ID: 1111736181

View in Genome Browser
Species Human (GRCh38)
Location 13:92141998-92142020
Sequence CATTCCAAGCATGAGATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111736181_1111736184 11 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736184 13:92142032-92142054 GTGATAGTCAGAGGAAACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 177
1111736181_1111736191 26 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736191 13:92142047-92142069 AACTTTGGGGGACAGTGGGAGGG 0: 1
1: 0
2: 22
3: 166
4: 616
1111736181_1111736187 14 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736187 13:92142035-92142057 ATAGTCAGAGGAAACTTTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 225
1111736181_1111736183 2 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736183 13:92142023-92142045 TAACTTCTGGTGATAGTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 111
1111736181_1111736188 21 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736188 13:92142042-92142064 GAGGAAACTTTGGGGGACAGTGG 0: 1
1: 0
2: 1
3: 43
4: 436
1111736181_1111736189 22 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736189 13:92142043-92142065 AGGAAACTTTGGGGGACAGTGGG 0: 1
1: 0
2: 1
3: 41
4: 559
1111736181_1111736190 25 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736190 13:92142046-92142068 AAACTTTGGGGGACAGTGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 454
1111736181_1111736186 13 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736186 13:92142034-92142056 GATAGTCAGAGGAAACTTTGGGG 0: 1
1: 0
2: 2
3: 23
4: 189
1111736181_1111736185 12 Left 1111736181 13:92141998-92142020 CCTCACATCTCATGCTTGGAATG 0: 1
1: 0
2: 0
3: 19
4: 168
Right 1111736185 13:92142033-92142055 TGATAGTCAGAGGAAACTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111736181 Original CRISPR CATTCCAAGCATGAGATGTG AGG (reversed) Intronic
901558292 1:10049015-10049037 CATTCCTAGCATGAGGTTTTGGG + Intronic
901939300 1:12649732-12649754 TAGTCCAAGGATGAGGTGTGAGG - Intronic
902805819 1:18860690-18860712 CATTCCAGCCATGTGGTGTGTGG - Intronic
903711288 1:25326650-25326672 CATTCCAAGCAAGAGGAGGGGGG + Intronic
903715660 1:25364779-25364801 CATTCCAAGCAAGAGGAGGGGGG - Intronic
905262082 1:36726844-36726866 CATTCCAGGCATGAGGAATGAGG - Intergenic
906730077 1:48073446-48073468 CATTCCAGGAATGAGTTTTGAGG - Intergenic
907685835 1:56610098-56610120 GCTTCCAAGCATGTGATGGGTGG + Intronic
909809823 1:79918771-79918793 CAGTGGAAGCAGGAGATGTGTGG + Intergenic
911401560 1:97381432-97381454 CATGCCAAGCATGGGCTCTGTGG + Intronic
911630952 1:100183049-100183071 CATTACGAGGCTGAGATGTGTGG + Intergenic
912831929 1:112960281-112960303 CATGCCAATCATTAGATGGGAGG - Intergenic
913392406 1:118329280-118329302 CATTCTAAGCTTCAGAGGTGTGG + Intergenic
915499831 1:156307925-156307947 CTTTGCAAGGATGAGATGGGTGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917858358 1:179120874-179120896 CATTCAAAGCCTGAGATATCTGG - Intronic
