ID: 1111745470

View in Genome Browser
Species Human (GRCh38)
Location 13:92263420-92263442
Sequence TGTATTGGAGAGGAAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 584}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111745470 Original CRISPR TGTATTGGAGAGGAAAAAGA AGG (reversed) Intronic
902189323 1:14750499-14750521 TGAATTTGAAAGAAAAAAGATGG - Intronic
903629808 1:24759445-24759467 CGTATTGTATAGGAAAAAGATGG - Intronic
904162472 1:28531888-28531910 TGTGATGGAGAGGAAGAAGCCGG + Exonic
904460542 1:30676857-30676879 TGTAAGGGAGTGGAAAAAGAAGG - Intergenic
904649062 1:31990659-31990681 TGAATAGGAGAGGAAATGGAGGG - Intergenic
905036387 1:34920834-34920856 TATATTCTAGTGGAAAAAGAGGG + Intronic
906039583 1:42777876-42777898 TGGATTGGAGAGGGGACAGAGGG - Intronic
906444283 1:45881197-45881219 TTTAATGGAGAAGAAAAAGATGG + Intronic
906667820 1:47633931-47633953 GGCATAGGATAGGAAAAAGAAGG + Intergenic
906668239 1:47636821-47636843 TGTTTTGGAGAAGAAAATGAGGG + Intergenic
906946509 1:50298977-50298999 TGAATTGCTGAGGAAACAGAGGG - Intergenic
907581193 1:55574281-55574303 TGAATTAGAAAAGAAAAAGAAGG + Intergenic
907997300 1:59645541-59645563 TGTATTGATGAGGAAACTGAGGG - Intronic
908352940 1:63303904-63303926 TGTGTTGGGGAGGAGGAAGAAGG + Intergenic
908572740 1:65426298-65426320 TGTAGTGGAGTGGCAAAAGAAGG + Intronic
908868691 1:68582602-68582624 TGAATAGGAGTGGAAAGAGAGGG - Intergenic
909070945 1:70993004-70993026 TTTATTGAAGAAGAAAAACAAGG - Intronic
909307835 1:74103998-74104020 TATATAAGAGAGGAAAGAGAAGG - Intronic
910115996 1:83732274-83732296 TGTTTGGGATAGGAAAAAGTGGG - Intergenic
910247767 1:85160209-85160231 TATATTGGAGAGTATAAAGTTGG - Intronic
910496716 1:87837758-87837780 TGTTTTGTAGAGAAAAAAAAAGG - Intergenic
910533092 1:88263628-88263650 TGTTTAGGAGAAAAAAAAGAAGG - Intergenic
910736581 1:90465057-90465079 TTTATTGGAGAGAAAACATAGGG - Intergenic
911329894 1:96514884-96514906 TAAAGTGGACAGGAAAAAGAGGG + Intergenic
912147665 1:106813678-106813700 TGTCTTGGATAAGAAAAAGTAGG + Intergenic
912171562 1:107106898-107106920 TCTAATGGAGAAGAAAAACAAGG + Intergenic
912192388 1:107354686-107354708 TGTATTGGTGAGGACCAAAAGGG - Intronic
913079783 1:115372313-115372335 TTTATTGATGAGGAAAATGAAGG - Intergenic
913281188 1:117186649-117186671 TGAAGTGGAGAGGGAAAATAAGG - Intronic
913374695 1:118138058-118138080 TATATTGGAAAGGAGAAGGAGGG - Intronic
913965967 1:143377728-143377750 AGTATTGCAGAGGAACAAGAAGG - Intergenic
914060341 1:144203336-144203358 AGTATTGCAGAGGAACAAGAAGG - Intergenic
914118809 1:144763033-144763055 AGTATTGCAGAGGAACAAGAAGG + Intergenic
915926730 1:160027197-160027219 TGAATGGAAAAGGAAAAAGATGG - Intergenic
916016301 1:160752777-160752799 TGTTTGGGAGAGGAAGAAAAAGG - Intronic
916343753 1:163765449-163765471 TTTATTGAAGAGAAAAATGAGGG - Intergenic
916970028 1:170003812-170003834 TGAATTGGAGTGGTAAGAGAGGG - Intronic
917659008 1:177159399-177159421 TGTAGTGGAGAGAAAAAAGAAGG + Intronic
917906388 1:179590527-179590549 TATATTAGAAAGGGAAAAGAAGG + Intergenic
918684970 1:187403176-187403198 TGTAAGGGAGAGGAAATAAAAGG - Intergenic
918699332 1:187588053-187588075 TGTTTAGGAGAAGAATAAGAAGG - Intergenic
918908706 1:190535043-190535065 TGTATATAAGAGCAAAAAGAAGG + Intergenic
918944875 1:191050931-191050953 AGTAATGGAGAGGAAACAGTAGG + Intergenic
920270724 1:204761748-204761770 TCTAGAGGAGAGGAAAAAGAGGG + Intergenic
920575260 1:207054520-207054542 TTTATAGGTGAGGAAACAGAGGG + Intronic
920663544 1:207941132-207941154 TGTATTGGATATTAAAAAAATGG - Intergenic
921498048 1:215865071-215865093 TTGATTGGATAGGAAAAACATGG - Intronic
921615494 1:217261390-217261412 TGAAGAGGAGAAGAAAAAGAAGG + Intergenic
921703562 1:218294257-218294279 TGAATTGGAGAGCAAACAGGTGG - Intronic
922030692 1:221794693-221794715 TGAAATGGAAAGGAAACAGAGGG - Intergenic
922302769 1:224317264-224317286 TGTATTAGGGCAGAAAAAGAAGG + Intronic
923115686 1:230935585-230935607 TGCAGTGGAGAGGGAAAAGATGG + Intronic
924167030 1:241294693-241294715 GGTATAGAAGAGGAAAAAAATGG - Intronic
924292963 1:242556809-242556831 TATATTAGAGAGTAAAATGAAGG + Intergenic
924512340 1:244738069-244738091 TGTTTGGGAGAGCAAAAAGTGGG - Intergenic
924547223 1:245040896-245040918 TATATTTTAGAGGAAAAAGGTGG + Intronic
924548781 1:245054673-245054695 TGTATTGGCTGGGAAAGAGAAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063945205 10:11169368-11169390 CTTATGGGAGATGAAAAAGATGG + Intronic
1064430996 10:15269733-15269755 TCCATTGGAGAGGAAAGGGATGG + Intronic
1064488699 10:15826348-15826370 TCTATTGGAGAAGCAAAAGATGG + Intronic
1064825158 10:19390199-19390221 TTTATTGGAAAGGAAAGGGAAGG - Intronic
1065036093 10:21639898-21639920 TGTCTTGGGGAGAAAAAGGAGGG + Intronic
1065292565 10:24245633-24245655 TGTCTCGGAAAGGAAAAGGAAGG - Intronic
1066247352 10:33596269-33596291 TCTATTGGAGAGTAATGAGAGGG + Intergenic
1066766047 10:38803835-38803857 TGGATTGGAATGGAAAAAAATGG - Intergenic
1066775185 10:38879971-38879993 TGGATTGGACTGGAAAAAAATGG + Intergenic
1067075309 10:43176198-43176220 TGTTTTGAATAGGAAAAAAATGG + Intronic
1068465588 10:57386257-57386279 TGTATTAGAGAGAAATAAAAAGG + Intergenic
1068763400 10:60736339-60736361 TGTAGTGGAGATGTATAAGAAGG - Intergenic
1070526673 10:77301516-77301538 TGGATGCAAGAGGAAAAAGAAGG - Intronic
1070963659 10:80516492-80516514 TGTATTGGGGAGGAGAATGGTGG + Intronic
1071229784 10:83572103-83572125 GGTAGTGGAGAGGAAAGAGAGGG + Intergenic
1073096579 10:100983814-100983836 TGTCCTGGAGAGGAAGATGAGGG + Exonic
1074214281 10:111369161-111369183 TGCTTTGCAGAAGAAAAAGAAGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1075133261 10:119759031-119759053 TACATTGGAGAGAAACAAGAGGG + Intronic
1075836038 10:125453676-125453698 TACCTTGGAGAGAAAAAAGATGG - Intergenic
