ID: 1111738863

View in Genome Browser
Species Human (GRCh38)
Location 13:92176696-92176718
Sequence GCTCCAGGCACTCTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111738863_1111738872 5 Left 1111738863 13:92176696-92176718 CCTCCCTCCAGAGTGCCTGGAGC 0: 1
1: 0
2: 3
3: 28
4: 299
Right 1111738872 13:92176724-92176746 CCAGTGGTTCCTCACCTCAACGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111738863 Original CRISPR GCTCCAGGCACTCTGGAGGG AGG (reversed) Intronic
900131305 1:1088355-1088377 GCTCCAGGCACTGCAGATGGGGG - Intronic
900781834 1:4623664-4623686 CCACCAGGCACTCTGGCAGGTGG - Intergenic
901211038 1:7526250-7526272 GCTCCAGGGGCTCTGGAGGCTGG + Intronic
901513034 1:9727381-9727403 GACCCAGGCAGTCTGGCGGGAGG - Exonic
901821475 1:11832972-11832994 TCTCCAGGCATTATGGAGGTGGG + Intronic
902090274 1:13897620-13897642 GCTCCATCCACCCTGCAGGGTGG - Intergenic
903467689 1:23563652-23563674 GCTCCAGACTCTCTGAGGGGAGG - Intergenic
905222409 1:36457784-36457806 GCTCCAAGTCCTCTGGAGGCAGG + Intronic
906630595 1:47364057-47364079 GCTGCAGGTACTATGGGGGGAGG - Intronic
907322943 1:53617039-53617061 GCTCTAGGCCCTCTGGAGGAGGG - Intronic
908814141 1:68014230-68014252 AGGCCAGGCTCTCTGGAGGGTGG + Intergenic
910279174 1:85479674-85479696 GTAACAGGCACTCTGGAGGTGGG + Intronic
912328264 1:108789946-108789968 GCTCCAGCTACTCAGGAGGCTGG + Intronic
912828006 1:112923905-112923927 GCCTCAGGCACTCTGGACTGAGG + Intronic
912868899 1:113285293-113285315 GCTCCAGCTACTCAGGAGGCAGG + Intergenic
912940839 1:114043098-114043120 ACTCTAGGCACTCTGCTGGGTGG + Intergenic
914322221 1:146576246-146576268 GCTCCTGGCACTCAGGAGAGAGG - Intergenic
914850409 1:151309927-151309949 GCTCCAGACACTCAGGAGCTGGG + Intronic
915080297 1:153347489-153347511 GTTCCAGCTACTCAGGAGGGAGG - Intronic
915318817 1:155044811-155044833 GCCTCAGGAAGTCTGGAGGGAGG + Intronic
919988415 1:202691834-202691856 GCTCCAGGAAACCTGCAGGGAGG - Intronic
920074760 1:203327851-203327873 GCCTGAGGGACTCTGGAGGGAGG - Intergenic
920349772 1:205330019-205330041 GCTGCAGGTACGCTGAAGGGAGG + Intergenic
921570001 1:216766290-216766312 GTTTGGGGCACTCTGGAGGGAGG + Intronic
1064096016 10:12425058-12425080 GCTCCAGCCACACTGGACGGTGG + Intronic
1064985023 10:21200970-21200992 GTTCCAGCTACTCAGGAGGGAGG + Intergenic
1065205991 10:23358196-23358218 GCTCCAGACACAGTTGAGGGTGG + Intergenic
1065827551 10:29585740-29585762 GCCCCAAGATCTCTGGAGGGAGG + Intronic
1065950319 10:30645550-30645572 GCCCCAAGATCTCTGGAGGGAGG - Intergenic
1069590329 10:69637411-69637433 GCTCCAGTCCCTCTGGTGGGCGG + Intergenic
1069628580 10:69883137-69883159 CCTCCAAGCACTTTGGAGGAGGG + Intronic
1070829920 10:79411908-79411930 GCTCCAGGGACTGGGGACGGTGG - Intronic
1071450252 10:85786930-85786952 CCTCCAGGCAGGCTGGAGAGAGG - Intronic
1073072538 10:100803654-100803676 CCTCCAGCCTCTCTGGGGGGTGG + Intronic
1075015757 10:118909013-118909035 TCTCCAGGCACTCAGGAGAGTGG + Intergenic
