ID: 1111735590

View in Genome Browser
Species Human (GRCh38)
Location 13:92135050-92135072
Sequence CTGCAGCAGGAGAACCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 580}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111735590 Original CRISPR CTGCAGCAGGAGAACCAGAG AGG (reversed) Intronic
900119268 1:1041649-1041671 CTGCAGGAGGAGACCCCGGGCGG - Exonic
900184739 1:1327780-1327802 CTGCAGCAGGAAAGCCGGTGCGG - Exonic
900612622 1:3550783-3550805 CTGCAGAGTGAGAACCCGAGGGG + Intronic
900680535 1:3913939-3913961 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
900707789 1:4091094-4091116 CTGCAGGAGGAGTAACACAGTGG - Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901439753 1:9270670-9270692 CTGTTGCAGGAGAACTAGACGGG + Exonic
902316522 1:15623963-15623985 CTGAAGCAGGAGAACCTGGGAGG + Intronic
902365473 1:15970479-15970501 CTGAGGCAGGAGAACCCGGGAGG - Intronic
902689886 1:18104586-18104608 TTGCAGCAGGACACCCAGTGAGG - Intergenic
902701642 1:18176243-18176265 CTGCAGGAGGGGACACAGAGAGG + Intronic
902779235 1:18693731-18693753 CAGCTGCAGGAGGATCAGAGCGG - Intronic
903807616 1:26016774-26016796 ATGCAGCAAGAGAAACAGGGAGG + Intergenic
904670200 1:32158943-32158965 CTGAAACAAGAGACCCAGAGAGG - Intronic
904784930 1:32975739-32975761 CTGAGGCAGGAGAATCAGACCGG + Intergenic
905402782 1:37715711-37715733 CAGGAGCAGTAGAACCAGGGAGG - Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905987734 1:42302415-42302437 CTGGAGCAGGAGACCAAGACAGG + Intronic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
906168200 1:43703631-43703653 CTTCAGCAGGAGGACCAAACTGG - Exonic
906277011 1:44524051-44524073 CTGCTGCTGGGGCACCAGAGTGG - Intronic
906390363 1:45410064-45410086 CTGAAGCACGAGAACCTGGGAGG + Intronic
907014256 1:50996221-50996243 CTGAAGAAAAAGAACCAGAGAGG + Intergenic
907148340 1:52257822-52257844 CTGAGGCAGGAGAACCCAAGAGG - Intronic
907348018 1:53800423-53800445 CTGAGGCAGGAGAACCAGGGAGG - Intronic
907462710 1:54614798-54614820 CTGCCGCAGGAGGTCCAGGGAGG + Exonic
908681794 1:66670102-66670124 CTGCAGTAGGAGAATGACAGGGG - Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911168283 1:94744633-94744655 CTGGCTCAGGAGAACCAGGGAGG + Intergenic
911194593 1:94980980-94981002 CTGCAGCAGGATTACCTGTGGGG + Exonic
912303086 1:108536717-108536739 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
912669237 1:111608800-111608822 CTGAGGCAGGAGAACCAGGCAGG + Intronic
912933294 1:113982774-113982796 TGGCAGCAGGAAAATCAGAGCGG - Intergenic
913229445 1:116729695-116729717 CTGCTCCAGGATAAACAGAGAGG - Intergenic
914490261 1:148147021-148147043 CTGCAGGAGGGGAGCCACAGTGG + Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915839506 1:159203155-159203177 CAGCAGCAAGAGGACCAGAAAGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916993300 1:170267934-170267956 CTGCTGCAGGAGAATGGGAGAGG + Intergenic
917166512 1:172118742-172118764 AGGCATCAGGAGAGCCAGAGTGG + Intronic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
917732185 1:177885896-177885918 TTGCAGCAGGAGCATCATAGAGG - Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919263884 1:195237282-195237304 CTGCAGTAGGAGAGGCACAGCGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919831755 1:201546173-201546195 CTGGGGAAGGAGAGCCAGAGGGG - Intergenic
920882520 1:209893810-209893832 GAGCAGCAAGAGAACCAGTGTGG - Intergenic
921065457 1:211619455-211619477 CTCTAGCTGGAGAACCAAAGAGG + Intergenic
921069352 1:211645967-211645989 CTGAGGCAGGAGAATCACAGAGG - Intergenic
921307775 1:213814260-213814282 TTGGAGCAGGACAACCTGAGGGG + Intergenic
921390277 1:214608192-214608214 CTGCAGGAGGGGAGCCACAGTGG - Intronic
921453736 1:215341545-215341567 GTGCGGCAGGAGTACGAGAGAGG - Intergenic
922531583 1:226349260-226349282 CTGCAGCAGGTGAGCCCCAGGGG - Intergenic
922819766 1:228476264-228476286 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
922926077 1:229347648-229347670 CAGCCCCAGGAGAACCACAGGGG - Intergenic
923067958 1:230537630-230537652 CAGCAGGGGGAGTACCAGAGAGG - Intergenic
923273826 1:232379931-232379953 CAGCAGCAGAAGGACCACAGGGG - Intergenic
923391820 1:233519937-233519959 ATGCAGCACAAGAAGCAGAGAGG - Intergenic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924152749 1:241145247-241145269 CTGAAGCGGGAGAATCACAGGGG - Intronic
924501292 1:244640841-244640863 CCAGAGCAGCAGAACCAGAGGGG + Intronic
924857323 1:247886783-247886805 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1062784246 10:248622-248644 CTGCAGCAGGGCACCCACAGTGG - Intronic
1062970653 10:1645762-1645784 CTCCAGGAGGAGAGGCAGAGGGG - Intronic
1063042407 10:2356755-2356777 CTGAAGCAGGAGAATCACAGAGG + Intergenic
1063122790 10:3116306-3116328 CTGCAGGAGGAGAACCCGTGGGG - Intronic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064329698 10:14382028-14382050 CTCCAGCACGTGAAACAGAGTGG + Intronic
1064439808 10:15343513-15343535 CTGGGACAGGAGAACCAGAGAGG + Intronic
1065199941 10:23302820-23302842 CTGCAACAGGAAAAACTGAGGGG + Intronic
1065505711 10:26428290-26428312 CAGCAGGAGGAGAACCAGAAAGG - Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1066115380 10:32234172-32234194 CTGAGGCAGGAGAATCAGGGAGG + Intergenic
1066360248 10:34723243-34723265 CTGCGGCAGGAGAACCTAGGAGG + Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067723210 10:48745786-48745808 CTACAGCAGGAAAACTAGATGGG - Intronic
