ID: 1111750687

View in Genome Browser
Species Human (GRCh38)
Location 13:92328025-92328047
Sequence CTGTGCTTCTTCAGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111750682_1111750687 14 Left 1111750682 13:92327988-92328010 CCTGATCCTCTTTGAAATGTACT 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 225
1111750679_1111750687 24 Left 1111750679 13:92327978-92328000 CCCAGCCAGGCCTGATCCTCTTT 0: 1
1: 0
2: 1
3: 55
4: 479
Right 1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 225
1111750683_1111750687 8 Left 1111750683 13:92327994-92328016 CCTCTTTGAAATGTACTTTTTGG 0: 1
1: 0
2: 1
3: 31
4: 363
Right 1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 225
1111750681_1111750687 19 Left 1111750681 13:92327983-92328005 CCAGGCCTGATCCTCTTTGAAAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 225
1111750680_1111750687 23 Left 1111750680 13:92327979-92328001 CCAGCCAGGCCTGATCCTCTTTG 0: 1
1: 0
2: 1
3: 22
4: 264
Right 1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111750687 Original CRISPR CTGTGCTTCTTCAGGGCAAA AGG Intronic
900357745 1:2272897-2272919 CTGTGCTTCTTCCAGGCGGAGGG + Intronic
901898986 1:12341818-12341840 GTGTGGTTCCTCAGAGCAAAGGG - Exonic
902198774 1:14818452-14818474 CTCTACTTCTTCAGGGACAAGGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903945728 1:26960943-26960965 CAGTTCTGCCTCAGGGCAAAGGG - Intergenic
907306367 1:53515287-53515309 CAGTGCTGCTGCAGGGCAATGGG + Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909419409 1:75447003-75447025 CTGTGCTTTCTTATGGCAAATGG - Intronic
909510602 1:76448023-76448045 CTGTGGTTTTTCAAGGCACATGG - Intronic
910403023 1:86855888-86855910 CTGTGCCTGTGCAGGGTAAAAGG + Intergenic
910777392 1:90890974-90890996 CTGGACTTCTTCAGGGCTAAAGG - Intergenic
912333959 1:108845474-108845496 CTCTGTTCCTTCAGGCCAAAGGG + Intronic
915898683 1:159830575-159830597 CTGTGCTTCCTCAGTTCTAAAGG + Intronic
916825878 1:168441506-168441528 ATGTGCTTGTTCAGGCTAAAGGG - Intergenic
918477433 1:184940159-184940181 ATGTCCTTTTTCAGGGCACAGGG - Intronic
918780524 1:188694037-188694059 CTGTGCTTTTTCAAAGCAACAGG - Intergenic
919479556 1:198071291-198071313 ATGTGCTTCTGCCAGGCAAATGG + Intergenic
919506845 1:198409665-198409687 ATGTTCTACTTCAGGCCAAAAGG + Intergenic
919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG + Intronic
920334709 1:205237228-205237250 CAGAGCTTCTTAAGGGCAATTGG + Intronic
920534855 1:206730812-206730834 CTGTACTTCTCCAGGACAAGAGG + Intronic
920540710 1:206775922-206775944 GTGAGCTTCTTGAGGCCAAAAGG + Intergenic
920814567 1:209319203-209319225 CTGAGCTTCTTCAGAGAGAAGGG - Intergenic
921282886 1:213584876-213584898 CTGAGTCTCTCCAGGGCAAAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923859131 1:237875504-237875526 CTGTCCTTGTTTAGGGCAAAGGG - Intergenic
1067183708 10:44009455-44009477 CTGTGCTTTCTAAGGGCAGAAGG - Intergenic
1067979762 10:51072426-51072448 ATTTCCTTCTTCTGGGCAAAAGG - Intronic
1069111669 10:64454821-64454843 CTAAGCTTCTTAAGGGCAAAGGG + Intergenic
1069638381 10:69939610-69939632 AATTGCTTCTGCAGGGCAAATGG - Intronic