918651716 1:186972998-186973020 CAGTCCAAGCATTAGCTTTGTGG + Intronic
921322351 1:213954120-213954142 CATAGCATGCATGAGGTGTGCGG - Intergenic
924071571 1:240285556-240285578 CATTCCAAAAATGAGAGGTTAGG + Intronic
924091269 1:240503602-240503624 CATTTCAAGCATAAGGTGTAAGG - Intronic
924530840 1:244892426-244892448 CATTTCAAGTATGTAATGTGGGG + Intergenic
1063520832 10:6739220-6739242 CATCCCACACATGAGCTGTGGGG + Intergenic
1066043908 10:31579910-31579932 CATTGCAAAAATGACATGTGTGG + Intergenic
1069378850 10:67821731-67821753 CAATCCAAGCATGAAATGATGGG + Intronic
1069987067 10:72291808-72291830 GATCCCCAGCAGGAGATGTGGGG - Intergenic
1070449093 10:76539627-76539649 CATTCCAATCTTGAGATGAGTGG - Intronic
1075324653 10:121521341-121521363 CTTTCCAGGCATAAGATGAGAGG - Intronic
1075484866 10:122813977-122813999 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484885 10:122814057-122814079 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075484904 10:122814137-122814159 CAGGCCAAGCAGGAGAGGTGCGG - Intergenic
1075987617 10:126801087-126801109 CTTTCCCAGCATGAGATCTATGG + Intergenic
1078427984 11:11266744-11266766 AATTACAAGCAAGAGATGTAAGG - Intergenic
1079305055 11:19314632-19314654 AATTCCATGCATGAGATGGGAGG - Intergenic
1081591581 11:44426861-44426883 GATCCCAAGCATCAGATGAGAGG - Intergenic
1081887219 11:46508140-46508162 CACTCCAAGCTTGAGAGGAGAGG + Intronic
1083528357 11:63394208-63394230 CGTTCTTAGCTTGAGATGTGAGG + Intronic
1084461206 11:69297663-69297685 CATTCCAAGCAAGGGAGGAGAGG + Intronic
1085349646 11:75790317-75790339 CATCCCTAGAATGAGAGGTGGGG - Intronic
1085607106 11:77911073-77911095 CCTGCCGAGCATGAGATGGGAGG - Intronic
1087723586 11:101694138-101694160 AGTTCCAAGCATGAAATATGAGG + Intronic
1089574624 11:119432576-119432598 CACTCCAGGCATGAGGTGTGGGG + Intergenic
1090123257 11:124055435-124055457 CAATGCAAGCATAAGAGGTGAGG - Intergenic
1090486139 11:127113974-127113996 CATTCCTAGCAGGATATGAGAGG + Intergenic
1090621202 11:128562604-128562626 CATTCCCAGGATTAGATGGGTGG - Intronic
1092817777 12:12326263-12326285 CATCCCAAGCATGAAATAAGGGG + Exonic
1094423749 12:30298301-30298323 CATTCTCAGCACCAGATGTGGGG + Intergenic
1094843850 12:34352944-34352966 CGCTCCATGCATGAGAGGTGGGG + Intergenic
1095524080 12:43104508-43104530 CATGCCAAGTAAGTGATGTGAGG - Intergenic
1097700786 12:62818254-62818276 CATTCCAGGAATGAGATAAGAGG - Intronic
1099504152 12:83451344-83451366 CACTCCAAGCTTGACCTGTGTGG + Intergenic
1101247447 12:102897894-102897916 CTTTCCAAGAATGGGCTGTGGGG + Intronic
1101514695 12:105423953-105423975 GAATTCAAGCCTGAGATGTGTGG - Intergenic
1102483824 12:113242786-113242808 CATTTCAAGCATGAGGGATGAGG - Intronic
1103794278 12:123492626-123492648 CATGGCAATGATGAGATGTGGGG + Intronic
1104966817 12:132512101-132512123 CATTCCAGGCCTCAGATGGGTGG - Intronic
1107001979 13:35558456-35558478 CATTCCAAGAAGAAAATGTGAGG + Intronic