1067764665 10:49075855-49075877 TAGCAGCAGGAGATCCAAAGTGG + Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068601777 10:58964393-58964415 CTGCAGAAGGAGAACCAAACAGG - Intergenic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069412482 10:68167917-68167939 CTGCAGGAGAAGAACTAGAGAGG + Intronic
1069732826 10:70630522-70630544 CTGCGGCAGGAGAATCAGGCAGG - Intergenic
1069831310 10:71283979-71284001 CTCCTGCAGGAGAACAAGATGGG - Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070228108 10:74532800-74532822 CTGAGGCAGGAGAACCCGGGAGG + Intronic
1070827105 10:79397702-79397724 CTGCAGAACCAGATCCAGAGTGG - Intronic
1070903176 10:80048700-80048722 CAGCAGCAGGAGGAACAGAAAGG - Intergenic
1071052823 10:81472885-81472907 CTGCAGCAGCAGCGCCAGATGGG - Intergenic
1071547142 10:86537346-86537368 CTGCATCAGGAGACCCACTGCGG - Intergenic
1072568504 10:96638257-96638279 CAAGAGCAGGAGAGCCAGAGAGG - Intronic
1073061225 10:100735069-100735091 CTGGAGCAGGAGAACCTGTGAGG + Intergenic
1073932049 10:108587243-108587265 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
1074108563 10:110406750-110406772 CTCCACCAGGAGCTCCAGAGAGG + Intergenic
1075310540 10:121410190-121410212 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1076246132 10:128949106-128949128 CTTCAGCAGGAGGACCAGGAGGG + Intergenic
1076509264 10:131000489-131000511 CTGGATCAGGAGGCCCAGAGAGG - Intergenic
1076613945 10:131744001-131744023 CTGCAGCTGGAGAAGCAACGGGG - Intergenic
1076781388 10:132726688-132726710 CTGCTGCAGGGGAACCTCAGTGG - Intronic
1077849411 11:6060870-6060892 CTACAGAAGGTGAAGCAGAGGGG + Intergenic
1077898622 11:6473219-6473241 AGGCTACAGGAGAACCAGAGGGG + Intronic
1078100900 11:8329639-8329661 CTACACCAGGAGGCCCAGAGGGG + Intergenic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1080105231 11:28504681-28504703 CTACAGCAGCAGAGCCAGCGTGG + Intergenic
1080408841 11:32004410-32004432 CATCAGCAGGAGTGCCAGAGGGG + Intronic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081928643 11:46852115-46852137 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1082277384 11:50236704-50236726 CGGAAGCAGGAGAACCTGGGAGG + Intergenic
1083490043 11:63009318-63009340 CAGCTGCTGGAGAAGCAGAGAGG - Intronic
1083657323 11:64235763-64235785 CAGCTGCAGGAAAACCAGTGAGG + Intronic
1084093414 11:66894265-66894287 CTGCAGCTGGAGAATCCGGGAGG - Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085635808 11:78158762-78158784 CTGCAGCAGAGGCAACAGAGAGG - Intergenic
1085822062 11:79804110-79804132 CTGAGGCAGGAGAATCAGACAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1088473923 11:110215810-110215832 CTGCCGAAGGACAACCACAGTGG - Intronic
1088483962 11:110323476-110323498 CTGGAGAAGTTGAACCAGAGAGG + Intergenic
1088681991 11:112251483-112251505 CTGAGGCAGGAGAACCCGGGAGG + Intronic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089259818 11:117216527-117216549 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1090705145 11:129329530-129329552 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1090785616 11:130044780-130044802 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1090845662 11:130527979-130528001 CTGCAGCAGGAGGATAAAAGAGG + Intergenic
1091616540 12:2054202-2054224 CTACAGAGGGGGAACCAGAGGGG - Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092453386 12:8624453-8624475 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093559457 12:20520914-20520936 CTGAGGGAGGAGATCCAGAGGGG + Intronic
1094219027 12:27973913-27973935 CTGAAGCAGGAGGCCCAGAGAGG + Intergenic
1094472332 12:30815057-30815079 CTGAAGCAGGAGAATCAGTTGGG - Intergenic
1094715104 12:33005999-33006021 CTGCAGAAAGAGAGGCAGAGTGG - Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1096647088 12:53044754-53044776 CAGCAGCAGGAGCTTCAGAGAGG - Intergenic
1096657686 12:53101981-53102003 TTCCAGCAGGAGAATGAGAGGGG - Intronic
1097242210 12:57583273-57583295 CAGCAGCAGGAAAACCAAAGAGG - Intronic
1097316095 12:58172930-58172952 CTGCCCTAGGAGAACCAGTGGGG - Intergenic
1097726249 12:63078757-63078779 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1100389750 12:94138093-94138115 CTGCAACAGAACAACCAGGGAGG + Intergenic
1101311125 12:103580314-103580336 ATGAAGCAGAGGAACCAGAGAGG + Intergenic
1101315085 12:103621631-103621653 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1102510916 12:113414845-113414867 GTGCAGCAGGAACAGCAGAGAGG - Intronic
1102564059 12:113783116-113783138 CTGCAGGAGGAGAAGTGGAGAGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103290972 12:119845849-119845871 CTGAGGCAGGAGAACCCGGGAGG + Intronic
1103764266 12:123270435-123270457 CTCGAGCAGGAGAGCCAGCGTGG + Intronic
1104384493 12:128338733-128338755 CTGCAGAAGGAAAACAAGAAAGG - Intronic
1104808774 12:131607209-131607231 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1104942382 12:132401087-132401109 CTCCTGCAGGAGAACCTGAGTGG + Intergenic
1105532845 13:21235678-21235700 CTGAGGCAGGAGAACCCGGGAGG + Intergenic
1108180303 13:47834014-47834036 CTCCACCAGGATCACCAGAGAGG + Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109205597 13:59479512-59479534 ATGCAAGAGGAGAACAAGAGAGG + Intergenic
1109285403 13:60402785-60402807 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109979751 13:69892457-69892479 CTAGAGCAGGAAAAGCAGAGAGG - Intronic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1112041454 13:95552524-95552546 CTGCAGATGGAGAACCCGGGGGG + Intronic
1112783743 13:102929524-102929546 CTTCAGTAGGTGAACAAGAGGGG + Intergenic
1113191125 13:107747392-107747414 CTGCTGGATGAGAACCATAGTGG - Intronic