1069723433 10:70563464-70563486 CTGAGCATCTTCATGGGAAATGG - Intronic
1070692927 10:78541165-78541187 GTGTGCTTCTCCAGAACAAATGG + Intergenic
1073469873 10:103715917-103715939 CTCTGCTTCTCCCAGGCAAATGG + Intronic
1074289476 10:112127712-112127734 CTGGGCTATTTCAGGGGAAAGGG - Intergenic
1074477846 10:113788895-113788917 TTGTGATTCTTCTGGGCAATAGG - Intergenic
1075088384 10:119429147-119429169 CAGTGCTTCCTCAGGACACAGGG - Intronic
1075301510 10:121328771-121328793 CTTTGTGTCTTCAGTGCAAAGGG + Intergenic
1075309839 10:121404984-121405006 CACTGCTTCTTCAGGACAGATGG + Intergenic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1077646508 11:3930081-3930103 CTGTGCTGCATCAGGTCAAGTGG + Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1080599839 11:33810470-33810492 CAGTGCTTCCTTAGGGGAAAGGG - Intergenic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1081398691 11:42617613-42617635 CTGTGCTTTTTAAGGGGGAAAGG - Intergenic
1082768083 11:57184332-57184354 CTGAGCTTCTTCAGAGCAGCAGG - Intronic
1083461911 11:62819375-62819397 AAGTGCTTCTTCAGGATAAAGGG + Intronic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1086403529 11:86480736-86480758 CTGAAGTTCCTCAGGGCAAAGGG + Intronic
1088965755 11:114719613-114719635 CTTTGCTTCTCCAGGCCTAATGG + Intergenic
1090878178 11:130809910-130809932 CTGTGCTCCTTCCTGGCACAGGG - Intergenic
1091210031 11:133849349-133849371 ACGTGCTTTTGCAGGGCAAAAGG - Intergenic
1091722380 12:2822780-2822802 CTGTCCTTTTTCAGGGCAACGGG + Exonic
1092514791 12:9198981-9199003 TTTTGCTTCTTCAGGTTAAAAGG + Intronic
1093478808 12:19583717-19583739 CTGTGGTTCCTCAAGGCACATGG - Intronic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1094433846 12:30399324-30399346 CTGCACTTATCCAGGGCAAATGG - Intergenic
1094788275 12:33876905-33876927 CTATGCTTTTACAGGACAAAAGG - Intergenic
1095878553 12:47107492-47107514 TTCTGCTTCTTCTGGGAAAATGG - Intronic
1098418017 12:70258800-70258822 CTGTGCTTGTTCAGGAGAAAGGG + Intronic
1098497444 12:71152582-71152604 CTGTGCTTCTTTGGGGAAATTGG - Intronic
1099094636 12:78358492-78358514 ATGTGTTTCTCCAGGGCAAACGG + Intergenic
1100214952 12:92438087-92438109 CTGTGATTCTACTGGGGAAAAGG + Intergenic
1100737762 12:97556401-97556423 CTGTTCTCCTTCAGGGAACACGG - Intergenic
1100955890 12:99907616-99907638 CTGTGCTACTTCCCAGCAAAAGG + Intronic
1101899941 12:108784291-108784313 CTGGACTTCTCCAGGGGAAAAGG + Exonic
1102356280 12:112238823-112238845 CTGTACTCCTTCAGGGTACAGGG + Intronic
1105520291 13:21125122-21125144 TTGTCATTCTTCAGGACAAAGGG - Intergenic
1106461758 13:29976729-29976751 CATAGCTTCTTCAGGGCCAAGGG - Intergenic
1106582103 13:31027517-31027539 CTGGGCCCCTTCAGGGCATAGGG - Intergenic
1108504365 13:51097863-51097885 CTGGGCTACTTCAGGGCTGATGG - Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1114691743 14:24589036-24589058 AAGAGCTTCTGCAGGGCAAAAGG - Intergenic
1120999934 14:90444224-90444246 CTGTGCCTCTCCAGGGCAGGGGG + Intergenic
1122914813 14:104853950-104853972 CTGCGGTTCATCAGGGAAAATGG - Intergenic
1124948913 15:34298094-34298116 CTGAACTTCTTGAGAGCAAATGG - Intronic
1125101707 15:35921001-35921023 CTCTGCCTATTCTGGGCAAAAGG - Intergenic