1076597704 10:131636045-131636067 CGGATTGGAGAGGAAGATGAAGG + Intergenic
1078416436 11:11170048-11170070 TGTTCTGGAGAGTAACAAGATGG - Intergenic
1079462502 11:20695391-20695413 CGTATTGGACAGGCAAAAGCTGG - Intronic
1080111737 11:28575602-28575624 TGGAATGGAAAGGAAAAGGAAGG - Intergenic
1080127980 11:28759921-28759943 TGTCTGGCATAGGAAAAAGAGGG - Intergenic
1080157112 11:29124479-29124501 TTAGTTGGAGAGGAAAGAGAAGG + Intergenic
1080179183 11:29402482-29402504 TGCATTGGATAGGCAGAAGAGGG + Intergenic
1081261452 11:40966374-40966396 GGGAATGAAGAGGAAAAAGATGG + Intronic
1081323447 11:41718063-41718085 AGTATTGGAGAGCAAGAAAAGGG + Intergenic
1083505146 11:63149743-63149765 AATATTGGAGAGCAAAAGGAAGG - Intronic
1084551340 11:69844517-69844539 GTTAGTGGAGAAGAAAAAGATGG + Intergenic
1085590481 11:77755188-77755210 TGGATTGCAGAGGAGCAAGAAGG + Intronic
1085843706 11:80042376-80042398 TGTACTGGAGAGGAAAGAACAGG - Intergenic
1086316109 11:85594455-85594477 TTTTTTGGAGAGGAATTAGAGGG - Intronic
1086642439 11:89176347-89176369 AGTATGGAAGAGGACAAAGAAGG + Intergenic
1086778278 11:90867583-90867605 TGTAAAGGAGAGGAAAATGTTGG + Intergenic
1088091234 11:106042208-106042230 TGTCTTTGAGAAGAAAAAGGTGG - Intergenic
1088322377 11:108567456-108567478 GGTTTTGGAGAAGAGAAAGATGG - Intronic
1088353767 11:108920201-108920223 TGTAATGGTGATGAACAAGAAGG + Intronic
1088394136 11:109348120-109348142 TTTATTCAAGAAGAAAAAGAAGG - Intergenic
1088745076 11:112798220-112798242 TGTGTGAGAGAGGAAAGAGAAGG + Intergenic
1088969275 11:114757927-114757949 TTTATTGGGGAGGAAATATAGGG + Intergenic
1089271973 11:117307650-117307672 TTTATTGGAGAGGCCCAAGAAGG + Intronic
1089457597 11:118634506-118634528 TGGTTTGGAGAGAAAACAGAGGG + Intronic
1089883409 11:121796315-121796337 AGAGTAGGAGAGGAAAAAGAGGG - Intergenic
1089915808 11:122154731-122154753 TGTGTTGAGGAGGAAAATGAGGG + Intergenic
1090112198 11:123925048-123925070 TATATTGGAAAATAAAAAGAAGG - Intergenic
1090513991 11:127405336-127405358 GCTATTGGAGTGGAAAAACAAGG - Intergenic
1090518647 11:127455338-127455360 TGTATTTGAGAGGAGCATGAAGG - Intergenic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1091232449 11:133997564-133997586 TGGAATGGGGAGGAAGAAGAGGG - Intergenic
1091829354 12:3538624-3538646 TGTGAAGGAGAGGAAAAAGTCGG - Intronic
1091951077 12:4593505-4593527 TGTATTGAAGAGACAAAAAAGGG - Intronic
1092947674 12:13472020-13472042 TGGATTGGAGAGGACAAGGCTGG - Intergenic
1096951312 12:55476572-55476594 TGTATTCTAGAGGAAAAGAAAGG - Intergenic
1097079267 12:56417866-56417888 AGGATTAGAGAAGAAAAAGAAGG + Intronic
1097562528 12:61224951-61224973 GGTATAGGAGAGGGAAGAGAAGG - Intergenic
1097992223 12:65848034-65848056 TTTAGTGGAGAGGCATAAGATGG - Intronic
1098796118 12:74889982-74890004 TGTTTAGGACAGGAAAGAGACGG - Intergenic
1099118141 12:78652847-78652869 TGTATTGCAAATGAAAATGATGG + Intergenic
1099316912 12:81095494-81095516 TGTATTCTAGAGGAAAATGCAGG - Intronic
1099541402 12:83913223-83913245 TGGATTGAAGAGGAAAAACTTGG - Intergenic
1099549975 12:84032028-84032050 TGTAATGGAGAGTAATATGATGG - Intergenic
1099602310 12:84756689-84756711 GGTATTGAAGATGAGAAAGAGGG - Intergenic
1099833053 12:87870066-87870088 AGAAGAGGAGAGGAAAAAGAAGG + Intergenic
1100047963 12:90407902-90407924 GGTATTTCAGAGGAAAATGAGGG - Intergenic
1100533707 12:95485012-95485034 TGTATAGATGAGGAAAATGAGGG - Intronic
1100636354 12:96438219-96438241 TTGATTTGAGAGGAACAAGAGGG + Intergenic
1101233259 12:102763644-102763666 TGTAATGGAGAGTAAACAGCTGG + Intergenic
1101570878 12:105952538-105952560 TGTATTGCAAAGTAAAAAGTGGG - Intergenic
1102394234 12:112574151-112574173 GGTAGTGGAGAAGAAAAAGGGGG + Intronic
1102568294 12:113811644-113811666 GGGAGTGGGGAGGAAAAAGAGGG - Intergenic
1102732148 12:115121090-115121112 GGGATGGAAGAGGAAAAAGAAGG - Intergenic
1103138676 12:118529727-118529749 TTTGTTGAAGAAGAAAAAGAAGG - Intergenic
1103365816 12:120382392-120382414 TGGGTTGGAGAGGAAAGGGAAGG + Intergenic
1104471093 12:129030141-129030163 CTTATGGGAGAAGAAAAAGAAGG + Intergenic
1104517362 12:129440284-129440306 GGTATTTGAGAGGAAAACAAGGG + Intronic
1105683391 13:22752423-22752445 TTTATTGGAGGAGAAAAATAAGG - Intergenic
1106086628 13:26548485-26548507 TGCGTTGGAGAGGAGAAAGGAGG - Intergenic
1106190887 13:27451170-27451192 CTTATTGAAGAAGAAAAAGAGGG - Intergenic
1107763661 13:43710138-43710160 AGGAGGGGAGAGGAAAAAGAGGG + Intronic
1107815123 13:44237896-44237918 TTTATTGCAAAGGAAAAAAAAGG + Intergenic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1108552579 13:51561129-51561151 TCTATTGGATAGGAGAAATATGG + Intergenic
1111264913 13:85796384-85796406 TGCAATTGTGAGGAAAAAGATGG - Exonic
1111368831 13:87289188-87289210 TGAATTGGAAAAGAAAAAAATGG + Intergenic
1111656221 13:91157103-91157125 TGTATTTGGAAGGAATAAGAAGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112376177 13:98843497-98843519 AGAATTGGAGATGTAAAAGAAGG + Intronic
1112685254 13:101817271-101817293 TGTATTAAAGAGAAAAAAAAAGG - Intronic
1113110229 13:106814743-106814765 TGTAGAGGAGAGGAAACACATGG + Intergenic
1113117356 13:106887391-106887413 TTTCATGGACAGGAAAAAGAAGG - Intergenic
1113424857 13:110199551-110199573 TCTAATGGAGAGGAAAATGAAGG + Intronic
1113683967 13:112266364-112266386 TGAATAGGAGTGGAGAAAGAGGG - Intergenic
1113833192 13:113312979-113313001 TGGCTTGAAGAGGAAAAGGAAGG + Intronic
1113973945 13:114212111-114212133 TGGATTTTAGATGAAAAAGAAGG - Intergenic
1114316419 14:21513747-21513769 GATTTTGGAGAGGACAAAGATGG + Intergenic
1115105634 14:29758225-29758247 TGCATTGTGGAAGAAAAAGAGGG + Intronic
1115830263 14:37330770-37330792 TGTATTTTAGTGGTAAAAGAAGG - Intronic
1116794749 14:49378068-49378090 AGTATCGGAGAGGAAAGAGCTGG - Intergenic
1118140440 14:63074652-63074674 TGTATTTAATAGTAAAAAGAAGG - Intronic