1075744595 10:124717963-124717985 GCTCCAGTCACTCAGCAGGCAGG + Intronic
1076635663 10:131880489-131880511 GCTCCAGGCAACGTTGAGGGTGG - Intergenic
1076905704 10:133359742-133359764 GCCCCAGGGAGCCTGGAGGGAGG - Intergenic
1077244057 11:1527409-1527431 GCTCCAGCCACTCAGAAAGGAGG + Intergenic
1077369341 11:2174271-2174293 GGGCCAGGCTCTCTGGAGGCAGG + Intergenic
1077466465 11:2735967-2735989 GCTCCAGACACACTGGAGGAAGG - Intronic
1079140139 11:17803178-17803200 GCTAAAGGCATTCTGTAGGGTGG + Intronic
1079498134 11:21069484-21069506 GGGACTGGCACTCTGGAGGGAGG + Intronic
1081698548 11:45136811-45136833 TCACCAGGCACTGAGGAGGGTGG + Intronic
1082803975 11:57435244-57435266 TCTTCAGGGAATCTGGAGGGTGG - Intergenic
1083764648 11:64836058-64836080 CCTCCAGGCACACTGGGGGCAGG + Intronic
1083997782 11:66280616-66280638 GCGCCAGGCAGCCTGGGGGGTGG + Intronic
1084483371 11:69434601-69434623 GCCCCAGGCCCTGGGGAGGGAGG + Intergenic
1085018133 11:73188631-73188653 TCTCCAGGCAGTGGGGAGGGCGG - Intergenic
1085104888 11:73833790-73833812 GTTCCAGCTACTCTGGAGGCTGG - Intronic
1085243977 11:75082959-75082981 GCTCCAGCTACTCGGGAGGCTGG + Intergenic
1085779048 11:79392135-79392157 GCCCCAGGAACTCTGAAGGATGG + Intronic
1087289028 11:96299645-96299667 GCTCCGGTGCCTCTGGAGGGAGG + Intronic
1087810881 11:102608061-102608083 GCCCCAGGGGATCTGGAGGGTGG - Intronic
1089404237 11:118184250-118184272 ACTTTGGGCACTCTGGAGGGAGG + Intergenic
1090517890 11:127448183-127448205 GCTCCAGGCAGGCCGGACGGAGG - Intergenic
1091057894 11:132436017-132436039 GCTTGAGGGACTCAGGAGGGAGG - Intronic
1091221258 11:133931243-133931265 GCGGCAGGCACTCGGGAGGAGGG - Intronic
1091390306 12:122194-122216 GTTCCAGGCTCTCTGGCTGGTGG - Intronic
1092045534 12:5430038-5430060 GTCCCTGGCAGTCTGGAGGGAGG - Intergenic
1093921724 12:24866432-24866454 GGACCAGGCACTGTGGAGTGGGG - Intronic
1096222782 12:49842557-49842579 GCGCCAGGCACGCTGGACAGAGG + Intronic
1096474114 12:51897446-51897468 GCTCCAGCCACTCTGGTGGGTGG - Intergenic
1096801338 12:54112570-54112592 CAGCCAGGCACTCAGGAGGGGGG + Intergenic
1098045801 12:66399199-66399221 GCTCCTGGCACGGTGGAGGGAGG - Intronic
1099569637 12:84300214-84300236 GCCCCAGGGACTCCGGAGGATGG - Intergenic
1101876119 12:108597928-108597950 GCTCCAGGCTCTCAGGACAGAGG + Intronic
1103445086 12:120989187-120989209 GCGCCAGGCACTCTGTGGGACGG + Intronic
1103696496 12:122819942-122819964 GTCCCAGGCACTCGGGAGGCTGG + Intronic
1103911550 12:124354987-124355009 GCGTCAGGCACTCTGGACTGTGG - Intronic
1104747790 12:131221005-131221027 GATCCTGCCACCCTGGAGGGAGG - Intergenic
1105623020 13:22087448-22087470 GCTCGAGGCACTGAGCAGGGAGG - Intergenic
1108055457 13:46480650-46480672 GATCAAGGAACTCTGCAGGGTGG - Intergenic
1108329689 13:49372790-49372812 GTCCCAGCTACTCTGGAGGGAGG - Intronic
1108748079 13:53416038-53416060 GCTCCAGTGAATGTGGAGGGAGG + Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1112513698 13:100033319-100033341 AATCCAGGCACTTTGGTGGGAGG - Intergenic