1108091817 13:46857323-46857345 CATTCCAGCCTTGAGATCTGTGG - Intronic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1112176187 13:97027583-97027605 CATTCCAGGAATGAAATGTTAGG - Intergenic
1113213148 13:108005772-108005794 CATTTCAAGCATGTGATCTTGGG - Intergenic
1113646444 13:111999869-111999891 CATGCCATGCAGGAGATGTGGGG - Intergenic
1115979517 14:39034675-39034697 CATTTCAAGCAGGAGCTCTGTGG - Intronic
1120678187 14:87447637-87447659 CATTCCAGACATGAAATGGGTGG - Intergenic
1122979598 14:105185609-105185631 CCTGCCAAGGATGAGATGGGAGG + Intergenic
1125014490 15:34918678-34918700 CATTGGAAACTTGAGATGTGTGG - Intronic
1125882292 15:43205226-43205248 CTTTCCAAGCATGGGAGGAGTGG - Intronic
1130210105 15:81914787-81914809 CATTCCCGGCACCAGATGTGGGG + Intergenic
1131048080 15:89328815-89328837 CAGTCCCAGGATGAGATCTGGGG + Exonic
1131455403 15:92579292-92579314 CATGCCAAGAGTGGGATGTGGGG - Intergenic
1131533746 15:93216500-93216522 AATTCCCAACATGATATGTGTGG + Intergenic
1135549932 16:23390131-23390153 CTTTCCAAGCATGAACTGGGAGG - Intronic
1138481812 16:57308119-57308141 CATTCCCAGCATGAGAGGAGAGG - Intergenic
1138814174 16:60185353-60185375 GATTACAAGCATGAGATGCTGGG - Intergenic
1139273249 16:65703196-65703218 CATTCCAAACAGGAGCTCTGGGG - Intergenic
1140892860 16:79299610-79299632 CATTCCAGGCATAAAAAGTGAGG + Intergenic
1144937582 17:18912732-18912754 CATTCCAAAAAGGAGAAGTGAGG + Intronic
1145732717 17:27203992-27204014 CTTTACCACCATGAGATGTGGGG + Intergenic
1148060361 17:44831711-44831733 TACTCCAAGCATGAGGTGGGAGG + Intergenic
1149630318 17:58116542-58116564 CATGCCCAACATGAGATTTGGGG + Intergenic
1149832661 17:59885354-59885376 CATTCCAAGAAACAGGTGTGGGG - Intronic
1150895609 17:69207196-69207218 CATCCCTTGCAAGAGATGTGAGG - Intronic
1151106754 17:71624253-71624275 GAGTCAAAGCAGGAGATGTGAGG + Intergenic
1151365960 17:73616793-73616815 CATTCCCACCATGAGATGCCTGG + Intronic
1153123977 18:1767115-1767137 AATGCCAAGCCAGAGATGTGGGG - Intergenic
1153854417 18:9131807-9131829 CATTTTAAGCATGAGATATCAGG + Intronic
1155210838 18:23600176-23600198 GATTCCAAGAATGAAATATGAGG - Exonic
1158696611 18:59709360-59709382 CAGTCCAAATTTGAGATGTGCGG + Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1162359491 19:10209685-10209707 CATTCCAGGCATGGGATTGGTGG - Intronic
1164938037 19:32230179-32230201 CATACCGAGCATCAGCTGTGGGG + Intergenic
1166161322 19:40955637-40955659 TTTACCAGGCATGAGATGTGGGG + Intergenic
1168444883 19:56403455-56403477 CATTGCTTGCTTGAGATGTGTGG + Intronic
935455913 2:103267850-103267872 CATTCTAAGCGAGGGATGTGAGG - Intergenic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
938786959 2:134638754-134638776 GTTTCCAAGCCTGAGATGTCAGG + Intronic
941341078 2:164304321-164304343 TTTTCAAAACATGAGATGTGAGG - Intergenic
944090582 2:195905528-195905550 CAGTCTAAGCATGTGAAGTGTGG + Intronic
946134933 2:217637717-217637739 AATACCGAGCATGTGATGTGTGG + Intronic
946993235 2:225359761-225359783 TATTCAAAGCATGAAATATGAGG + Intergenic