1118346230 14:64943043-64943065 TCGAATGGAGAGGAAAAAAAGGG + Intronic
1118975920 14:70676687-70676709 TGTATGGGCGAGGAAAATGAGGG - Intergenic
1120200471 14:81533474-81533496 TGGAGTGGGGTGGAAAAAGAAGG - Intronic
1120455603 14:84726220-84726242 TGAATTGGAATGGAAAATGATGG + Intergenic
1120647391 14:87089992-87090014 TGACTTGGAGAGAAAAAGGAAGG - Intergenic
1121038616 14:90727045-90727067 TGTGAAGGAGAAGAAAAAGAGGG + Intronic
1121912095 14:97800982-97801004 TGTTTTGGAGGAGAAAAAGCAGG + Intergenic
1122581560 14:102775014-102775036 TCAATTGGAGAAGAAAAAGGAGG + Intergenic
1123186552 14:106523229-106523251 TATTTTGGAAAGGAAAAAGTTGG - Intergenic
1123228824 15:17080654-17080676 TGGATTGGAGAGGTAAAGAATGG + Intergenic
1124961259 15:34397387-34397409 TGTATTATATAAGAAAAAGATGG - Intronic
1124977888 15:34543611-34543633 TGTATTATATAAGAAAAAGATGG - Intronic
1125526323 15:40377651-40377673 GGTACTGGAGAGGAGAAAGGTGG + Intergenic
1125680357 15:41526779-41526801 TGGATCAGAGAGGAAGAAGATGG + Intronic
1126674430 15:51147122-51147144 TGTAGGGGAGAGGATAAAGTTGG - Intergenic
1126884245 15:53132644-53132666 TGTATTTTAGAAGAAGAAGAAGG + Intergenic
1127166360 15:56247603-56247625 AGTATAGGCGAGGGAAAAGAAGG + Intronic
1127654833 15:61046148-61046170 TGCATGGGAGAGGGAAAGGAGGG + Intronic
1127961953 15:63896557-63896579 TGATTTGGAGAGGAAGGAGAAGG + Intergenic
1129598397 15:76982696-76982718 TGCCTGGGAGAGGAAAAAAAGGG + Intergenic
1129954288 15:79620313-79620335 TGAATAGGAGTGGAAAGAGAAGG + Intergenic
1129975476 15:79817827-79817849 TGTTTAGGAAAAGAAAAAGATGG - Intergenic
1130088514 15:80799319-80799341 TGGTTAGGAGAGGAAATAGATGG + Intronic
1130400809 15:83551556-83551578 TGGACTGGAGAGGAACCAGAAGG - Intronic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1132330106 15:101006736-101006758 TGTATTTGTGTGGAGAAAGAGGG + Intronic
1133195842 16:4169559-4169581 TGCTTTGGAGAAGAAGAAGAAGG - Intergenic
1133323480 16:4929320-4929342 GGTCTGGGAGAGGAAGAAGAGGG - Intronic
1135331396 16:21562975-21562997 TGTATGGGAGAGAGAAAAGGAGG - Intergenic
1137938713 16:52659893-52659915 TGTGTTGCAGAAGGAAAAGAGGG + Intergenic
1138104808 16:54282352-54282374 TGACTGCGAGAGGAAAAAGAGGG + Intergenic
1138835408 16:60428863-60428885 TGTACTGGAAGGGAAAGAGAAGG + Intergenic
1138839333 16:60480013-60480035 TGAAATGTTGAGGAAAAAGAAGG - Intergenic
1138846274 16:60570977-60570999 AATATTGCAGAGGAAAAACAAGG - Intergenic
1139315420 16:66063624-66063646 TGTATTGGAGAGCAATAATCAGG - Intergenic
1139580448 16:67870335-67870357 AGTATTTGAGATGAAAAAAAAGG - Intronic
1139836197 16:69840568-69840590 TGTATTGGGAAGGAAAATAATGG - Intronic
1140819287 16:78648201-78648223 TGAATTAGAGAGGAAAAAGGTGG - Intronic
1143438289 17:6947086-6947108 TGTCTTGAAGAGTCAAAAGAAGG - Intronic
1143722257 17:8821291-8821313 TTTACTGGAGAGGAAATGGAAGG - Intronic
1143800101 17:9372220-9372242 AGAATAGGAGAAGAAAAAGACGG - Intronic
1143999237 17:11037224-11037246 TGTATTGGAGGGGAAAGGCAGGG + Intergenic
1144149527 17:12429890-12429912 TGTGTGGGAGAGGATGAAGAAGG - Intergenic
1144693473 17:17285027-17285049 TGTTTTTGAGAGGAAAGAGAAGG - Intergenic
1145338051 17:21929760-21929782 TGGATTAGACAGGAAAAAAATGG + Intergenic
1145338809 17:21936081-21936103 TGGATTGGACAGGAACAAAATGG + Intergenic
1145340919 17:21953796-21953818 TGGATTGGACTGGAAAAAAATGG + Intergenic
1145704801 17:26862410-26862432 TGTAATGGACAGGAACAAAATGG + Intergenic
1145704893 17:26863140-26863162 TGTAATGGACAGGAACAAAATGG + Intergenic
1145705718 17:26869782-26869804 TGGAATGGACAGGAAAAAAATGG + Intergenic
1146108126 17:30061875-30061897 TGTATTAGACAGGAATAAAAGGG - Intronic
1146691372 17:34878426-34878448 TGGTTTGGAGAGGAAAGGGATGG - Intergenic
1146767657 17:35538029-35538051 AGAACTGGAGAGGAAGAAGATGG + Intergenic
1147712594 17:42480322-42480344 AGTATAGGAGAGAAAAGAGAAGG - Intronic
1148322118 17:46763536-46763558 CGTATTGGAGAGGAAGCAAAGGG + Exonic
1149868791 17:60165090-60165112 TTTATTGGAGAGGGCAATGAAGG + Intronic
1150105650 17:62460712-62460734 TGTGAAGGAGAGGAAAAAGGAGG - Intronic
1152008474 17:77696720-77696742 TGTAATGGACAGGAAAAAGCAGG + Intergenic
1152300793 17:79494449-79494471 TTTGTTGGTGAGGAACAAGAGGG - Intronic
1152505285 17:80745823-80745845 TGTATTTGAGAAGGGAAAGAAGG + Intronic
1203200916 17_KI270729v1_random:274534-274556 TGGAATGGACAGGAAAAAAATGG + Intergenic
1203210511 17_KI270730v1_random:75235-75257 TGGAATGGACAGGAAAAAAATGG + Intergenic
1153053113 18:919021-919043 AGTAATGGGGAGGAAAAGGAAGG - Intergenic
1153091300 18:1346987-1347009 TGCCTTGGAGAGGAAAATTAAGG - Intergenic
1153538776 18:6133200-6133222 TGTATTGGACAGCAAAGATATGG - Intronic
1153687191 18:7558013-7558035 TCCACTGGAGAGGAAAATGAAGG + Intergenic
1155599109 18:27523757-27523779 TGTAGAGGAGTGGAAAGAGATGG - Intergenic
1155613599 18:27696674-27696696 TGTGTTGGAGTGGAAGAACAAGG + Intergenic
1155649621 18:28125478-28125500 TGTATTGGGGAGGGAAAAAATGG + Intronic
1156792429 18:40991641-40991663 TATATTAGAAAGGAATAAGATGG + Intergenic
1156868510 18:41915960-41915982 GATATTTGGGAGGAAAAAGAAGG + Intergenic
1157004120 18:43560762-43560784 TCTCTTGGAGAGGAAACAAAAGG - Intergenic
1158323851 18:56293324-56293346 TGTACAGGAGAGCAGAAAGATGG + Intergenic
1158573470 18:58616331-58616353 TGCCTTGGACAGGTAAAAGAAGG - Intronic
1158884933 18:61818035-61818057 GAAATTGGAAAGGAAAAAGAAGG - Intronic
1159688326 18:71452408-71452430 TGAAGTAGAGAGGAAAATGATGG + Intergenic
1159738391 18:72133515-72133537 TGTCTTAAAGAGGAACAAGAAGG + Intergenic
1160146532 18:76370269-76370291 TGTATTGGGGAGGAGGAAGTCGG - Intronic
1163976564 19:20858575-20858597 TATCTTGGAGATTAAAAAGAGGG + Intronic
1163992612 19:21013001-21013023 TATGTTTGAGAGGAAAAAAACGG - Intergenic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