1113517231 13:110913276-110913298 GCAAGAGACACTCTGGAGGGAGG + Intronic
1113842093 13:113366075-113366097 GCCCCAGGCTCTGTGCAGGGTGG + Intergenic
1113878835 13:113611186-113611208 GCTCCGGGAACCCAGGAGGGTGG + Intronic
1114493356 14:23117024-23117046 GCTCCAGGTCCTGTGGGGGGCGG + Intergenic
1117353431 14:54902369-54902391 GCTCAAGACGCCCTGGAGGGCGG - Exonic
1118819091 14:69333378-69333400 GCCCCAGTGACTCTGCAGGGAGG + Intronic
1119433614 14:74584081-74584103 GGGCCAGGCACTATGCAGGGGGG + Intronic
1119527309 14:75333091-75333113 ACTCCTGGAAATCTGGAGGGGGG - Intergenic
1120907975 14:89636974-89636996 GCTACAGGCTCTCAGGAGAGGGG + Intronic
1121323316 14:93005476-93005498 GCTCCAGGCCCTGGGAAGGGTGG - Intronic
1121467801 14:94127313-94127335 GCTCTAGGCACTTTGAGGGGAGG - Intergenic
1121521906 14:94591879-94591901 GCCCCAGGCACTGTGCTGGGGGG - Intronic
1121634572 14:95445183-95445205 GCACCAGGCCCTGTGGATGGAGG + Intronic
1123145867 14:106129480-106129502 CCCCCAGGCATTCTGCAGGGAGG + Intergenic
1123632919 15:22274571-22274593 GCTGCAGGCCCTGTGGAGGGAGG - Intergenic
1123908823 15:24946585-24946607 GCTCCAGCCACTCAGGAAGTTGG - Intronic
1126046930 15:44650534-44650556 GTCCCAGCTACTCTGGAGGGAGG + Intronic
1126428863 15:48559367-48559389 TCTCCAGGAAGTCTGGCGGGTGG + Intronic
1126813467 15:52431868-52431890 GTTCCAGCCACTAGGGAGGGAGG + Intronic
1127576808 15:60299706-60299728 GAGCTAGGCACACTGGAGGGAGG + Intergenic
1128189686 15:65679805-65679827 CATCCAGGCACTCTAAAGGGTGG - Intronic
1130015968 15:80186623-80186645 GCTTCTGGGATTCTGGAGGGTGG + Exonic
1130312428 15:82767094-82767116 GTTCCAGGCACTGTATAGGGAGG + Intronic
1130895741 15:88169287-88169309 GTTCCATGCACTCTGCAAGGAGG - Intronic
1131908718 15:97172469-97172491 GTTCCAGGCAATTAGGAGGGAGG - Intergenic
1132677711 16:1127517-1127539 GCTCCATCCACACGGGAGGGTGG - Intergenic
1132982789 16:2747358-2747380 GCTCCGGGCGCTCTGCAGAGTGG + Intergenic
1133492094 16:6280176-6280198 GCTACAGGCAGTCTGCAGGGTGG + Intronic
1134034659 16:11020571-11020593 GCTCCTGGCACTTTGGAGCTTGG + Intronic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1135561887 16:23483055-23483077 GCTCCTGGGGCCCTGGAGGGGGG - Intronic
1136368753 16:29822591-29822613 GCTCCAGGCAGTCCTGAGGTTGG - Intronic
1137510634 16:49096817-49096839 GCGCCAGGTTCACTGGAGGGTGG - Intergenic
1137789808 16:51165550-51165572 GCTCCTGGCTCTCAGGAAGGTGG - Intergenic
1138062144 16:53902990-53903012 GTTCCAGCTACTCGGGAGGGTGG + Intronic
1139326786 16:66158756-66158778 GTTCCAGGTACTCAGGAGGCTGG + Intergenic
1140011405 16:71134922-71134944 GCTCCTGGCACTCAGGAGAGAGG + Intronic
1140512449 16:75517752-75517774 ACTCCCAGCACTCTGGGGGGAGG + Intergenic
1141096878 16:81169204-81169226 GCCCCACGCACTCTGGTAGGAGG - Intergenic
1141163878 16:81647656-81647678 GCTCCAGGCTCCCTGGAGGCTGG - Intronic
1141209123 16:81959725-81959747 GCTGCAGGCACTCTGTAGCCAGG + Exonic
1141211700 16:81987041-81987063 GCACTAGGAACTCTGGTGGGAGG + Intergenic