1114449915 14:22818690-22818712 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114799456 14:25756854-25756876 ATGCAGCAGGAGAACTAAATAGG - Intergenic
1115152711 14:30303744-30303766 ATGCTGCAGGAGAATGAGAGTGG - Intergenic
1115494044 14:33984987-33985009 CTGAGGCAGGAGAATCAGACAGG + Intronic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1116246565 14:42421633-42421655 TGGGAGCTGGAGAACCAGAGAGG - Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117689307 14:58289836-58289858 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1117994513 14:61466462-61466484 CTCCAGGAGGAGAACCGAAGGGG - Intronic
1118128824 14:62939286-62939308 CTGAAGAAGGAGAGCCACAGAGG - Intronic
1118970057 14:70628613-70628635 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1119536062 14:75403261-75403283 GTGCAGAAGGAGCTCCAGAGTGG + Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1119788756 14:77330987-77331009 ATGCAGCAGGGGGAGCAGAGAGG - Intronic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1123984457 15:25632848-25632870 CTGCAGAGGGAGAGGCAGAGTGG + Intergenic
1124371385 15:29106607-29106629 CTGCAGCTGGAGAAGCACAAGGG + Exonic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1126815401 15:52448770-52448792 CTGGAGCATGAGGACAAGAGAGG - Intronic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127341280 15:58047007-58047029 TTGCAACAGGAAAACAAGAGAGG + Intronic
1127533471 15:59867547-59867569 CTGCCTGAGGAGATCCAGAGTGG - Intergenic
1127965851 15:63922459-63922481 CTGCAGAAGGGGACCCTGAGGGG + Intronic
1128017577 15:64360790-64360812 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128520780 15:68373357-68373379 CTGCAGCAGGAGCAACTGTGGGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129354874 15:74983472-74983494 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1129911067 15:79226853-79226875 CTGAAGCAGGAAGACCAGTGAGG - Intergenic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1131168317 15:90158833-90158855 CTGAAGCAGAAAAGCCAGAGGGG - Intergenic
1131654426 15:94440907-94440929 CAGGAGCAGGAGAGTCAGAGTGG - Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132118429 15:99156170-99156192 CTGGCGCAGGGGAACCACAGTGG - Exonic
1132156360 15:99498389-99498411 CTGCAGCTGGAGGCCAAGAGAGG - Intergenic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1132921975 16:2400662-2400684 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1133042869 16:3069751-3069773 TGGCAGCAGGAGAAGCAGGGTGG + Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133219126 16:4311264-4311286 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1133359999 16:5166662-5166684 CTGCAGAAGGAGGCCCAGGGAGG + Intergenic
1133803266 16:9102020-9102042 CTGAAGCAGGAGAACCCTGGAGG + Intronic
1133936033 16:10270122-10270144 TTGCAGTAGGAGAACGAGATTGG - Intergenic
1134528514 16:14963585-14963607 CTGCTGCAAGACCACCAGAGGGG + Intergenic
1134635350 16:15787570-15787592 CTGAGGCAGGAGAACCAGGGAGG - Intronic
1135291766 16:21245561-21245583 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1135911713 16:26567338-26567360 CTGAAGCAGGAGCCCCAGACTGG + Intergenic
1136025516 16:27465780-27465802 CTTGAGCAGGAGAATCACAGTGG - Intronic
1136071677 16:27791296-27791318 CTGCTGCAAGACCACCAGAGTGG - Exonic
1139156690 16:64451910-64451932 CTGCAGCAGGTACAACAGAGGGG - Intergenic
1139220147 16:65173313-65173335 ATGCAGCAGTAAAAACAGAGTGG - Intergenic
1139961224 16:70718635-70718657 CTGAGCCAGGAGAACCACAGGGG - Intronic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141183780 16:81772717-81772739 CTGAGGCAGGATAACCAGGGAGG + Intronic
1141830586 16:86508199-86508221 CTGCACGCGGAGACCCAGAGAGG + Intergenic
1142842648 17:2645701-2645723 CTGAGGCAGGAGAACCCAAGAGG - Intronic
1143145765 17:4774120-4774142 CTGAGGCAGGAGAACCCGGGAGG + Intronic
1143669129 17:8384200-8384222 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
1143704639 17:8687794-8687816 AAGCAGGAGGAGAGCCAGAGTGG + Intergenic
1144086635 17:11815099-11815121 TTGCAGCTGGAGAACCAAACCGG - Intronic
1144201086 17:12943366-12943388 GGGAAGCAGGAGAACCAGACAGG - Intronic
1144308596 17:13992067-13992089 CTGCAGTAGGAACAGCAGAGGGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145190853 17:20841624-20841646 CTGCAGGAGGGGAGCCACAGTGG + Intronic
1146260021 17:31415011-31415033 CTCCAGCAGGGGAAGCAGGGAGG + Intronic
1146540301 17:33687682-33687704 CTGCAGCCAGAGAATAAGAGAGG + Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1147656932 17:42096418-42096440 TGGCAGCAGGAGGGCCAGAGTGG + Intergenic
1147878690 17:43639848-43639870 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1148568663 17:48648859-48648881 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1148647168 17:49225714-49225736 GGGCAGCAGGAGAAGCAGTGGGG + Intronic
1150210524 17:63438851-63438873 CGGCAGGAGGAGAACAAGCGGGG + Intronic
1150559188 17:66280500-66280522 CTGAGGCAGGAGAACCCGAGAGG - Intergenic
1151114831 17:71724075-71724097 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1151139487 17:71977795-71977817 CTGCAGCAGCTGTACCAGACTGG + Intergenic
1151390470 17:73783775-73783797 CTGAATTAGGAGACCCAGAGGGG + Intergenic
1151738458 17:75961668-75961690 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152339122 17:79714742-79714764 CTGCTGAAGGGAAACCAGAGAGG - Intergenic
1152344509 17:79742991-79743013 CTGAAGCAGGAGACCCGGGGTGG - Intergenic
1152667949 17:81582199-81582221 CTGCAGCAGCACAACCAGGAGGG + Intronic