1164931019 19:32176129-32176151 AGTATTAGAGAGAAAACAGAAGG + Intergenic
1165015084 19:32874930-32874952 GGTTTTGGAGAGAAAGAAGAAGG - Intergenic
1165581453 19:36868546-36868568 TGTATTGAAAATGAAAAAGTAGG - Intronic
1166146068 19:40836458-40836480 TGGTTTGGAGAGGAAAGAGCAGG + Intronic
1166150169 19:40867392-40867414 TGGTTTGGAGAGGAAAGAGCAGG + Intronic
1166415755 19:42593940-42593962 TGTATTGGAGTAGAAAAATGGGG + Intronic
1168106783 19:54170373-54170395 TGTATTTGTGAGGAAAAAGGGGG + Intronic
1168142650 19:54399534-54399556 TGTAATACAGAGGAAAGAGAGGG - Intergenic
1202699745 1_KI270712v1_random:155221-155243 AGTATTGCAGAGGAACAAGAAGG - Intergenic
925101907 2:1254166-1254188 GGAATTGGAGTGGAAAAAGCAGG + Intronic
925762636 2:7200383-7200405 TGTTTTGTTGAGGAAAGAGAAGG - Intergenic
925962153 2:9027664-9027686 TATATTGAGGAGGAAAAATATGG + Intergenic
926019953 2:9486063-9486085 TTTAGGGGAGAGGAAAAAGTTGG - Intronic
926341487 2:11908357-11908379 TTTATTGAAGAGGAAACTGAGGG + Intergenic
926490702 2:13522848-13522870 TGTTTGGAAGAGCAAAAAGAGGG + Intergenic
926659371 2:15446101-15446123 TGTATTGGGAAGGAGAAACAAGG + Intronic
927237928 2:20894096-20894118 TGGATTGGAGAAGAAAAATGTGG + Intergenic
927261211 2:21092985-21093007 TGGATTGGAGTGAAAAAAGAAGG - Intergenic
927408013 2:22794487-22794509 GGAATTGGAGAGGAAGGAGAGGG - Intergenic
927418819 2:22907945-22907967 TGTTTTGGAGAGAAAGTAGAGGG - Intergenic
927564940 2:24104002-24104024 TGTTTTGGAGAAGAAACAAAAGG + Intronic
928037815 2:27841960-27841982 TGGATTGAAGAGGAAAAAATTGG + Intronic
928687985 2:33768975-33768997 GGGATTAGAGAGGAAAATGAAGG + Intergenic
928690775 2:33796486-33796508 TGTAGTTGATAGGAAAAAAAAGG + Intergenic
929426485 2:41849669-41849691 TAGACTGGAGAGGAAGAAGATGG - Intergenic
929915415 2:46131542-46131564 TGGAGTGGGGAGGAAAGAGAGGG + Intronic
930631336 2:53757856-53757878 TGTATTGCAGAGGGATAAGCTGG - Intronic
930932514 2:56904275-56904297 TGAATAGAAGAGGAAAAAGTGGG + Intergenic
932202334 2:69841791-69841813 TGTATTGCAAAGTAAGAAGAGGG + Intronic
932361222 2:71107669-71107691 TGTGTGGGAGAGGATAAGGATGG + Intergenic
932393870 2:71424742-71424764 TGCTATGGAGATGAAAAAGAAGG - Intronic
932718759 2:74123107-74123129 TATATTATAGAGGAAAATGAAGG + Intergenic
932883023 2:75521857-75521879 TGTGTTGGTGAGGTAAAACAGGG + Intronic
933309154 2:80638637-80638659 TTTATTGGTGAGAAAAAAAATGG + Intronic
933545668 2:83708135-83708157 TGAATAGGAGTGGAGAAAGAGGG + Intergenic
933715625 2:85357817-85357839 TGAATTGGAGAAGGAAAGGAAGG + Intronic
934170688 2:89538709-89538731 AGTATTGCAGAGGAACAAGAAGG - Intergenic
934280991 2:91613029-91613051 AGTATTGCAGAGGAACAAGAAGG - Intergenic
935322418 2:101902062-101902084 TGGCCTGGAGAGGCAAAAGAGGG + Intergenic
935585021 2:104792815-104792837 CCTATTGGAGGGGAGAAAGAGGG + Intergenic
936543201 2:113368739-113368761 AGTATTGGACAGGAAGGAGAAGG + Intergenic
936784426 2:116076768-116076790 TGACTTGAAGATGAAAAAGAAGG - Intergenic
937028558 2:118719268-118719290 TGAAATGGAGAAGAAAAGGAGGG + Intergenic
938044769 2:128108515-128108537 TGTAATTGAAAAGAAAAAGAGGG + Intronic
938323210 2:130379555-130379577 GGCATTGGGGAGGAGAAAGAAGG - Intergenic
938569705 2:132551440-132551462 TGTAATGCTGAGGAAGAAGAGGG + Intronic
938640542 2:133273623-133273645 TGTATGGGAAAGGAAAATTAAGG + Intronic
939370129 2:141288374-141288396 TGCATTGTGGAGGAAAAAAATGG - Intronic
939617894 2:144380800-144380822 TTTTTTGGAGAATAAAAAGAAGG - Intergenic
940943346 2:159588299-159588321 TATATTGTAGATGAAAATGAAGG - Intronic
941208409 2:162604226-162604248 TGCTTTGGTGATGAAAAAGAAGG + Intronic
941453132 2:165683686-165683708 TGTCTTGGGTAGTAAAAAGAGGG + Exonic
941936623 2:170986768-170986790 TGTACTGGAGTGGGAAAAGAAGG + Intergenic
942580509 2:177411876-177411898 TGTATTGCAGAGGGATAAGCTGG + Intronic
943280915 2:185931950-185931972 TGTAATGGACAGGAAATAAAAGG + Intergenic
943343769 2:186712857-186712879 TATTTTGAGGAGGAAAAAGAAGG - Intronic
945349825 2:208764217-208764239 TGAATTGGAGTGGTGAAAGAGGG - Intronic
945685407 2:212962991-212963013 TGTAAATGAGAGGAAAAAAAGGG - Intergenic
945778231 2:214133799-214133821 AGAATTGGAAAGGAAAGAGATGG + Intronic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
946612250 2:221471740-221471762 TGTATTGGAGTGTACAATGAAGG + Intronic
946676905 2:222169976-222169998 TCTATTAGAATGGAAAAAGAAGG + Intergenic
947008086 2:225535530-225535552 GAGATTGGAGAGGAAAAAGAAGG + Intronic
947644584 2:231729075-231729097 TGTGTTGGGGAGGAGAAAGGGGG - Intergenic
948200344 2:236125496-236125518 TATATTAGAAAGGAAAAAGAAGG + Exonic
1168798710 20:630047-630069 TGTACTTGATAGAAAAAAGAAGG + Intergenic
1169715280 20:8609528-8609550 TAAATTGAAGAGAAAAAAGATGG - Intronic
1170434221 20:16308567-16308589 TGTCTTGGGGAGGAGAAAGAGGG - Intronic
1170915626 20:20621786-20621808 TATATTTGAGGGGAACAAGAGGG + Intronic
1171014096 20:21524047-21524069 TGTTTTGAAGATGAAAAGGAAGG - Intergenic
1171301540 20:24065233-24065255 TGTATGGATGAAGAAAAAGAGGG - Intergenic
1172179924 20:32996644-32996666 TGGATTGGAGTGTAAATAGATGG - Intronic
1172191924 20:33067237-33067259 TGTCTTGGAGAGGAAAGAAAAGG + Intronic
1172434170 20:34916833-34916855 TGTACGGGAGAGGAATATGAGGG - Intronic
1172486444 20:35300889-35300911 GGTATTGGGAGGGAAAAAGAGGG - Intergenic
1172631167 20:36379136-36379158 TGTGCTTGAGAGGACAAAGAGGG - Intronic
1172915280 20:38438948-38438970 AGTATTAGAAATGAAAAAGAAGG + Intergenic
1173077992 20:39839311-39839333 TTTATTGAAGAGGAAAGAAAAGG + Intergenic
1174544476 20:51315018-51315040 TGTATTGGAGAGTTATAGGAAGG - Intergenic
1174701591 20:52614599-52614621 TATATTGGAAAGGGAAGAGAAGG - Intergenic
1175412627 20:58780847-58780869 TGGAGGGGAGAGGAGAAAGAGGG + Intergenic
1176756663 21:10730762-10730784 TGGATTGGAGAGGAAAGGAATGG - Intergenic