1141474954 16:84266647-84266669 GCTACAGACACTGTGGAGAGGGG - Intergenic
1142145098 16:88489602-88489624 GCTGCAGCCGCTCTGGAGTGGGG - Intronic
1142425340 16:89999579-89999601 TCTCCAGAGACTCTGCAGGGTGG + Intergenic
1143719377 17:8799183-8799205 GCCCCAGGTACCCGGGAGGGAGG + Exonic
1144549914 17:16231154-16231176 GCTCCTAGCACTTTGGAAGGCGG - Intronic
1144659435 17:17058544-17058566 GCTCCAGGGACTGTGGGGAGTGG + Intronic
1144672532 17:17141040-17141062 GCTACAGTCACTCTGCATGGGGG - Intronic
1144775958 17:17784690-17784712 CCTCAAGGCACACAGGAGGGTGG + Intronic
1146378137 17:32308500-32308522 GTTCCAGCTACTCTGGAGGCTGG + Intronic
1146789796 17:35744907-35744929 GTTGCAGGCCCTCTGGAGGTTGG + Exonic
1147342060 17:39758550-39758572 TCTCCAGGCTTTCTGGAGTGGGG + Intergenic
1148056894 17:44804477-44804499 GCTCAGGGGACTCTGGAGGCGGG - Exonic
1148134498 17:45283552-45283574 GCCACAGGCACCCTGGACGGTGG + Intronic
1148550038 17:48544708-48544730 GCTCCTGGGTCTCTGAAGGGTGG + Exonic
1151914846 17:77110321-77110343 GATCCAGGCTCTCTAAAGGGAGG - Intronic
1152378858 17:79931865-79931887 GCTCCAGGGGCTGTGGTGGGAGG + Intergenic
1152655416 17:81517175-81517197 GCTCCAGGCCTTCTGGAGACAGG + Intronic
1153275982 18:3368287-3368309 GCCCCTGGCACTCTGGGTGGGGG + Intergenic
1153982349 18:10321180-10321202 GCCACAGGCTCTGTGGAGGGCGG + Intergenic
1157332265 18:46712543-46712565 GCTGCAGGCACAGAGGAGGGAGG - Intronic
1157424046 18:47569917-47569939 GTCCCAGGGAATCTGGAGGGTGG + Intergenic
1157577801 18:48755308-48755330 GCACGAGGCACCCTGGAGAGTGG + Intronic
1157815586 18:50727573-50727595 CCTCCAGGCTCTCTGGAGGAAGG - Intronic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1158608773 18:58919738-58919760 GCTGCTGGCACTCTGGACAGAGG - Exonic
1160620767 18:80169100-80169122 GCTCCGGTCACTCAGGAAGGTGG + Exonic
1160968069 19:1755274-1755296 TCTCCACCCACTCTGGAGGAGGG - Intronic
1161027450 19:2043091-2043113 GCTCCAGGCTGTGAGGAGGGAGG - Intronic
1161031670 19:2060612-2060634 GCGCAAGGCACTCTGCAGGTGGG + Intergenic
1161210025 19:3061547-3061569 CCTCCCGGCGCTTTGGAGGGCGG - Intronic
1161453462 19:4359207-4359229 GCTCCAGGAACCCTGGAGCCAGG + Exonic
1162393749 19:10404608-10404630 GCTCCAGCCACTCCGGTGAGGGG + Intronic
1162404390 19:10464832-10464854 GTCCCAGCCACTCTGGAGGCGGG - Intronic
1163186225 19:15641335-15641357 GCTCCAGGGACAGTGGAGAGAGG - Intronic
1163589389 19:18183148-18183170 GTTCCAGACACTCGGGAGGCTGG - Intergenic
1164370073 19:27636348-27636370 GCTCCAGGCATTCTGATGGGAGG - Intergenic
1164502265 19:28829961-28829983 GCAGCAGGCACTCTGCTGGGTGG - Intergenic
1165289072 19:34868564-34868586 GTTCCAGCTACTCGGGAGGGAGG - Intergenic
1166675234 19:44736923-44736945 GTCCCAGACACTCTGGAGGCTGG - Intergenic
1166696908 19:44857004-44857026 GCACAAGGGACCCTGGAGGGTGG + Intronic
1166837020 19:45673744-45673766 GTTCCAGCTACTCTGGAGGCTGG + Intronic
1167289950 19:48619058-48619080 GCTAGGGGCACGCTGGAGGGCGG - Intronic
1167743955 19:51340288-51340310 GGTCCGGGCCGTCTGGAGGGAGG + Exonic