1153310518 18:3673244-3673266 GTGCCGCAGGAGGACCAGGGAGG - Intronic
1153411966 18:4803277-4803299 CTGCAGCAGCAGGGCAAGAGTGG + Intergenic
1153501245 18:5752158-5752180 CTGCAGCAGGAGAACTTGTGAGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155964606 18:32024290-32024312 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1157474152 18:48010815-48010837 CAGCAGGAGGAGGACCCGAGTGG + Intergenic
1158918379 18:62160604-62160626 CTGAGGCAGGAGAACCTGCGAGG - Intronic
1160037663 18:75316638-75316660 GTGCAGCTGGAAAACCAAAGAGG - Intergenic
1160995351 19:1879799-1879821 CTGCAGGAGGGGAGCCACAGTGG - Intronic
1161469131 19:4447677-4447699 CTGGAGCAGGAGGCACAGAGGGG - Intronic
1161575284 19:5051474-5051496 CTGCAGCAGGGAAGCCAGATGGG + Intronic
1163770699 19:19189350-19189372 TGGCAGCAGGGGAAGCAGAGAGG - Intronic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164532618 19:29059813-29059835 CTGCAGCAGGAGAAACACTCGGG + Intergenic
1165438480 19:35810167-35810189 CTGAAGCAGGAGAACCCGGGAGG + Intronic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1166374741 19:42321312-42321334 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1166851263 19:45762545-45762567 CTGAGGCAGGAGAATCTGAGAGG - Intronic
1167296387 19:48652674-48652696 CTGAGGCAGGAGAACCTGTGAGG + Intergenic
1167360180 19:49025910-49025932 CTCCAGCAGGAAGACCAGAGGGG + Intronic
1167360905 19:49029871-49029893 CTCCAGCAGGAAGACCAGAGGGG - Intronic
1167362747 19:49038926-49038948 CTCCAGCAGGAAGACCAGAGGGG + Intergenic
1167363388 19:49042262-49042284 CTCCAGCAGGAAGACCAGAGGGG - Intergenic
1167365106 19:49050665-49050687 CTGCAGCAGGAAGACCAGAGGGG + Intergenic
1167367356 19:49061809-49061831 CTCCAGCAGGAAGAGCAGAGGGG + Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1168265452 19:55221278-55221300 CTGCAGCAGAAGAACTAAAATGG + Intergenic
925407734 2:3616658-3616680 CTGAGGCAGGAGAACCAGGCAGG + Intronic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
925991271 2:9256908-9256930 CTGCAGCAGGAGGATCAGGAAGG - Intronic
926201481 2:10802765-10802787 CTGCAGCAGGAAGGGCAGAGGGG - Intronic
926610314 2:14940341-14940363 CTGGAGCAGGAGGAAAAGAGAGG - Intergenic
926888240 2:17617191-17617213 CTTCAGCAGGAGAGCTTGAGAGG + Intronic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
927275959 2:21262695-21262717 CCGCAGCAGCAGGACAAGAGGGG + Intergenic
927638896 2:24834554-24834576 GTGGAGAAGGAGAAGCAGAGTGG - Exonic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928032780 2:27795929-27795951 AGGCAGCAGGAGAAACAGAGGGG - Intronic
928606397 2:32947751-32947773 GTGCCGCAGGAGACCCAGAGCGG + Exonic
929122798 2:38497145-38497167 CTGGAGCAGGAGAACAGGAGAGG + Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929402908 2:41606292-41606314 CTGCCCCAGGTGAACCTGAGGGG - Intergenic
929421148 2:41790928-41790950 ATCCATTAGGAGAACCAGAGAGG - Intergenic
929464299 2:42130902-42130924 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
929518046 2:42622305-42622327 CTGAGGCAGGAGAATCAGACAGG + Intronic
929797633 2:45072318-45072340 TGGCAGGAGGAGAACCTGAGTGG + Intergenic
929889341 2:45906368-45906390 CTGCAGCTGAAGATCCACAGGGG - Intronic
930893179 2:56414861-56414883 CTGAGGCAGGAGGACCTGAGAGG - Intergenic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
931003108 2:57812710-57812732 CTGAGGCAGGAGAACCCGGGAGG + Intergenic
931345299 2:61440302-61440324 CTCCAGCAGGACCACCAGGGAGG - Intronic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932734728 2:74246718-74246740 CTGCAGCAGGAACCCCTGAGTGG + Intronic
933522874 2:83394898-83394920 CTGCAGCAATAGACCCAGAATGG + Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
934673137 2:96229612-96229634 CTGAAGCAGGAGGACCACTGGGG - Intergenic
934978028 2:98819498-98819520 CTGCAGTAGGATAATCAGTGCGG - Intronic
936260734 2:110957958-110957980 CTGAGGCAGGAGAACCTGGGAGG + Intronic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938797527 2:134730883-134730905 CTGGAGCAGGAGCAAAAGAGAGG - Intergenic
939666625 2:144960703-144960725 CTGCAGCAGTTGAAGCATAGAGG + Intergenic
939989111 2:148860739-148860761 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
940449962 2:153824834-153824856 CTGGAGCAGGAGGGACAGAGAGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941930487 2:170934356-170934378 CTGAGGCAGGAGAACCCGGGAGG - Intronic
942621186 2:177845919-177845941 CTGAGGCAGGAGAATCAGACAGG + Intronic
942870661 2:180730728-180730750 CTGCAGCAGGAGAGCCTATGTGG + Intergenic
943436094 2:187867404-187867426 GTGCAGCTGGAGACCCGGAGAGG - Intergenic
943436201 2:187868147-187868169 GTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436208 2:187868197-187868219 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
943436222 2:187868291-187868313 GTGCAGCTGGAGACCCGGAGAGG - Intergenic
943436235 2:187868391-187868413 GTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436253 2:187868538-187868560 ATGCAGCTGGAGACCCAGAGAGG - Intergenic
943436258 2:187868588-187868610 ATGGAGCTGGAGAGCCAGAGAGG - Intergenic
943436278 2:187868735-187868757 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436293 2:187868829-187868851 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436307 2:187868923-187868945 CTGCAGCTGGAGAACCGGAAAGG - Intergenic
943436327 2:187869072-187869094 TTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436346 2:187869219-187869241 CTGCAGCTGAAGACCCGGAGAGG - Intergenic