1177122160 21:17151236-17151258 TGAATAGGAGTGGTAAAAGAGGG + Intergenic
1177397048 21:20549898-20549920 TGGATGGTAGGGGAAAAAGAGGG - Intergenic
1177827482 21:26100630-26100652 TGTATTTTAGAGGAGAAAGTTGG + Intronic
1178928355 21:36794477-36794499 GGGATTGGAGAGGAACAAAAAGG + Intronic
1178968723 21:37150631-37150653 TTTACTGAAGAGGAACAAGAGGG - Intronic
1179807358 21:43848076-43848098 TGCATTAGAGAGGATAAAGGTGG - Intergenic
1181537471 22:23554005-23554027 TGTCTTGGAAGGGAAAAGGAAGG - Intergenic
1181856108 22:25782610-25782632 TGTCGGGGAGAGGAAAAAGTGGG + Intronic
1181914951 22:26272589-26272611 TGCCTTAGAGAGGAAAAAGCAGG + Intronic
1182379225 22:29872803-29872825 TCAAATGGAGAGGAAAAGGAGGG + Intergenic
1182836913 22:33349645-33349667 GGAATTGGAAAGGAAAAGGAAGG - Intronic
1203306537 22_KI270736v1_random:113156-113178 TGGATTGGAGAGGAATAAAAAGG + Intergenic
1203307330 22_KI270736v1_random:118441-118463 TGTATTGGAGTGGAGTGAGATGG + Intergenic
1203308085 22_KI270736v1_random:123634-123656 TGTATTGGAGATGAAAGGAATGG + Intergenic
1203308493 22_KI270736v1_random:126117-126139 TGGATTGGAGTGGAAAGGGATGG + Intergenic
949155930 3:827263-827285 TGGAATGGAGAGGAAAAAGTGGG + Intergenic
949495949 3:4632326-4632348 AGTATAGGAGAGGAAAGAGTTGG - Intronic
950680034 3:14578874-14578896 TTTATTGGAGAGGAAATTGAGGG - Intergenic
951069245 3:18306980-18307002 TCAATGGAAGAGGAAAAAGAAGG + Intronic
951422601 3:22505120-22505142 TGTTTTGGAGAGGATAAATGTGG - Intergenic
951741060 3:25923834-25923856 TGTCTTGTAGAGGATGAAGAAGG + Intergenic
952212021 3:31237498-31237520 TCTATTGCAGGGGAAAAAGAAGG + Intergenic
952265406 3:31780920-31780942 AGTATTGCAGAAGATAAAGAGGG + Intronic
952773447 3:37022485-37022507 TGGATTGGAGAGGAGCAAGATGG + Intronic
952962274 3:38599895-38599917 TGTGGGGGAGGGGAAAAAGAGGG + Intronic
953161372 3:40423211-40423233 TTTATGGGTGAGGAATAAGAAGG - Intronic
953842389 3:46399564-46399586 TCTAATAGAGAGGAAAAAGTTGG + Intergenic
953908509 3:46880721-46880743 TGTCTTGAAGAAGAAGAAGAAGG + Intronic
953971542 3:47352314-47352336 GTTATTGGAGAGGAGGAAGAAGG - Intergenic
954229058 3:49202261-49202283 TGTGTTGCAGAGAAAAAAGCAGG + Intronic
955133871 3:56196837-56196859 TGTTTTGGAAAGGACAAAGCGGG - Intronic
955572747 3:60325790-60325812 TGTAGTGGAGAGGACCAGGAAGG + Intronic
955607127 3:60717140-60717162 GGTGTGGGAGAGGAAAAAAATGG + Intronic
956059622 3:65336352-65336374 TGTATTGGATGGGAAATAAAAGG + Intergenic
956345020 3:68269025-68269047 TGTGTTAGAGATGAGAAAGAAGG - Intronic
956946814 3:74232672-74232694 TGGATTGGAGAGGACTAACATGG + Intergenic
957804530 3:85130334-85130356 TGTATTGGTAAGGAAAACTATGG - Intronic
957924234 3:86788249-86788271 TGGCTTGGAAAGAAAAAAGAGGG - Intergenic
957938894 3:86978941-86978963 TGGTTTGGGGAGGAAAAAGATGG - Intronic
958696170 3:97529424-97529446 TGTATTGGAAAAGAAAAAAAAGG + Intronic
958831498 3:99095993-99096015 TGAATTTGAGAGGAAGAAAATGG + Intergenic
959343569 3:105162841-105162863 TTTATTTCAGAGGAAAATGAAGG - Intergenic
959646172 3:108704536-108704558 TGGATTAGGGAGGAAAAAAATGG + Intergenic
960623378 3:119657467-119657489 TGTATGGAAGGGGGAAAAGAAGG + Intronic
960754641 3:120998185-120998207 TGAATTGGAGTGGTAAAAGGGGG - Intronic
961022988 3:123525215-123525237 TCTCTTGGAAAGGAAAAAGGTGG + Intronic
962975547 3:140442824-140442846 TGGGCTGGAGAGGTAAAAGAAGG - Intronic
963057488 3:141198549-141198571 TGAATAGGAGTGGCAAAAGAGGG - Intergenic
964268165 3:154923837-154923859 TATATTAGAAAAGAAAAAGAAGG + Intergenic
964708612 3:159647408-159647430 TGGATTGAAGAAGAAAAACAAGG + Intronic
965134590 3:164745726-164745748 TGTCTTGGGGAGGAAAATCACGG - Intergenic
965387771 3:168065127-168065149 TTTATTACTGAGGAAAAAGAAGG - Intronic
965523179 3:169689303-169689325 TGTATTGGAGTGGTAAGAAATGG - Intergenic
966045304 3:175541660-175541682 GGTATTTGAGGGGAAAAAAAAGG - Intronic
967155814 3:186691347-186691369 TGTATTGAAATGGAAAAACAAGG + Intergenic
967224565 3:187278698-187278720 CGTATGGGAGAGGAAAAAGGAGG - Intronic
967263175 3:187665247-187665269 TGTCCTGGAGTGGAAAAAAAGGG - Intergenic
967345257 3:188448075-188448097 TATATTGGATTGTAAAAAGAGGG + Intronic
967535546 3:190597994-190598016 TAAATTGGAGAGAAAAAGGAAGG - Intronic
967638996 3:191838609-191838631 TGAATAGGAGAGGTAAGAGAGGG - Intergenic
967892205 3:194371478-194371500 AGGATGGAAGAGGAAAAAGAGGG - Intergenic
969029104 4:4197169-4197191 AATATTGCAGAGGAACAAGAAGG + Exonic
969949936 4:10825335-10825357 TGAATAGGAGTGGAGAAAGAGGG + Intergenic
970173382 4:13311367-13311389 TGAATAGGAGAGGTGAAAGAGGG - Intergenic
970368379 4:15383980-15384002 AATCTTGGAGAGGAAAGAGATGG + Intronic
970792994 4:19881160-19881182 TGAATTGGAGAGGGAAAATAAGG - Intergenic
971383253 4:26119284-26119306 TGGATTGGGGAGGAAAACAATGG - Intergenic
972102480 4:35439321-35439343 TGTATTTTATAGGAAAGAGAGGG - Intergenic
972135206 4:35884502-35884524 TGCAATGGAGAAGAAAGAGAAGG + Intergenic
972291339 4:37692859-37692881 TGGAAGGGAGAGGCAAAAGAAGG + Intergenic
972316946 4:37935610-37935632 TGAATTGGAGAGGGAGAAGATGG - Intronic
972506769 4:39727228-39727250 TGTATTGTGTAGGAAAAACATGG + Intronic
972546558 4:40085630-40085652 TTTTTTGTAGAGGGAAAAGAGGG + Intronic
973092140 4:46149946-46149968 TTTATAGGAGAGAAAAAAAAAGG + Intergenic
973310192 4:48701453-48701475 AGAAAAGGAGAGGAAAAAGAAGG + Intronic
974128007 4:57719226-57719248 TGAATAGGAGAGGCAAGAGAGGG - Intergenic
974579682 4:63780140-63780162 ATTATTTGAGATGAAAAAGATGG - Intergenic
974663869 4:64932537-64932559 TGTATTCATGGGGAAAAAGAAGG - Intergenic
974813486 4:66976058-66976080 TGTATAGGAAATGGAAAAGAGGG - Intergenic
975114966 4:70670284-70670306 TGTAGGGGAGAGGAAAAGAAAGG - Intronic
975914606 4:79309306-79309328 TGTTTTTGAAAGGAAAAAAATGG - Intronic
975967354 4:79990023-79990045 TATATTGAACAGGCAAAAGATGG + Intronic