1167921623 19:52787112-52787134 TCTCCATTCACTCAGGAGGGAGG + Intronic
1168287357 19:55341302-55341324 GCCCCAGGCAGCCTGGAGGCGGG - Intronic
925077550 2:1030240-1030262 GCACCAGGCACAGTGGAAGGCGG - Intronic
925112207 2:1346267-1346289 GCGCCAGGCAGGGTGGAGGGTGG - Intronic
925390433 2:3490458-3490480 GCCCCAGGCACTGTGCAGGAGGG + Intergenic
925979327 2:9164284-9164306 CCTCCTGGCACACTGGAGAGGGG - Intergenic
927095691 2:19746181-19746203 GCTCCCAGCACACTGGAGGGTGG + Intergenic
927680596 2:25136613-25136635 CCTCCAGGCACAGTGAAGGGCGG + Intronic
930026539 2:47032474-47032496 GCTTCAGGAGCTGTGGAGGGTGG + Intronic
930700282 2:54453659-54453681 GTCCCAGGTACTCTGGAGGCTGG - Intergenic
930946758 2:57084779-57084801 GCTCCCGGCACCCAAGAGGGAGG + Intergenic
930946786 2:57084875-57084897 CCTGCAGGCTCTGTGGAGGGCGG + Intergenic
933748687 2:85589233-85589255 GCTCCAGGGACCCTGGAAGGAGG - Intronic
936149662 2:110008351-110008373 GCTGCTGGCACTCTGGACAGAGG - Intergenic
936195016 2:110363018-110363040 GCTGCTGGCACTCTGGACAGAGG + Intergenic
936414247 2:112289856-112289878 GCTCCAGCCACTCTGGAGGCTGG - Intronic
937132868 2:119526113-119526135 GTTACAGGCTCTCTGTAGGGGGG - Intergenic
938073574 2:128320453-128320475 GGTCCAAGCACACTGCAGGGCGG - Intergenic
938210233 2:129460781-129460803 CCCCCAGTCACTCTGCAGGGAGG + Intergenic
938367316 2:130745002-130745024 GCTCCTGGCAGCCTGGAGAGCGG - Intergenic
939455293 2:142426687-142426709 GCTCCAGACACCCAGTAGGGAGG - Intergenic
939689016 2:145234896-145234918 GATCCAGGGACTCTGGGGTGAGG - Intergenic
940806604 2:158194555-158194577 GCCCTAGGCTCTCTGGAGGTAGG + Intronic
940863168 2:158790723-158790745 GCCCCAGGTACTCAGGAGGCTGG - Intergenic
942202068 2:173581435-173581457 GTTCCAGGCAGTCTGGCGGGTGG + Intergenic
942666905 2:178329534-178329556 GTCCCAGCTACTCTGGAGGGAGG - Intronic
943152985 2:184138060-184138082 GGTCCCAGCACTCTGAAGGGTGG + Intergenic
1171014474 20:21527623-21527645 GCTCAAGGCAGTCTAGAGGGTGG + Intergenic
1171795348 20:29561896-29561918 CAGCCAGGCACTCAGGAGGGGGG - Intergenic
1171853104 20:30322369-30322391 CAGCCAGGCACTCAGGAGGGGGG + Intergenic
1172110410 20:32541476-32541498 GCTCCAGCCACCTTGGATGGTGG + Intronic
1174464595 20:50707468-50707490 GCCCCAGCTACTCTGGAGGCTGG + Intergenic
1174942657 20:54947666-54947688 GTTCCAGCAACTCTAGAGGGAGG + Intergenic
1175479346 20:59300530-59300552 GTTCCAGCCCCTCTGGGGGGCGG + Exonic
1175642153 20:60639806-60639828 TTTCCAGGCTCTCTGAAGGGAGG + Intergenic
1175689695 20:61056554-61056576 GCTCAAGGCAGCCTGGTGGGTGG + Intergenic
1176136735 20:63526096-63526118 GTCCCAGCTACTCTGGAGGGTGG + Intergenic
1176141390 20:63546607-63546629 GCTCCAGGAACTCTGGGTGAGGG - Intronic
1176222777 20:63978039-63978061 GCTGCAGGCCCTGTGGGGGGCGG - Intronic
1176372752 21:6072290-6072312 ACTCCAGCTACTCAGGAGGGAGG - Intergenic
1178486367 21:33022181-33022203 CCTCCAGGCACTCTGCTGGCAGG + Intergenic
1178910971 21:36673240-36673262 GTTCCAGCCACTCAGGAGGCTGG + Intergenic