944215797 2:197254292-197254314 CTGAGGCAGGAGAACCTGGGAGG + Intronic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945984083 2:216340397-216340419 CTGCAGGAGGAGAGCCAGGGAGG - Intronic
947461223 2:230306367-230306389 CTGCTGCAGGAGACACAGAGAGG + Intronic
947735538 2:232452724-232452746 CTGAGGCAGGAGAACCCGGGAGG + Intergenic
948612353 2:239178042-239178064 CTGGAGCATGCGAACGAGAGCGG - Intronic
948918100 2:241048475-241048497 CTGGGGCAGGAGACCCAGGGAGG + Intronic
948930042 2:241126240-241126262 CTGCAGCGGGAGATCCAGGAGGG - Exonic
948995441 2:241576024-241576046 CTGCAGTGGGAGAAGGAGAGTGG - Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
949070455 2:242021269-242021291 ATGCAGCTGGAGACCCTGAGGGG + Intergenic
949071050 2:242024475-242024497 GTGCAGCTGGAGATCCAGGGAGG + Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1170671019 20:18433676-18433698 CTGCAGCTGTAGAGCAAGAGGGG + Exonic
1170735244 20:19008648-19008670 CAGCAGCAAGAGAGCCAGGGAGG - Intergenic
1171467856 20:25343703-25343725 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1171470436 20:25366363-25366385 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1172224363 20:33295505-33295527 ATGAGGCAGGAGAATCAGAGAGG + Intronic
1172279797 20:33700873-33700895 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1172300859 20:33849125-33849147 CTACAGCCGGAGAGCAAGAGAGG - Intronic
1172630817 20:36377049-36377071 CTGGAGAAGGGAAACCAGAGAGG + Intronic
1172735671 20:37125316-37125338 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1172795966 20:37537829-37537851 CTTCATCAGGAGAACCAGGTAGG - Intergenic
1173345864 20:42199353-42199375 AAGCAGAAGGAGACCCAGAGTGG - Exonic
1173358527 20:42318527-42318549 CTTCAGCAGGAGAGCCCAAGAGG - Intronic
1173466085 20:43282497-43282519 CTGGAGCAGAAGAAACAAAGAGG + Intergenic
1173470924 20:43323043-43323065 CTGCAGTCAGAGAACCAGAGAGG + Intergenic
1173906079 20:46630479-46630501 CTGCAGAAGGAAATCAAGAGTGG - Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174100237 20:48121646-48121668 GTGGAGCTGGAGAACCAGAGGGG - Intergenic
1174149022 20:48473092-48473114 GTGGAGCTGGAGACCCAGAGAGG - Intergenic
1174149048 20:48473250-48473272 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
1174149086 20:48473501-48473523 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
1174149204 20:48474279-48474301 GTGAAGCTGGAGAACCAGGGAGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175633915 20:60564802-60564824 CTGCAGAGGGAGGACCAGTGTGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1176081366 20:63274950-63274972 CTGCTGCAGGACAAGGAGAGTGG - Intronic
1177169163 21:17637206-17637228 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178570880 21:33735904-33735926 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1179339148 21:40488011-40488033 CTGGTTCAGGAGATCCAGAGAGG + Intronic
1180039336 21:45268090-45268112 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1181121426 22:20670339-20670361 CTGCAGGAGGGGAGCCACAGTGG - Intergenic
1181334385 22:22117363-22117385 CTGCAGGAGGGGAGCCACAGTGG - Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1182302211 22:29343287-29343309 CTGCAGCAGGAGGGCAGGAGTGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183161249 22:36114794-36114816 CTGCAGCAGGTGCAGCAGAAGGG - Intergenic
1183271453 22:36865081-36865103 CTGCAGCAGCAGGACGGGAGTGG - Intronic
1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG + Intronic
1183630163 22:39027752-39027774 GAGCAGCAGAGGAACCAGAGGGG - Intronic
1183633593 22:39047621-39047643 GAGCAGCAGAGGAACCAGAGGGG - Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185032254 22:48450281-48450303 CTGGAGCTGGGGAAGCAGAGAGG + Intergenic
1185273073 22:49937510-49937532 CTGCCACAGGAGACCCAGTGAGG - Intergenic
949158916 3:858044-858066 GTGCAGCTGGAGACCCAGGGAGG - Intergenic
949159153 3:859560-859582 GTGCAGCAGAAGACCCACAGAGG - Intergenic
949159239 3:860193-860215 CAGCAGCTAGAGACCCAGAGAGG - Intergenic
949159279 3:860535-860557 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
949159307 3:860782-860804 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
949159315 3:860832-860854 TTTCAGCTGGAGACCCAGAGAGG - Intergenic
949159326 3:860931-860953 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
949159351 3:861130-861152 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
949362219 3:3244097-3244119 TTGCATCTGGAGAACCTGAGGGG - Intergenic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
949875453 3:8623535-8623557 CTGCAGCAGGTGAGCCAGGGCGG - Exonic
950380178 3:12606628-12606650 CTGAGGCAGGAGAACCCGGGAGG - Intronic
951817647 3:26772509-26772531 CTGCGGCACGAGAACCTGGGAGG + Intergenic
952988677 3:38811866-38811888 CTGGAGCAGGGGAAACAGTGAGG + Intergenic
953358770 3:42276938-42276960 CAGCTGCAGGTGAACCAGAGTGG + Intergenic
954222796 3:49164943-49164965 CAGCAGCTGGAGAAACAGATGGG - Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954809346 3:53238554-53238576 CTGCAGCAGAAGTGCCATAGTGG - Intronic
956212217 3:66813834-66813856 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
956507867 3:69961633-69961655 CTGAGGCAGGAGAACCCGGGAGG + Intronic
957063198 3:75498912-75498934 CTGCAGCTGGAGGGCCAGATGGG - Intergenic
957911290 3:86622482-86622504 CTGTTGCAAGTGAACCAGAGAGG - Intergenic
960680295 3:120240723-120240745 CTGAGGCAGGAGAACCCGGGAGG - Intronic
960731042 3:120726710-120726732 CTCCAGCCGGAGCAACAGAGTGG + Intronic