976465808 4:85367559-85367581 GGTATTGTAGAGGAAAAGGGGGG + Intergenic
976498872 4:85763046-85763068 TGTATTGAAGATGCAAAAAATGG - Intronic
976536517 4:86223665-86223687 TGTGGTGCAGAGGAAGAAGAGGG - Intronic
977023124 4:91780971-91780993 AGTAATGGAGAGGAAAAATCTGG + Intergenic
977264155 4:94834455-94834477 GGAGGTGGAGAGGAAAAAGAAGG - Intronic
977468967 4:97418220-97418242 TGAATAGGAGTGGCAAAAGAGGG - Intronic
977607980 4:99001686-99001708 TTTATTGAAGAGTAAACAGAAGG - Intronic
977645762 4:99410021-99410043 TGTGTTAGAGAGAAAAAAGAGGG - Intergenic
977737526 4:100434978-100435000 TGAATAGGAGTGGTAAAAGAGGG - Intronic
977993251 4:103470249-103470271 TGGATTGGATATGAAAAACAAGG + Intergenic
978042866 4:104091873-104091895 TCTTATGGAGAGGAAAAAAAAGG + Intergenic
978051248 4:104202979-104203001 TGAATAGGAGTGGTAAAAGAGGG - Intergenic
979002701 4:115245243-115245265 TTTATTGGAGAGTGAAAAGAGGG - Intergenic
979126513 4:116980039-116980061 TGTATTCCAGAGGAAGGAGAGGG - Intergenic
979416061 4:120440425-120440447 TGTACTAGAGATGAAAGAGATGG + Intergenic
980696156 4:136358927-136358949 TGTATTGTGGGGGAAAAGGAAGG + Intergenic
980922952 4:139105452-139105474 TGTTTTGGGGAGTAAAAGGATGG - Intronic
981701625 4:147613675-147613697 TGTGTTGGAAAGGAGAAAAAAGG + Intergenic
983013036 4:162573145-162573167 TGTATTGGAGGAAAAAAAAATGG + Intergenic
983289877 4:165788673-165788695 GGTTTAGGAGAGGAAAAATATGG - Intergenic
983482288 4:168289935-168289957 TGCATTGTAGAGGCAAAACAGGG - Intronic
984640895 4:182163236-182163258 TGGATTGGAGAGACGAAAGACGG - Intronic
986477019 5:8144807-8144829 TGGATTGTAAAGGACAAAGAAGG - Intergenic
986637787 5:9840392-9840414 TGGATGGTAGAGGAGAAAGATGG - Intergenic
986965469 5:13265452-13265474 TGTATTGGTGAAAAAAATGATGG + Intergenic
987147778 5:15009182-15009204 TGGAGGGCAGAGGAAAAAGATGG + Intergenic
987709310 5:21488504-21488526 TGTATGAGAGCTGAAAAAGAAGG - Intergenic
988212575 5:28224818-28224840 TTTAATGGAGAGGAAGTAGAGGG - Intergenic
988469822 5:31527451-31527473 TGTAAAGGGGAGGACAAAGAAGG - Intronic
988672593 5:33397781-33397803 TGTATTGTAGAGAAAATAGCTGG + Intergenic
988750302 5:34185653-34185675 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
989068386 5:37485394-37485416 TGTATGAGAGCTGAAAAAGAAGG - Intronic
990296405 5:54405935-54405957 TATATTGGAGAGGAACTAAAGGG + Intergenic
990478313 5:56183836-56183858 TGTATTGGAAAGGAACCTGAGGG + Intronic
991067523 5:62440200-62440222 TGTAATGGAGACCCAAAAGAGGG + Intronic
991665256 5:68993302-68993324 GGAAGTGGACAGGAAAAAGAAGG + Intergenic
991738563 5:69648855-69648877 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991759633 5:69907567-69907589 TGTATGAGAGCTGAAAAAGAAGG - Intergenic
991787701 5:70210545-70210567 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991790138 5:70228595-70228617 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991814886 5:70503692-70503714 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991818022 5:70524970-70524992 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991838862 5:70782633-70782655 TGTATGAGAGCTGAAAAAGAAGG - Intergenic
991880146 5:71210912-71210934 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991882586 5:71228938-71228960 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
991965078 5:72082711-72082733 TCTATTAGAAAGTAAAAAGATGG - Intergenic
992174125 5:74133120-74133142 TGTGTTGCAGAGGAAGAAAAAGG + Intergenic
992401081 5:76412017-76412039 TGTCCTGGAGAGAAAAAAAATGG - Intronic
992425065 5:76648358-76648380 TGTTTTGGCAAGGAAAAAGTGGG - Intronic
992509403 5:77418305-77418327 TGCATTGCAGAGGAAAGAGTTGG - Exonic
993973379 5:94446979-94447001 TGTGTAGGAGAGCAAAAAGGAGG + Intronic
994310370 5:98262247-98262269 AATATTGGAGAGGAAGAGGAAGG - Intergenic
994327015 5:98459881-98459903 TGTATAGCAGAGCAGAAAGATGG - Intergenic
994421433 5:99529836-99529858 TGTATGAGAGCTGAAAAAGAAGG - Intergenic
994485611 5:100384475-100384497 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
994697780 5:103094219-103094241 TGTAATATTGAGGAAAAAGATGG + Intronic
994818842 5:104622075-104622097 TGCATTGGAGGGCAAAAAGTAGG - Intergenic
995155154 5:108902170-108902192 TCTATTAAAGAGGAAAAAAACGG + Intronic
995302565 5:110601254-110601276 TGAATAGGAGTGGTAAAAGAGGG - Intronic
995734513 5:115285747-115285769 TTTTTTGGAGAGGAAATTGATGG + Intronic
996624501 5:125553763-125553785 TGTAATGCACATGAAAAAGAGGG + Intergenic
996952895 5:129149204-129149226 TGAATTGGAGTGGTAACAGAGGG + Intergenic
996971055 5:129368458-129368480 TTTATTGAAAAGCAAAAAGAGGG + Intergenic
998687161 5:144541399-144541421 TTTATTGGAGAGGCAATGGAAGG + Intergenic
998731267 5:145080211-145080233 TATATTGCAGAAGAAAGAGAAGG + Intergenic
999549039 5:152663663-152663685 TGTGTAGGAGAAGAGAAAGAGGG + Intergenic
999773553 5:154793428-154793450 TATTTTAGAGATGAAAAAGAGGG + Intronic
999843269 5:155451487-155451509 GGTATTAGAGAAGTAAAAGATGG - Intergenic
1000207377 5:159075432-159075454 TGTTTTGAAAAGGAAAATGAAGG - Intronic
1000594011 5:163193333-163193355 GGAATTGGTGAGGAAAAAAATGG - Intergenic
1000686835 5:164260525-164260547 AGTAGAGGAGAGGAAAGAGAAGG + Intergenic
1001024020 5:168207828-168207850 TGTTTTGGAGAGACAAAGGAAGG - Intronic
1001162583 5:169334109-169334131 GGTTTTGGAGAGAAGAAAGAAGG - Intergenic
1001854047 5:174995399-174995421 TGAAGTGGAGGGGCAAAAGAGGG + Intergenic
1002117590 5:176975865-176975887 AGTAAAGGAAAGGAAAAAGAGGG + Intronic
1002565068 5:180108099-180108121 TGTGGAGGAGAGGAAAAAGAGGG - Intronic
1003915439 6:10782480-10782502 TGAATGGGAGAGAAAACAGAAGG - Intronic
1004216365 6:13707996-13708018 TGGATTGCAGAGGAACAACAGGG - Intronic
1004800828 6:19145282-19145304 TGTATGGGAGAGGGTAAACAAGG - Intergenic