948155802 2:235779903-235779925 CATTCCAAGCACGAGTGGTGAGG - Intronic
948318109 2:237045779-237045801 CATTTCAAGCATGACCTGGGAGG + Intergenic
948441777 2:237996346-237996368 CATCCCAAGCATGGGCTTTGTGG + Intronic
1169282973 20:4282770-4282792 TATTCCAGGCAGGAGATGGGAGG + Intergenic
1169437490 20:5605933-5605955 GATTCCAAGCCAGGGATGTGAGG - Intronic
1171210048 20:23309920-23309942 CTTACCAGGCATGAGAAGTGGGG - Intergenic
1172184713 20:33024138-33024160 CAATCCAGACATGAGATGTCTGG + Intergenic
1173235861 20:41244865-41244887 CCTTCCAAGGGTGAGAGGTGAGG - Intronic
1173431906 20:42995551-42995573 CATTGTGAGCATGAGAAGTGAGG + Intronic
1178713299 21:34939981-34940003 CATTGCAATCATGAAATGGGTGG - Intronic
1178793149 21:35718803-35718825 CTTCCCATGCATGACATGTGGGG + Intronic
1182037002 22:27206758-27206780 CATTCAAAGCAGGAGATTTAGGG - Intergenic
951939067 3:28057767-28057789 AATTCAAAGCATGAGCTTTGAGG + Intergenic
952450890 3:33431816-33431838 CATGGCAAGGATGAGTTGTGAGG + Intronic
955103338 3:55873146-55873168 CATTCCATGCAGGAGAGCTGTGG - Intronic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
961489609 3:127245449-127245471 AAGTCAAAGCATGAGAAGTGAGG + Intergenic
961490315 3:127252765-127252787 AAGTCAAAGCATGAGAAGTGTGG + Intergenic
964928793 3:161989980-161990002 CATACCCAGAATGAGCTGTGAGG + Intergenic
969359819 4:6656369-6656391 TATTCCAAGCAGGAGATGACTGG - Intergenic
973064493 4:45771545-45771567 CATCCCAAGCATGGGAAGTGTGG - Intergenic
974855562 4:67456768-67456790 CATTCCCAGGATGAGATACGAGG + Intergenic
978501784 4:109417728-109417750 CACTCCAAGCAGGAGAGGAGAGG + Intergenic
979060933 4:116059438-116059460 ACTTCCAAGCATGTGATGGGAGG + Intergenic
979846339 4:125517475-125517497 CATTACAAACATGAGATGGTTGG - Intergenic
981539002 4:145828767-145828789 CAGGCCAGGCATGGGATGTGGGG + Intronic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
987104001 5:14618949-14618971 CATTCCAGGGATGAGGAGTGGGG - Intergenic
991354544 5:65754371-65754393 CATTCCAAGCAAGAGTACTGAGG + Intronic
993608944 5:90031388-90031410 CCTTCCAAGAAAAAGATGTGAGG + Intergenic
996007526 5:118440877-118440899 TTTTCCAAGCATGATATTTGTGG - Intergenic
999535128 5:152507942-152507964 ATTTCCAAGAAAGAGATGTGAGG - Intergenic
999723895 5:154419146-154419168 CATTTCAAGCAGGAGATGTTGGG + Exonic
1000215473 5:159151659-159151681 CATTCCACTTAGGAGATGTGTGG - Intergenic
1000636982 5:163655755-163655777 CATTCCAGGCATGCGTAGTGAGG - Intergenic
1007769598 6:44182469-44182491 AATTCCAAGCATGGGTTGTCGGG - Intronic
1007905354 6:45454379-45454401 CTTTCGTAGCATGAGATTTGTGG + Intronic
1008778065 6:55065146-55065168 CATTGCAAGCATCAGATGACTGG + Intergenic
1013145901 6:107391474-107391496 TATTCCAAGCAGGGGATGGGGGG + Intronic
1015083986 6:129265177-129265199 CATTCCAAACAAGTGATGTGGGG - Intronic
1016493573 6:144634133-144634155 CAGTCCAGGCATGGGATGTGTGG + Intronic
1016939462 6:149472527-149472549 GATTGCAATCATGAGAGGTGGGG + Intronic