960927790 3:122813149-122813171 CTGAAGCAGGAGAATCCGGGAGG + Intronic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
961364006 3:126388020-126388042 CTGAGGCAGGAGAACCCGGGAGG + Intergenic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961763585 3:129190137-129190159 CTGAGGCAGGAGAATCAGAGCGG + Intergenic
961811235 3:129523100-129523122 CTGCAGGGGGAGAATCAGGGAGG - Intergenic
962103258 3:132364651-132364673 GTCTAGCAGGAGAACCAGAAAGG - Intronic
963145361 3:141988502-141988524 CTGAGGCAGGAGAACTAGAGGGG - Intronic
963296016 3:143547622-143547644 CTGGGGCAGGAGAACCAATGTGG - Intronic
963862464 3:150325220-150325242 CTGCAGCAGGTGGACAAAAGAGG - Intergenic
964780778 3:160335318-160335340 CTGAGGCAGGAGAACCTGGGAGG - Intronic
965346097 3:167552490-167552512 GTGAAGAGGGAGAACCAGAGTGG + Intronic
965349815 3:167598549-167598571 TGGCAGCAGGAGAAAGAGAGTGG - Intronic
966639738 3:182176617-182176639 CTCCAGCTGGAGATCCAGAGGGG - Intergenic
966967077 3:185004379-185004401 CTGAGGCAGGAGAACCAGGCAGG + Intronic
968049768 3:195646565-195646587 GTGCAGCTGGAGAACCAGACAGG + Intergenic
968049880 3:195647245-195647267 GTGCAGCTGGAGACCCAGTGGGG - Intergenic
968073017 3:195799397-195799419 CTGAAGCAGGAGAATCACGGAGG - Intronic
968097529 3:195942024-195942046 GTGCAGCTGGAGAACCAGACAGG - Intergenic
968105559 3:195999165-195999187 CTGCAGCTGGAGACCCGGGGAGG - Intergenic
968105743 3:196000065-196000087 GTGCAGCTGGAGACCCAGCGGGG - Intergenic
968105750 3:196000111-196000133 GTGCAGCTGGAGACCCAGGGGGG - Intergenic
968105975 3:196001312-196001334 GTGCAGCTGGAGAACCAGACAGG - Intergenic
968106108 3:196002434-196002456 TTGCAGCTGCAGATCCAGAGAGG - Intergenic
968106394 3:196004700-196004722 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
968201983 3:196762585-196762607 CTGAGGCAGGAGAATCAGACAGG + Intronic
968303835 3:197636747-197636769 CTGCAGCTGGAGACCCGGGGAGG - Intergenic
968304319 3:197639065-197639087 GTGCAGCTGGAGACCCAGGGAGG - Intergenic
968304367 3:197639417-197639439 ATGCAGCTGGAGAACCAGACAGG - Intergenic
968879248 4:3290765-3290787 CTACAGGAGGAGAACCACAGGGG + Intergenic
969257479 4:6011969-6011991 CTGCAGCATGAAAAGCAGGGAGG + Intergenic
971223786 4:24732991-24733013 CTGCAGGTGGAGGACCAGATAGG + Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
971937826 4:33175555-33175577 CTGAGGCACGAGAACCAGGGAGG + Intergenic
972619475 4:40733060-40733082 CTAAACCAGGAGAACCAGAAAGG - Intergenic
972939595 4:44181342-44181364 CTGAGGCAGGAGAACCAGGCAGG - Intronic
973274117 4:48291052-48291074 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
973615303 4:52672016-52672038 CTGACGCAGGAGAACCTGGGAGG + Intergenic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
974683636 4:65195710-65195732 CTGCTGCAGGGAAAACAGAGAGG - Intergenic
975968437 4:80004068-80004090 ATGCAGCAGTAAAAACAGAGTGG + Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
977449545 4:97177138-97177160 ATGCATCAGGAGAATTAGAGGGG + Intergenic
978398631 4:108308574-108308596 CTGGAGCAGGATATCCATAGTGG + Intergenic
978643265 4:110896632-110896654 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
978741082 4:112138745-112138767 CTGCAGGAGGACAACCATATAGG - Intergenic
978959798 4:114662913-114662935 CTGAGGCAGGAGAACCTGGGAGG - Intronic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
979779016 4:124625802-124625824 CTGCTGCAGGAGATGAAGAGTGG + Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
982271913 4:153599189-153599211 CTAAAGCAGGAGCACGAGAGGGG + Intronic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
983939205 4:173523574-173523596 AAGTAGCAGGAGAACAAGAGAGG - Intergenic
984613358 4:181867002-181867024 CTGTAGCAGGGGAATCAGTGTGG - Intergenic
985168428 4:187122715-187122737 CTGCAGGAGTAAAACTAGAGAGG - Intergenic
985506163 5:281738-281760 CTACAGCTGGAGATCCGGAGAGG + Intronic
985506168 5:281785-281807 GTGCAGCTGGAGAACCAGACAGG + Intronic
985506196 5:282022-282044 CTGCAGCTGGAGATACAGATAGG + Intronic
985506256 5:282449-282471 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506353 5:283393-283415 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506391 5:283722-283744 CTACAGCTGGAGAACTGGAGAGG + Intronic
985506614 5:285172-285194 GTGCAGCTGGAGACCCAGAGGGG + Intronic
985506836 5:286264-286286 GTGCAGCTGGAGACCCAGCGGGG + Intronic
985740988 5:1617420-1617442 ATGCAGCTGGAGACCCAGCGGGG - Intergenic
985741180 5:1618341-1618363 GTGCAGCTGGAGACCCAGGGGGG - Intergenic
985741441 5:1619546-1619568 GTGCAGCTGGAGACCCAGCGGGG - Intergenic
985741632 5:1620514-1620536 TTGCAGCTGCAGACCCAGAGAGG - Intergenic
985741679 5:1620936-1620958 GTGCAGCTGGAGAACCAGACAGG - Intergenic
985741690 5:1621030-1621052 CTACAGCTGGACACCCAGAGAGG - Intergenic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
985742032 5:1623711-1623733 GTGCAGCTGCAGACCCAGAGAGG - Intergenic
985742205 5:1625004-1625026 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
986230717 5:5862724-5862746 CTGAGGCAGGAGAATCACAGAGG - Intergenic
986254252 5:6088544-6088566 CTGCAGCTGGAGACCCAGAAAGG - Intergenic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986466946 5:8035075-8035097 GAGGAGCAGGAGACCCAGAGTGG + Intergenic
986614590 5:9603218-9603240 CAGGAACAGGAGAACCAGAACGG - Intergenic
987795043 5:22616894-22616916 CTTCAGCATGAGAGGCAGAGGGG - Intronic
988065368 5:26224827-26224849 GTGCAGCTGGAGATCCAGGGAGG - Intergenic
988065506 5:26225852-26225874 GTGCAGCTTGAGACCCAGAGAGG - Intergenic