1005302960 6:24489076-24489098 AGAATGGGAGAGGAACAAGATGG - Intronic
1005378053 6:25205027-25205049 TTTCTTGGAAAGGACAAAGAAGG + Intergenic
1005548371 6:26891958-26891980 TGTATGAGAGCTGAAAAAGAAGG + Intergenic
1005960500 6:30689946-30689968 TGGATTGGAGGGGCAAAATATGG - Intronic
1007265408 6:40591895-40591917 TGTACAGGAGAAGAGAAAGAAGG + Intergenic
1007417347 6:41699496-41699518 GCTTTTGGAGAGGAAACAGAGGG - Intronic
1008160494 6:48069283-48069305 TGAATTGAAGAGGAAATAAATGG + Intergenic
1008936829 6:57000695-57000717 TGGTTTGGAGAGGAAAGAGCAGG + Intronic
1009456673 6:63865033-63865055 GGTCTTGGAAAGGAAAACGAAGG - Intronic
1010593597 6:77738117-77738139 TGTGTTGGAGAGTTAAAGGATGG + Intronic
1010858886 6:80879655-80879677 TGCATTGAATTGGAAAAAGAAGG - Intergenic
1011163618 6:84420622-84420644 TCTTTTGGATAGGAAAAAGGTGG + Intergenic
1011769716 6:90661988-90662010 TTTATAGGTGAGGAAACAGAAGG - Intergenic
1012802994 6:103857846-103857868 TCTAGTGGTGAGGAAAAAAATGG - Intergenic
1013119193 6:107126370-107126392 TGTATTGGAGAAGAAATGGGTGG - Intergenic
1013165002 6:107581812-107581834 AGAATTGGAGAGGAGAAAAAAGG - Intronic
1013326885 6:109055245-109055267 AGGATTGGAGAGGAAAGTGAAGG - Intronic
1013443249 6:110192763-110192785 GGTACTGGAGAGGAAACAAAAGG - Intronic
1013870802 6:114757308-114757330 TGTACTAGAGAAGAAACAGAAGG - Intergenic
1014973970 6:127855584-127855606 ACAATTGGAGATGAAAAAGAGGG + Intronic
1015186942 6:130428345-130428367 TGTATTGGGGAAGAAAATTATGG - Intronic
1015711371 6:136144956-136144978 TTAATTGGAGAAGAAAAAAATGG - Intronic
1016121659 6:140350101-140350123 TGTACAAGAGTGGAAAAAGAAGG - Intergenic
1016507543 6:144799543-144799565 TGTATGGGAGAGGGAATAGCTGG + Intronic
1017947461 6:159107313-159107335 TTTATGGGAGAGGAAGAAGTGGG + Intergenic
1017983065 6:159419689-159419711 TGCATTGCAGATGAAAAAAATGG + Intergenic
1018090631 6:160344877-160344899 TATATTGTAGAGTAAAAAAAAGG + Intergenic
1018590729 6:165418668-165418690 GATATTGGAGAGGAAAAGGAAGG - Exonic
1018661910 6:166095914-166095936 TGAATAGGAGTGGTAAAAGAAGG + Intergenic
1020626869 7:10592096-10592118 TGAATTGAATAGGGAAAAGAAGG + Intergenic
1020789774 7:12612735-12612757 TGAATTGGTGAGGAACAAAACGG - Intronic
1021968223 7:25943076-25943098 AGGATGGCAGAGGAAAAAGATGG + Intergenic
1023153220 7:37222003-37222025 TATACAGGAGAGGAAACAGATGG + Intronic
1023340005 7:39210045-39210067 TTTATTGTACAGGAAAGAGATGG - Intronic
1024373536 7:48612924-48612946 TGTATTGTAGAGAAAAACGAGGG - Intronic
1024797186 7:53035030-53035052 TTTTTTGGACATGAAAAAGAAGG + Intergenic
1024981177 7:55158882-55158904 TGTAGGAGAAAGGAAAAAGATGG + Intronic
1025221451 7:57113395-57113417 CTCATTGCAGAGGAAAAAGAAGG - Intergenic
1025632237 7:63285065-63285087 CTCATTGCAGAGGAAAAAGAAGG - Intergenic
1025650322 7:63461164-63461186 CTCATTGCAGAGGAAAAAGAAGG + Intergenic
1026081378 7:67224546-67224568 TGTTTTGGGGAGAAAAAAGAAGG - Intronic
1026659258 7:72284932-72284954 GGTACTGTAGAGGAAAAAAAAGG - Intronic
1026695703 7:72589453-72589475 TGTTTTGGGGAGAAAAAAGAAGG + Intronic
1028343852 7:89756131-89756153 TGTATTGGAGGGGACAAAGTGGG - Intergenic
1028361232 7:89969323-89969345 AGAATTGGAGAGAAAAATGATGG - Intergenic
1028427598 7:90707448-90707470 TGGATTGGAGAGGTGAAGGAAGG - Intronic
1028547405 7:92019143-92019165 TGTCTTGGAGAAAAAAAAAAAGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030433087 7:109477762-109477784 TGACTTGGAGAGAAAAAAGTTGG - Intergenic
1030441149 7:109591606-109591628 TTTATTGGAGAGGAAGACGAAGG + Intergenic
1031225580 7:119033779-119033801 TCTCATGGAGAGGAAACAGAAGG - Intergenic
1031375115 7:121014954-121014976 TGAATTGACAAGGAAAAAGAAGG - Intronic
1031411910 7:121449331-121449353 TGTATAGGATAGGAGAAGGATGG + Intergenic
1032034808 7:128513912-128513934 TGTGAAGGAGAGGAAAAAGGAGG - Intergenic
1032202771 7:129834492-129834514 TGAAATGGAGAGGAAAAACTTGG - Exonic
1032431304 7:131864345-131864367 TGTTTTGGAAAGCAAAATGAAGG - Intergenic
1033226676 7:139568313-139568335 TGGAATTCAGAGGAAAAAGAAGG - Exonic
1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG + Intronic
1033940945 7:146652811-146652833 TGTGGTTGGGAGGAAAAAGAAGG + Intronic
1034073463 7:148209671-148209693 TGCATTGGAAAGAGAAAAGAGGG - Intronic
1036239722 8:7071639-7071661 TGTGTCGGAGAGAGAAAAGATGG + Intergenic
1036407415 8:8467645-8467667 TGCATTGGAGAGAGAAAATAAGG - Intergenic
1037155221 8:15691548-15691570 TGCATTGGAGTGGTAAGAGAAGG + Intronic
1040624355 8:49129271-49129293 TATTTTGGAAAGAAAAAAGAAGG + Intergenic
1040625301 8:49140945-49140967 TGTATAAGAGAGGGAAAAAAAGG + Intergenic
1040928176 8:52707509-52707531 TGGATTAGAAAGGAAAAAAATGG - Intronic
1041152867 8:54954678-54954700 TGATCTGGGGAGGAAAAAGAGGG - Intergenic
1041844733 8:62315391-62315413 TTTATTGCAAATGAAAAAGAAGG + Intronic
1041886706 8:62817421-62817443 TGAATCTGGGAGGAAAAAGAGGG - Intronic
1041938087 8:63356860-63356882 TGTTTTGAAGAAGAAATAGAAGG - Intergenic
1042106599 8:65333922-65333944 TGCATTCCAGAAGAAAAAGAAGG + Intergenic
1042131849 8:65595010-65595032 TGGATTGGAGAGGAGAAAAGTGG - Intergenic
1043089425 8:75878699-75878721 AGTAGTGGAGAGAAAAAATAGGG - Intergenic
1043359322 8:79452539-79452561 TCCATTGGAGAGCAAAATGAAGG + Intergenic
1044216851 8:89622439-89622461 TATACTGAAGAGGAAAAAAAAGG + Intergenic
1044278158 8:90326058-90326080 TGTCTTGGAGTGGAGAATGAAGG + Intergenic
1044556530 8:93568390-93568412 TGTGTAGTAAAGGAAAAAGAAGG + Intergenic
1044861093 8:96524733-96524755 TGTATTGGAAAGGAGAAAAAAGG - Intronic
1045078443 8:98597072-98597094 TGTTTTGGAGAGGTGAAAAAAGG + Intronic
1045364128 8:101459928-101459950 TGAAGTGGGGAGGAAACAGAAGG + Intergenic
1045422994 8:102035152-102035174 TGAATTTAAGAGGAAAAAGGTGG - Intronic
1045487790 8:102645769-102645791 TGTCTTGGGGGGGAAAAAAAGGG + Intergenic