1179023511 21:37660027-37660049 GCTGCAGGAATGCTGGAGGGAGG + Intronic
1179157146 21:38860354-38860376 GATCCAGGGACTCAGGAGGGAGG + Intergenic
1179359234 21:40689964-40689986 GCCCCAGCCAGTGTGGAGGGAGG + Intronic
1179750725 21:43465953-43465975 ACTCCAGCTACTCAGGAGGGAGG + Intergenic
1179913352 21:44461435-44461457 GCCCCAGGCTCTGTGGCGGGAGG - Exonic
1180583092 22:16860014-16860036 GCTGCTGGCACTCTGGACAGAGG + Intergenic
1181029826 22:20144324-20144346 GCTCCAGGCACCCGGCAGGTTGG + Intronic
1181029978 22:20144961-20144983 GACCCAGGGACTCGGGAGGGTGG + Intronic
1181339338 22:22165789-22165811 GCTCCTGGTGCCCTGGAGGGAGG + Intergenic
1181513445 22:23398995-23399017 GCTCCAGGCACCCAGCAGGTTGG - Intergenic
1182355700 22:29721399-29721421 GCTCCAGGAGGTCTGGGGGGAGG - Intronic
1183282140 22:36937668-36937690 ACTCCAGGGACCCTGGAGGTGGG - Exonic
1183466135 22:37981308-37981330 GCTCCCTGGACCCTGGAGGGGGG - Intronic
1183666110 22:39246776-39246798 GCTCCAGGCACTGGGGAGACAGG + Intergenic
1183811590 22:40262089-40262111 GCTCCAGGTGCTGTGCAGGGAGG - Exonic
1184231386 22:43160069-43160091 GTGCCAGGCACTCTAGGGGGCGG + Intronic
1184432490 22:44449673-44449695 GCTCCAGGAACCCTGAAAGGAGG - Intergenic
1184741245 22:46430158-46430180 GACACAGCCACTCTGGAGGGCGG + Intronic
1184746565 22:46459565-46459587 CCTGCTGGCACTGTGGAGGGTGG - Intronic
949146051 3:701253-701275 GCTGCAGTCACTGTGGAGGATGG + Intergenic
949529027 3:4935439-4935461 GCACCAGACAGGCTGGAGGGAGG - Intergenic
949969940 3:9396544-9396566 GCTACAGGCACTCGTGGGGGTGG - Intergenic
950307039 3:11923963-11923985 GCTGAAGGCAATCAGGAGGGTGG - Intergenic
950538309 3:13594629-13594651 GCTCCGTGGGCTCTGGAGGGAGG + Intronic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
960124166 3:113980018-113980040 GCTCCATCCACTCTACAGGGAGG - Intronic
962620634 3:137174573-137174595 GCTGCAGCCAGTCTGCAGGGTGG + Intergenic
962854366 3:139330444-139330466 TCTACAGGAACTCTGCAGGGCGG + Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
964175413 3:153821891-153821913 GCTGCTAGCACTTTGGAGGGGGG - Intergenic
967004189 3:185368037-185368059 GTCCCAGTCACTCGGGAGGGAGG + Intronic
968702488 4:2063522-2063544 GCTTAAGGAGCTCTGGAGGGGGG + Intronic
969681353 4:8645090-8645112 GATCCTGGCACACTGGAGCGGGG + Intergenic
980851868 4:138392965-138392987 GCTCCAGTAATTCAGGAGGGAGG + Intergenic
982070897 4:151693505-151693527 TCTCCTGACACTCTTGAGGGGGG - Intronic
983409072 4:167373256-167373278 GTCCCAGACACTCGGGAGGGAGG + Intergenic
984727714 4:183037300-183037322 CCTGCAGGCACTCAGGAAGGAGG + Intergenic
984857242 4:184205722-184205744 GCTCCAGGCAGTCAGGGTGGTGG + Intronic
984887001 4:184457983-184458005 GTTCCAGCCACCCTGGAGAGTGG + Intronic
985823377 5:2176056-2176078 GCTCAGGGCAGTGTGGAGGGAGG - Intergenic
987071483 5:14340987-14341009 GCTGCAGGCATTCTGAAAGGAGG - Intronic
988812661 5:34801067-34801089 GCTTCATACACTCTGGAAGGAGG + Intronic
990180416 5:53154700-53154722 GATACATGCACTCTGGAGGGAGG - Intergenic