988065541 5:26226152-26226174 ATGGAGCTGGAGACCCAGAGAGG - Intergenic
988065549 5:26226202-26226224 TTTCAGCTGGAGACCCAGAGAGG - Intergenic
988065560 5:26226299-26226321 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
988065572 5:26226398-26226420 GTGCAACTGGAGACCCAGAGAGG - Intergenic
988065622 5:26226787-26226809 CTGCAGCTGGAGACCCGGAGAGG - Intergenic
988065636 5:26226887-26226909 ATGCAGCTGGAGACCCAGAGAGG - Intergenic
988065644 5:26226981-26227003 TTGCAGCTGGAGACCCAGAGAGG - Intergenic
988065655 5:26227081-26227103 ATGCAGCTGGAGACCCAGACAGG - Intergenic
988065672 5:26227228-26227250 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
988065698 5:26227428-26227450 GTGCAGCTGGAGACCCAGAGGGG - Intergenic
988273021 5:29041647-29041669 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
989633339 5:43510537-43510559 CTGAGGCAGGAGAATCAGACAGG - Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991369031 5:65899008-65899030 CTGAGGCAGGAGAATCAGGGGGG - Intergenic
991444841 5:66688489-66688511 CTGCAGAAGTTGAACTAGAGGGG + Intronic
991487215 5:67149809-67149831 CTGCATCAGGGGTACAAGAGAGG + Intronic
991910263 5:71552719-71552741 CTGAGGCAGGAGAACCAGGCAGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993344827 5:86769840-86769862 CTGGAGCAGGAGGAAAAGAGAGG + Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
995604351 5:113835373-113835395 CTGCAGCAGTAAAATCACAGGGG + Intergenic
995942507 5:117600683-117600705 CTGAGGCAGGAGAATCAGACAGG + Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996501350 5:124219743-124219765 CTGCAGAAAGAGAGACAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
997377733 5:133409341-133409363 CTGTAGCAGGTGAGCCTGAGAGG - Intronic
998318211 5:141203180-141203202 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
999105024 5:149063180-149063202 CTACAGCAGGAGGCCCAGGGAGG + Intergenic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
1000380452 5:160624300-160624322 CTGGCACAGGAGAGCCAGAGGGG + Intronic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1001425551 5:171619816-171619838 CAGCAGCTGGAGGCCCAGAGAGG - Intergenic
1002145901 5:177181126-177181148 CTGAGGCAGGAGAACCTGGGAGG - Intronic
1002671263 5:180869565-180869587 CTACAGAAGGGGAAACAGAGAGG + Intergenic
1002889150 6:1318163-1318185 GTGCAACAGGGGAACCAGAATGG - Intergenic
1003260278 6:4510526-4510548 ATGCAGCATGAGGCCCAGAGTGG + Intergenic
1003389414 6:5700494-5700516 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1003580247 6:7333698-7333720 CTCCAGCATGAGCAACAGAGTGG - Intronic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1004152337 6:13133390-13133412 CTGAGGCAGGAGAATCAGACAGG - Intronic
1004407593 6:15348766-15348788 CTGCAACAGGAGAACTAGCGTGG + Intronic
1004425086 6:15501694-15501716 GGGCAGCAGGAGACCCAGTGAGG + Intronic
1004682502 6:17909793-17909815 CTGAGGCAGGAGAACCTGGGAGG + Intronic
1004839463 6:19566360-19566382 ATGCAGCAGGAGGACATGAGGGG + Intergenic
1004997665 6:21209758-21209780 CAGCAGCAGCAGAACCTGAAAGG + Intronic
1005006296 6:21290513-21290535 CTGAGGCAGGAGAACCTGTGGGG + Intergenic
1005019849 6:21407202-21407224 ATTCAACAGGAGATCCAGAGAGG - Intergenic
1006171966 6:32098148-32098170 CAGCACCAGGAGAACCAGGCTGG + Intronic
1006532896 6:34672190-34672212 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1007389367 6:41541433-41541455 ATGGAGCAGAAGAACCACAGGGG + Intergenic
1007720530 6:43882604-43882626 ATGGAGCAGGAAAACCAGATGGG - Intergenic
1007876585 6:45110026-45110048 CTGCTGCAGGAGACCAGGAGAGG - Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008678426 6:53845746-53845768 CTGTTGCAGTAGATCCAGAGTGG + Intronic
1010474160 6:76265424-76265446 CTGTGGCAGGAGTACCAGAATGG - Intergenic
1011957648 6:93043088-93043110 CTGAATTAGGAGAACCAGTGGGG - Intergenic
1012415282 6:99006320-99006342 CTCCAGCCTGAGAAACAGAGGGG - Intergenic
1012422943 6:99084515-99084537 CTGAGGCAGGAGAACCCGGGAGG + Intergenic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013431029 6:110054914-110054936 CATCAGCTGGAGACCCAGAGAGG + Intergenic
1013531250 6:111020760-111020782 CTGATGCAGGAGAACCCGGGAGG + Intronic
1013618470 6:111866907-111866929 CAGCATCAGGAGAACTAGAGGGG - Intronic
1013630869 6:111984665-111984687 GTGCAGTAGGAGCACCTGAGCGG + Intergenic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1016802972 6:148185137-148185159 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1016804155 6:148196083-148196105 CTCCACCAGGAGGATCAGAGTGG + Intergenic
1017509537 6:155101798-155101820 CTGAGGCAGGAGAACCCGAGAGG - Intronic
1017587807 6:155946784-155946806 CTGCAGCAGGTGCTCCAGATGGG - Intergenic
1017869352 6:158473751-158473773 CTGAAGCAGGAGAATCAGTGAGG - Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1019705074 7:2493756-2493778 CTGCAGGATGAGGCCCAGAGAGG - Intergenic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020704461 7:11526702-11526724 TGGCAGCAGGAGAAAGAGAGGGG - Intronic
1020772482 7:12412123-12412145 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1021922970 7:25505653-25505675 CTGCTGCTGGAGAATGAGAGAGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022537682 7:31107939-31107961 CTGCAGCTGGGGAGCCAGGGCGG - Exonic
1024992951 7:55250762-55250784 CTGCAGCAGCCCAGCCAGAGAGG + Intronic
1025233905 7:57220784-57220806 GTGGAGCTGGAGAACCAGAGAGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1027996374 7:85430390-85430412 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1028927767 7:96378159-96378181 CAGGAGCAGGAGAGACAGAGAGG + Intergenic