1045581891 8:103490852-103490874 TGAATAGGAGTGGTAAAAGAGGG - Intergenic
1045676757 8:104615511-104615533 TGTCATGGAGAGGAAACAAACGG - Intronic
1045715054 8:105033335-105033357 TGTCTCTGAGAGGAGAAAGATGG - Intronic
1045875705 8:106978485-106978507 GGGAAAGGAGAGGAAAAAGATGG + Intergenic
1046070259 8:109243690-109243712 TTTATTTAAGAGGAAAAAAATGG - Intronic
1046142870 8:110118626-110118648 TGTATTTTAGAGTAAAAATAAGG - Intergenic
1046687247 8:117241453-117241475 TATATTGAAGAGGAAACAAAAGG - Intergenic
1047795445 8:128250434-128250456 TCCAGTGGAGTGGAAAAAGAAGG - Intergenic
1047879945 8:129181982-129182004 TGTTTTTGAGAGGTAATAGATGG + Intergenic
1048124798 8:131622060-131622082 TGAATAGGAGAGGAGAGAGAGGG + Intergenic
1050178308 9:2892748-2892770 TGTAGTTAAGAGGATAAAGATGG - Intergenic
1050197433 9:3101475-3101497 TGCATTGGAGATGAAGAAGAGGG + Intergenic
1050353716 9:4763529-4763551 TGTGGTGGACAGGAAAAAGGGGG + Intergenic
1051049087 9:12910097-12910119 TGAATTGGAAAGTCAAAAGAAGG + Intergenic
1051279449 9:15426987-15427009 ATTATTGGTGAGGAAAAGGAAGG - Intronic
1051352526 9:16212009-16212031 TGACTGGGAGAAGAAAAAGAAGG + Intronic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052439221 9:28472057-28472079 TGACTTGGAAAGAAAAAAGAGGG + Intronic
1052457374 9:28717540-28717562 TGTGTGGGAGAGAAAAGAGAGGG - Intergenic
1052602627 9:30655559-30655581 TTTAATAGAGAGGAAAGAGAAGG - Intergenic
1052778494 9:32756282-32756304 TTTATTGGAGAATCAAAAGAGGG + Intergenic
1052850123 9:33373162-33373184 TGTCTTGGAGAGGCCAGAGAAGG + Intergenic
1053387574 9:37706854-37706876 GGTACAGGAGAGGAAAAACATGG - Intronic
1053847769 9:42257984-42258006 TGCATTGGAGAGGGAATAAATGG - Intergenic
1055492590 9:76820791-76820813 TGGTTGGGAGAGGAAAAAGTAGG + Intronic
1056168353 9:83959494-83959516 TCTATTGGGAAGGAAAAAGCAGG - Intergenic
1056212314 9:84376258-84376280 GGTAGTGGAATGGAAAAAGAAGG - Intergenic
1056458558 9:86787145-86787167 TGTATAGGTGACGAAACAGAGGG - Intergenic
1058430540 9:104914639-104914661 TGTAGTGGAGAGTAGGAAGATGG - Intronic
1059523460 9:114966130-114966152 CCCATTGGAAAGGAAAAAGAGGG + Intergenic
1059848119 9:118304088-118304110 TGTATTGGAGAGGCAGAGAATGG - Intergenic
1060547346 9:124469163-124469185 GGTCCTGGAGAGGAAAAAGCAGG + Intronic
1060702517 9:125770022-125770044 TGTATAGAAGAGGAAATGGAAGG + Intronic
1060816713 9:126639004-126639026 AGAATTGGAGAGGAGAGAGAAGG + Intronic
1061244521 9:129394584-129394606 TGTCTTGGAAGGGAAAAGGATGG + Intergenic
1061464458 9:130766678-130766700 TGTATCGGACAAGAAAGAGAGGG - Intronic
1061616282 9:131781665-131781687 TGTAAAGGAGAGAAACAAGAGGG + Intergenic
1203391289 Un_KI270438v1:99526-99548 TGGAATGGAGTGGAAAAAAATGG + Intergenic
1203677610 Un_KI270756v1:36308-36330 TGGATTGGACTGGAAAAAAATGG - Intergenic
1203679398 Un_KI270756v1:50705-50727 TGTAATGGACTGGAAAAAAATGG - Intergenic
1185728122 X:2439272-2439294 TGGACTGCAGAGGAAAGAGAGGG + Intronic
1186310587 X:8313629-8313651 TGTGTTGAAGAGTAAAATGAAGG - Intergenic
1186876119 X:13819954-13819976 GGCATATGAGAGGAAAAAGAGGG + Intronic
1187089187 X:16076663-16076685 TCTACTGCAGAGGAAAAAGCAGG + Intergenic
1187229316 X:17405646-17405668 TTTTTTGGAGAGGACAAAGGAGG + Intronic
1187508124 X:19893693-19893715 TTTACTGAAAAGGAAAAAGAGGG - Intergenic
1189233973 X:39473732-39473754 TTTATTGGAGATGGAAAAGGGGG + Intergenic
1190397875 X:50003236-50003258 TGCACTGGAGAGGGAAGAGAAGG - Intronic
1191028391 X:55940480-55940502 TGAATAGGAGTGGTAAAAGAGGG - Intergenic
1192198682 X:69049582-69049604 TGTATTGTGGGGGAAAAATAAGG - Intergenic
1193057328 X:77167597-77167619 TGTATAGGAGTGGTAAAAGTGGG + Intergenic
1193536461 X:82722002-82722024 AGTAATAGAGAGGAAAAAAATGG + Intergenic
1193689088 X:84618013-84618035 AGAATTGGAGAGGGAAAAGGAGG - Intergenic
1193836046 X:86345269-86345291 TTTATTGGCCATGAAAAAGAAGG - Intronic
1194365809 X:93012185-93012207 TATATTGGAGAGGAAGAAAGAGG - Intergenic
1194536788 X:95115383-95115405 TGAATAGGAGTGGAAAGAGAGGG + Intergenic
1194638070 X:96370014-96370036 TGTATGAGTGAGGAAAAGGAAGG - Intergenic
1194834308 X:98661996-98662018 TGAATTGGGGAAGAAAAAGACGG + Intergenic
1195670513 X:107466061-107466083 TGTATTTGAGGAGGAAAAGAAGG - Intergenic
1196513272 X:116539781-116539803 TGTATAGGAGAGGAAGAAAAAGG - Intergenic
1197397624 X:125946436-125946458 TGTAATGAAGAAGAAAAGGAAGG + Intergenic
1197928717 X:131673807-131673829 TGTAATGGAGAGGCAAGAGAGGG - Intergenic
1198142173 X:133815269-133815291 TGTATGGAGGAGGAAAGAGATGG - Intronic
1198142410 X:133817682-133817704 TGTATGGAGGAGGAAAGAGATGG + Intronic
1198680987 X:139181957-139181979 TGTGTTGGAGAGGGAGAAGAGGG - Intronic
1199669499 X:150131262-150131284 TGGATTGAACAGGAAAATGAAGG + Intergenic
1199697808 X:150355604-150355626 TGTATTGGAGAGGACAAGACTGG + Intergenic
1199718118 X:150521658-150521680 TGTATTTGGGAGAAGAAAGAGGG + Intergenic
1199865695 X:151848162-151848184 GGGATGAGAGAGGAAAAAGAGGG + Intergenic
1199988251 X:152968037-152968059 TACATTGGGGAGGAAAAGGAAGG + Intronic
1200079560 X:153569247-153569269 TGTGTTGGAGAGGAAAAACAAGG + Intronic
1200674031 Y:6128432-6128454 TATATTGGAGAGGAAGAAAGAGG - Intergenic
1201138229 Y:11006965-11006987 TGGAATGGAGAGGAAAGAAATGG - Intergenic
1201138586 Y:11009471-11009493 TGGAGTGGAAAGGAATAAGATGG - Intergenic
1201197807 Y:11511384-11511406 TGGAATGGAGAGGAAAAGAATGG + Intergenic
1201207157 Y:11643372-11643394 TAGATTGGAGTGGAAAAAAATGG + Intergenic
1201337450 Y:12895881-12895903 TCTAATGGGGAGGAAGAAGAGGG - Intergenic
1201395513 Y:13543774-13543796 TGTATTGAATAGGAAAAAGCTGG + Intergenic
1201927768 Y:19308130-19308152 TGTAAAGAAGAGGAAAGAGAGGG - Intergenic
1202100746 Y:21305141-21305163 TGTAATGGACAGGACAAAAAGGG + Intergenic
1202606563 Y:26644252-26644274 TGGATTGGAGAGGAAAGAAGTGG + Intergenic