1019003852 6:168779676-168779698 CATTCCACTCATTAGAAGTGAGG - Intergenic
1020941573 7:14545623-14545645 GATTCCAAGTGTGAGATTTGTGG - Intronic
1021851040 7:24808898-24808920 CATACCAAGCATGTAATGAGAGG - Intronic
1025845897 7:65197145-65197167 CCCACCAAGCATGAGATGGGAGG + Intergenic
1025896122 7:65702857-65702879 CCCACCAAGCATGAGATGGGAGG + Intergenic
1027003636 7:74673205-74673227 CATAGCAATCCTGAGATGTGAGG + Intronic
1030416498 7:109250777-109250799 GATTCCAAGGATAAGATTTGGGG - Intergenic
1031860582 7:126975326-126975348 AATTCCAATCTTGAGATTTGAGG + Intronic
1031960492 7:127985137-127985159 CATTCCCAGCTTGTGGTGTGCGG + Intronic
1032417707 7:131749862-131749884 CATTCAAAACCTGAGATGTGTGG - Intergenic
1033165118 7:139033441-139033463 CATTTCATACAAGAGATGTGAGG + Intronic
1035659205 8:1334082-1334104 CAGTCCAGGCATGAGCTGTTTGG - Intergenic
1035682602 8:1499105-1499127 CACTCCAAGAATGAGGAGTGGGG - Intergenic
1039261835 8:35780288-35780310 CATGTCAGGCATGAGATATGAGG - Intronic
1042494576 8:69441793-69441815 CATCCCAAGGAAGAGATATGTGG - Intergenic
1044245791 8:89943793-89943815 GAGTCCAAGCAGGAGATGTTGGG + Intronic
1048015543 8:130493296-130493318 CATTACAAGCATAATTTGTGTGG + Intergenic
1050602987 9:7271631-7271653 CATTGCAAGCAAGAGGGGTGAGG + Intergenic
1051164400 9:14246541-14246563 AAATCCATGTATGAGATGTGTGG - Intronic
1051337577 9:16079992-16080014 CCTTCCATGCTTGTGATGTGGGG + Intergenic
1051708975 9:19910602-19910624 CATACCAAGCATGCTATATGTGG - Intergenic
1052300250 9:26945827-26945849 CATTTGAAGCATGAGATGGATGG - Intronic
1052526579 9:29626894-29626916 CACTCCAAGCATGAGATAGGTGG - Intergenic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1054957805 9:70933470-70933492 CATTCCAAGAAGGTGAAGTGAGG + Intronic
1056788905 9:89612837-89612859 CAATCGAAGCATGAGAGGTAGGG - Intergenic
1058367969 9:104232894-104232916 CATTCCTTCCATGACATGTGAGG + Intergenic
1060234747 9:121854352-121854374 CTCTCCAAGCAAGAGGTGTGTGG + Intronic
1061366344 9:130173905-130173927 TGTTCCAAGCATGAGGGGTGAGG - Intronic
1062423483 9:136495220-136495242 CATGTCAAACATGAGATGTGTGG - Exonic
1189561711 X:42197649-42197671 AATTCCATGGATGAGAAGTGGGG - Intergenic
1190018161 X:46846699-46846721 AATACCAAGCAAGTGATGTGAGG - Intronic
1190179287 X:48177721-48177743 CATTCCAAGAAGCAGATGTGAGG - Intergenic
1190190737 X:48274751-48274773 CATTCCAAGAAGCAGATCTGAGG - Intronic
1190791105 X:53701148-53701170 AATTCCAAGCATAAGATGTAGGG + Intergenic
1193543017 X:82794708-82794730 CCCTCCAAGCCTGTGATGTGAGG - Intergenic
1196005244 X:110830535-110830557 CATTCACAGAAAGAGATGTGGGG - Intergenic
1196068588 X:111493892-111493914 CATTTCAAGCAGGAAATATGAGG + Intergenic
1196939742 X:120763368-120763390 TAAGCCAAGCAAGAGATGTGTGG - Intergenic
1199437821 X:147832689-147832711 CATTCCAGGCAGGAGATGGGAGG + Intergenic
1200252576 X:154561574-154561596 CATTCCAGGCCTGTGATGCGAGG + Intronic
1200265191 X:154642842-154642864 CATTCCAGGCCTGTGATGCGAGG - Intergenic