1029475237 7:100779486-100779508 GAACAGCAGGAGAACCCGAGTGG + Exonic
1029650164 7:101886084-101886106 GGCCAGCAGGAGATCCAGAGAGG - Intronic
1030103807 7:105969725-105969747 CCTCAGCAGGAGATCCACAGAGG - Intronic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031198510 7:118647379-118647401 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1032433316 7:131880443-131880465 CTGCAGAGGGACAACCAAAGGGG - Intergenic
1033078608 7:138272771-138272793 CTGGAGCAGGAGGAACAGTGGGG + Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033457932 7:141519165-141519187 CTGGAGCAGGTGAACAGGAGAGG - Intergenic
1034511499 7:151539074-151539096 GTGCAGCAGGAAAACCCCAGAGG - Intergenic
1034694774 7:153043710-153043732 CTGTGGCAGGTGAGCCAGAGGGG + Intergenic
1035543203 8:458174-458196 CTGGAGGAGGAGAGCAAGAGAGG - Intronic
1037581962 8:20250695-20250717 CTGAGGCAGGAGAATCAGAGGGG - Intronic
1038397602 8:27258607-27258629 GTGGAGCTGGAGAACCAGAGGGG + Intergenic
1039228748 8:35419674-35419696 CTGCAGTAGGACAAACAGGGTGG + Intronic
1039838273 8:41275239-41275261 CTCCAGTAGGAGAGCGAGAGGGG + Intronic
1041340505 8:56840831-56840853 TTGCAGCAGGACAACCTGAAGGG + Intergenic
1042482736 8:69322562-69322584 CTACAGCTGGAGACCCAGAAAGG + Intergenic
1042482758 8:69322708-69322730 GTGCAGCTGGAGACCCGGAGAGG + Intergenic
1042482762 8:69322755-69322777 GTGCAGCTGCAGACCCAGAGAGG + Intergenic
1042482775 8:69322855-69322877 CTGCAGCTGGAGACCCAGAGAGG + Intergenic
1042482799 8:69323051-69323073 CTGCATCTGGCGAGCCAGAGAGG + Intergenic
1042482830 8:69323341-69323363 CTGCAGCTGGAGACCCAAAGAGG + Intergenic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042922566 8:73934152-73934174 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1044064644 8:87684552-87684574 GTGCTGCAGTAGAACAAGAGAGG + Intergenic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1044409220 8:91866855-91866877 CAGCAGCAGGCCATCCAGAGTGG + Intergenic
1046187155 8:110735335-110735357 CTGCAGCAGGTGCTCCAGATGGG + Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1049012035 8:139893696-139893718 CTTCAGCATGAGGAACAGAGTGG + Intronic
1049297208 8:141848517-141848539 CTGCTGCAGGAGCTCCAGGGAGG - Intergenic
1049390755 8:142369122-142369144 CTGCAGGAGGGGAAACAGTGTGG + Intronic
1049539090 8:143198923-143198945 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1049589534 8:143450652-143450674 CTGGAGCAGGAGGTCGAGAGAGG + Intronic
1049626143 8:143622506-143622528 CTCCAGCAGGGGCAACAGAGTGG + Intergenic
1051111644 9:13645150-13645172 ATGCAACAGGAGAAGCAGAAAGG - Intergenic
1056234142 9:84574817-84574839 CTGCTGCAGAAGTACTAGAGAGG + Intergenic
1057164757 9:92916766-92916788 CTGAGGCAGGAGAACCTGGGAGG + Intergenic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057728642 9:97589368-97589390 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1057986028 9:99715087-99715109 CTGAAGCAGGAGAACCTGGGAGG - Intergenic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1058774871 9:108273210-108273232 CTGCAGCAGGCGCATGAGAGTGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1059373933 9:113866974-113866996 CTGAGGCAGGAGAACCCGGGAGG - Intergenic
1060543328 9:124446493-124446515 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG + Intergenic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1060648903 9:125307164-125307186 CTGAGGCAGGAGAATCACAGTGG + Intronic
1060788424 9:126468665-126468687 CTGGAGCAGGAACACCAGGGAGG - Intronic
1061383711 9:130276049-130276071 CTGCAGGGGGAGGACCAGAAAGG + Intergenic
1061395971 9:130343482-130343504 CTGCACCTGGGGATCCAGAGGGG - Intronic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061616252 9:131781386-131781408 CTGTAGCAGTAGAACCAGCTTGG + Intergenic
1061822591 9:133236780-133236802 CTGCAGCAGGGGACCCAGTTGGG + Intergenic
1062084273 9:134640932-134640954 CTGCTGGAGGAGACCCCGAGGGG + Intergenic
1062151508 9:135021580-135021602 CTGGAGCAGGAGTCCCAGGGCGG - Intergenic
1062212929 9:135374209-135374231 CTGGAGCAGGAGAAACAGATTGG - Intergenic
1062219558 9:135407561-135407583 CTGCACCTGGAGACCCACAGTGG + Intergenic
1062449269 9:136608707-136608729 CTTCTGCAGGAGGACCAGGGAGG - Intergenic
1062500365 9:136849523-136849545 CTGCAGCCGGAGCCCCGGAGCGG - Exonic
1185766283 X:2728292-2728314 CTGAGGCAGGAGAACCCGGGAGG - Intronic
1186145175 X:6617588-6617610 CAGCAGCAAGAGAGCCAGAGGGG - Intergenic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1188191285 X:27174353-27174375 CTGAGGCAGGAGAACCTGGGAGG - Intergenic
1188375374 X:29421996-29422018 GTGCATGAGGAGAACCAGGGTGG + Intronic
1188675778 X:32937322-32937344 CTGCAGCAGGAGGAGTACAGTGG - Intronic
1189943459 X:46152549-46152571 TTGTAGCAGGAGAGCTAGAGGGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1190746110 X:53322347-53322369 GTGCAGCAGGAGGTCAAGAGGGG - Intergenic
1190914479 X:54800462-54800484 CTGAAGCAGGAGGACCAGTAAGG - Intergenic
1191128038 X:56978725-56978747 CTGGAGCAGAAGATCCTGAGAGG + Intronic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1196748474 X:119093272-119093294 CCTCAGCAGCAGAACCAGAAAGG - Intronic
1196804469 X:119572340-119572362 CAGCAACAGCAGAACCAGAACGG - Intergenic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1197710217 X:129660676-129660698 AGGCAGCAGGAGAAAGAGAGAGG + Intergenic
1197730990 X:129809897-129809919 CTGAGGCAGGAGAACCCGGGAGG + Intronic
1200958670 Y:8975590-8975612 CTGAGGCAGGAGAACCTGGGAGG - Intergenic