CCCTAGGCTTTGGGGGAAATAGG - Intronic
1016282958 6:142440159-142440181 CTATAGGATTCGGGGGAAAACGG + Intronic
1016474373 6:144410431-144410453 CCATAGGTTTTGGGGGGAACAGG + Intronic
1016740575 6:147524359-147524381 ACAGTGGTTTGGGGGGAAAGGGG + Intronic
1017295297 6:152786551-152786573 CAATAGGTTTTGGGGGTAACAGG + Intergenic
1017302373 6:152876794-152876816 CCATAGGTTTTGGGGGGAACAGG - Intergenic
1017524058 6:155227367-155227389 CAATAGGGTTGTGGGGAAAACGG - Intronic
1017793465 6:157822500-157822522 CGAGAGGTTTGGGGGACAACAGG - Intronic
1017905523 6:158755361-158755383 CCATAGACTTGAGGGAAAACTGG + Intronic
1019434590 7:1015525-1015547 CCTTAGACTTGGGGGGAAACAGG - Intronic
1019788027 7:2991787-2991809 CCATAGGTTTTTGGGGGTACAGG + Intronic
1020786637 7:12581540-12581562 ACATAGCTTGAGGGGGAAACTGG + Intronic
1020834141 7:13127304-13127326 TCATAGGTTTTGGGGGACAGGGG + Intergenic
1021048728 7:15955987-15956009 TCATGGGGTTGGGGGGAAAGGGG - Intergenic
1021620241 7:22544017-22544039 CAATAGGTTTTTGGGGGAACAGG - Intronic
1022264162 7:28737002-28737024 CCACAGGTCTGGGTGGGAACAGG - Intronic
1022953372 7:35359889-35359911 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1024351371 7:48368323-48368345 CCATAGGTTTTTTGGGGAACAGG + Intronic
1025712234 7:63923074-63923096 CCAAAAGTTTGGGGGGAAAAGGG + Intergenic
1028726922 7:94098266-94098288 CCATACGTTTTGGGAGGAACAGG - Intergenic
1029014709 7:97303866-97303888 CCATATGTGTGGGGGAAAAAAGG - Intergenic
1029057244 7:97759833-97759855 CCATAGGTTTTTGGGGAACAGGG + Intergenic
1030625344 7:111839842-111839864 CCATAGGTTTTTGGGGAAACAGG + Intronic
1033999345 7:147392373-147392395 CCATAGGTTTTTGGGGGAACAGG + Intronic
1034208146 7:149336599-149336621 CAATAGGTTTGGGGGGGAACAGG - Intergenic
1034229643 7:149511997-149512019 CAATAGGTTTTGGGGGGAATAGG + Intergenic
1035293936 7:157857274-157857296 CCATAGGCTTGAGGGAAAACAGG - Intronic
1037549744 8:19958588-19958610 CCATAGGTTATTGGGGGAACAGG + Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038811674 8:30852668-30852690 CCGTAGGTTTTTAGGGAAACAGG - Intronic
1039000729 8:32977101-32977123 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1043278805 8:78436954-78436976 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1044616471 8:94147888-94147910 CCATAGGTTTGGGTGAACAAGGG - Intronic
1046557154 8:115789581-115789603 ACATAGGCTTGGGGGAAAAAAGG - Intronic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1054961712 9:70977088-70977110 CCATATGTTGGTGGGGAAAGGGG + Intronic
1055928700 9:81537741-81537763 CCACAGGTTTTTGGGGGAACAGG + Intergenic
1056107020 9:83356756-83356778 CGATAGGTTTTTGGGAAAACAGG + Intronic
1056178971 9:84063043-84063065 CCATACGTTTTGGGGGGAATGGG - Intergenic
1057605201 9:96494016-96494038 CCATAGGTGCAGGGGGAAAGCGG - Intronic
1058396650 9:104561306-104561328 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1060418454 9:123449969-123449991 CCATAGCCTTTGGGGGAAACAGG - Intronic
1062186040 9:135219093-135219115 CCCCAGGTTTGGGGAAAAACAGG - Intergenic
1185590365 X:1272395-1272417 TTATAGGGTTGGGGGGAAAGAGG + Intronic
1186528948 X:10276159-10276181 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1186587333 X:10889291-10889313 CCATAGGTTTTTGGGGAAACAGG + Intergenic
1186740265 X:12509711-12509733 CCATAGGTTATTGGGGGAACAGG - Intronic
1187304928 X:18086434-18086456 GCATAGGTTTGGGTGGTAGCAGG - Intergenic
1187837026 X:23442348-23442370 CCATAGGTTTTTGGGGAACAAGG - Intergenic
1188410126 X:29861674-29861696 CCATAGGTTTTTGGGGGAACAGG - Intronic
1190589777 X:51988073-51988095 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1190685761 X:52871405-52871427 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1192082276 X:68059953-68059975 CCAAAGGTTTGTGGTGACACTGG - Intronic
1193277397 X:79605102-79605124 CAAGATGTCTGGGGGGAAACAGG - Intergenic
1194097903 X:89666021-89666043 CCATAGTAGTGGGTGGAAACAGG + Intergenic
1195683657 X:107566813-107566835 CCAGAGCTCTGGGAGGAAACAGG + Intronic
1197376198 X:125684617-125684639 CAATAGGTTTTTAGGGAAACAGG - Intergenic
1197526279 X:127568084-127568106 TCTGAGGTTTGGGGGAAAACTGG + Intergenic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1198199364 X:134399927-134399949 CCAGAGGTTTGGGAGGGAAAAGG - Intronic
1200450925 Y:3327410-3327432 CCATAGTAGTGGGTGGAAACAGG + Intergenic