991975376 5:72179454-72179476 GGGCCAGGCATTCTGAAGGGAGG - Intronic
996326997 5:122286482-122286504 GCTGCAGTCACTGTGGAGGATGG + Intergenic
996413569 5:123185441-123185463 ACTCCAGGAGCTCTGGAGAGGGG + Intronic
996726905 5:126680487-126680509 CCTCCGGGCACTGTGGAAGGGGG - Intergenic
997119133 5:131156363-131156385 GTTCCAGGTACTCAGGTGGGAGG + Intergenic
997673342 5:135694306-135694328 GCCACAGGCTCTGTGGAGGGAGG + Intergenic
999036470 5:148357080-148357102 GCTCCAAGCACTTTGGAGAGAGG + Intergenic
999244947 5:150149137-150149159 ACTCCAGGCACTGTGGGGAGGGG + Intronic
1000050790 5:157561464-157561486 GCTTCTGGGACTCTGGGGGGAGG - Intronic
1000711964 5:164591491-164591513 GCCCCAGCTACTCGGGAGGGAGG + Intergenic
1001118519 5:168959576-168959598 ACTCCAGGCAGCCTGGAGGCGGG - Intronic
1001494051 5:172175493-172175515 CCTCCTGGCACCCTGGTGGGTGG - Intronic
1002158201 5:177299456-177299478 GCTCCAGGCAGCGTGGACGGAGG - Exonic
1002578885 5:180195193-180195215 GCTCCAGGGACGCTGGCGGGAGG - Intronic
1002795071 6:465526-465548 CCTCCAGGCCCTCGGGTGGGAGG - Intergenic
1003007870 6:2398308-2398330 CCTCCAGGCAGAATGGAGGGAGG + Intergenic
1003515474 6:6814804-6814826 GATCCAGGCTCTATGGAGGATGG - Intergenic
1006168853 6:32081629-32081651 GCTCCAGGAACTCAGGGCGGGGG + Intronic
1006781686 6:36636619-36636641 GCTCAGGGGACTCTTGAGGGAGG + Intergenic
1006922044 6:37633588-37633610 GCTGCAGACACTGTGGTGGGAGG + Exonic
1007482553 6:42159602-42159624 GCTTCCGGCTCACTGGAGGGCGG - Intronic
1008882375 6:56394237-56394259 GTTCCAGGCAGTCTGGGGGCAGG - Intergenic
1009444330 6:63722731-63722753 GAAATAGGCACTCTGGAGGGAGG - Intronic
1009494738 6:64332676-64332698 GCTCCATCCACACTGGAGGCTGG + Intronic
1015402094 6:132798527-132798549 GCCACTGGCACTCTGGCGGGCGG + Exonic
1016956846 6:149635158-149635180 GCCCCAGCTACTCTGGAGGCTGG + Intronic
1017707717 6:157139433-157139455 GCACCAGGCACCCTGGAGAAGGG + Intronic
1018047694 6:159979662-159979684 GAACCAGGCACCCTGGTGGGGGG + Intronic
1018825236 6:167403938-167403960 GTTCCAGGCAGAGTGGAGGGAGG + Intergenic
1019206429 6:170365725-170365747 GCTCCAGGCAGCCTGGCAGGGGG - Intronic
1019772182 7:2890613-2890635 GCTCCAGGCTCTGTGGATGCAGG + Intergenic
1024348709 7:48340222-48340244 GTTCCAGCCACTCAGGAGGGTGG - Intronic
1024784113 7:52886572-52886594 GCTGCAGACACTCTGGGGAGTGG - Intergenic
1025245264 7:57312375-57312397 GCTTCAGTCACTCTGGATTGGGG - Intergenic
1026398316 7:69982448-69982470 GCTCCAGGCTATCCTGAGGGGGG + Intronic
1026645368 7:72163056-72163078 TCTCCAGCCTCTATGGAGGGCGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028472280 7:91218505-91218527 GGTACATGCCCTCTGGAGGGTGG + Intergenic
1029177861 7:98677697-98677719 GCTCCAGCTACTCAGGAGGCTGG - Intergenic
1029461383 7:100695637-100695659 GTTCCCGGCACTTTGGAAGGAGG - Intergenic
1032469432 7:132167650-132167672 GTTCCAGCTACTCTGGAGGCTGG - Intronic
1033200138 7:139360730-139360752 TCTCTAGGTACTCTGGAGGACGG - Intronic
1034220929 7:149445683-149445705 GCACCAGGCACAGTTGAGGGTGG - Intronic
1034491459 7:151395252-151395274 GCTCCAGGCGCCCTGCAGGCAGG + Intronic
1034835990 7:154351917-154351939 GCTCCCAGCCCTCTGGAAGGTGG + Intronic
1035098497 7:156377095-156377117 GAGCCAGGCACTCCGGGGGGTGG + Intergenic
1035290453 7:157834714-157834736 GCTCCAGGCTCACTGGAGGCTGG - Intronic
1038035329 8:23682337-23682359 GCTCCTGGGACGGTGGAGGGCGG + Intronic
1041321080 8:56613068-56613090 ACACCAGGCACTTTGAAGGGAGG + Intergenic
1043522503 8:81061646-81061668 GCTCCAGGCACTCAGGACACAGG + Intronic
1043560868 8:81491692-81491714 GTTCCAGGCTTTCTGGAAGGAGG - Intergenic
1049222535 8:141434519-141434541 GCTGCGGGAGCTCTGGAGGGAGG + Intergenic
1049581452 8:143412962-143412984 GGACCAGGCTCACTGGAGGGTGG + Intergenic
1050150707 9:2616983-2617005 GATCCAGAAACTCTGGAGGTGGG + Intergenic
1053790902 9:41685668-41685690 CAGCCAGGCACTCAGGAGGGGGG + Intergenic
1054154252 9:61629104-61629126 CAGCCAGGCACTCAGGAGGGGGG - Intergenic
1054179249 9:61897362-61897384 CAGCCAGGCACTCAGGAGGGGGG + Intergenic
1054474037 9:65560224-65560246 CAGCCAGGCACTCAGGAGGGGGG - Intergenic
1054658289 9:67683459-67683481 CAGCCAGGCACTCAGGAGGGGGG - Intergenic
1055462214 9:76529785-76529807 GCTGCAGGCACCCAGGAAGGGGG - Intergenic
1055507117 9:76959512-76959534 GTTCCAGCTACTCTGGAGGCTGG + Intergenic
1056233048 9:84566625-84566647 GCTCCTGGGACTGCGGAGGGAGG + Intergenic
1057173281 9:92976497-92976519 TCTCCAGCCACACTGGAGGAGGG - Exonic
1058830530 9:108812391-108812413 GAGCGAGGCACTCTGGAGCGAGG + Intergenic
1058967104 9:110048661-110048683 CCTCCGGGCGCGCTGGAGGGCGG - Exonic
1060188520 9:121578041-121578063 GCACCAGGGAATCTGGGGGGTGG + Intronic
1060930466 9:127486526-127486548 AGTCCAGGCGCCCTGGAGGGTGG - Intronic
1060959027 9:127665861-127665883 GTCCCAGGCACACTGGAGGGTGG + Intronic
1061156234 9:128863580-128863602 GTTCCAGGAACTTAGGAGGGAGG + Intronic
1061592727 9:131608479-131608501 GGTCCAGACACTGGGGAGGGAGG + Intronic
1061866538 9:133494296-133494318 GCCCCAGGTACTTGGGAGGGAGG + Intergenic
1062034481 9:134376826-134376848 GCTGCAGGGTCTCAGGAGGGAGG + Intronic
1062147110 9:134995690-134995712 GCTGCGGGCACTCTCTAGGGTGG + Intergenic
1062672690 9:137720935-137720957 GCTGCAGCCACTCTGGAGTGTGG - Intronic
1186476182 X:9859500-9859522 GCTCCAGGCACTAGGGAGGCTGG + Intronic
1188970203 X:36605943-36605965 GTTCCAGCTACTCAGGAGGGTGG + Intergenic
1191225751 X:58040998-58041020 GGTCCAAGCACTCTGATGGGTGG - Intergenic
1193190301 X:78563261-78563283 AGTCCAGGCAATCTGGAGGAGGG - Intergenic
1196441565 X:115723804-115723826 GTTCCAGCTACTCTGGAGGCTGG + Intergenic
1196445095 X:115841793-115841815 GTTCCAGCTACTCTGGAGGCTGG + Intergenic
1198332507 X:135634583-135634605 GCAACAGGCACTTTGGAGGCAGG + Intergenic
1199680689 X:150222320-150222342 CCTGCAGCCACTATGGAGGGGGG + Intergenic
1200135588 X:153873127-153873149 GGCCCCGGCACTCAGGAGGGCGG + Intronic
1201539499 Y:15090885-15090907 GCTCCAACCACACTGGACGGTGG - Intergenic