1125968810 15:43895374-43895396 CTGTCCCTCTGCAGAGCAAAGGG + Intronic
1128631329 15:69271153-69271175 CTTTCCTTCTTCAGTGGAAAAGG - Exonic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1131295861 15:91148601-91148623 CTGTGTTTCTTCAGGGAACCCGG - Intronic
1135082296 16:19446436-19446458 CTGTGCTACTCCAGTGCAAGTGG + Intronic
1135345070 16:21681928-21681950 CTTTGCTTCTGCAAGGAAAAGGG + Intronic
1135391869 16:22100402-22100424 CTTTGCTTCTTCAGGGAGGAGGG + Exonic
1135561187 16:23478347-23478369 CTGTGAGTCTTCTGGGCAAGGGG - Exonic
1137446828 16:48537026-48537048 CTGTCAGTCTTCAGGGCACAGGG - Intergenic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1141017587 16:80465105-80465127 CTGAGCTTCTTGAGGGCATCTGG - Intergenic
1141055565 16:80810636-80810658 CTCTGCTTCTTTATAGCAAAAGG - Intergenic
1141806315 16:86344046-86344068 CTTTGCTTCTCCATGGCATAAGG - Intergenic
1144520972 17:15951980-15952002 CTGTGCTGCTCCAGGGCACCAGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1147450870 17:40502965-40502987 CAGTGGTTCTTCAGGGCCAGGGG + Intergenic
1147666333 17:42150979-42151001 CTGTGTTTCTTCTGGTAAAATGG - Intronic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1151239760 17:72748717-72748739 CTGTGTTTCCTCAGAGAAAAAGG + Intronic
1152924804 17:83081931-83081953 CTGTGCTTCGTCAGGACAGCTGG - Intronic
1152935267 17:83132976-83132998 CTGTGCTTCTTCCGAGCCCACGG - Intergenic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1155103234 18:22634666-22634688 CTGTGCAGCTCCATGGCAAAGGG + Intergenic
1155889185 18:31245181-31245203 CTATGCTTCATCAGGCAAAATGG - Intergenic
1156397287 18:36709573-36709595 CTGTCTTTCTACAGGGCAGAAGG - Intronic
1158711372 18:59841102-59841124 CTTTGCTTTTTCAGGGGAGATGG + Intergenic
1164570831 19:29373083-29373105 CTTTGCTTCCTCATGGCACATGG - Intergenic
1168422808 19:56216416-56216438 CTGTGCGCCATAAGGGCAAATGG + Intergenic
1168425066 19:56233448-56233470 CTGTGCGCCATAAGGGCAAATGG + Intronic
925494813 2:4435215-4435237 CTGTGGTTTTTCCAGGCAAATGG + Intergenic
925764924 2:7223526-7223548 CTATACTTTTTCTGGGCAAAAGG - Intergenic
928100884 2:28436882-28436904 CTGTGCTTCCTCATGCCACACGG + Intergenic
929895720 2:45959141-45959163 CCGTGCTTCCTCAGGGCAAGAGG + Intronic
931169861 2:59791200-59791222 CTGTGGATCTTCATGTCAAAAGG - Intergenic
935735767 2:106105646-106105668 CTGGGCTCCAGCAGGGCAAAGGG - Intronic
936516158 2:113182811-113182833 CTGTGCTCCCTCTGGGCAGAGGG - Exonic
936524924 2:113235778-113235800 CTGCGCTTCTGCAGCGAAAATGG + Intronic
936650482 2:114420925-114420947 TTGGGCTTCTCCAGGGCATATGG + Intergenic
938605126 2:132884250-132884272 CTGTGCTTAAAAAGGGCAAACGG - Intronic
939349102 2:141009943-141009965 CTGTGTTTCTTGAGGGCCAATGG + Intronic
939539114 2:143471898-143471920 CTTTGCTTCTGCAGGCCATAGGG - Intronic
940023861 2:149184391-149184413 CTGTCCTTCTGCAGGGCCCAGGG + Intronic
940430840 2:153588172-153588194 CTGTGGTTTTTCCAGGCAAAGGG + Intergenic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
940992056 2:160107509-160107531 CTGTTCTGCTTCAGGGGCAAAGG - Intronic
945781558 2:214180382-214180404 CTGTGATATTTCAGTGCAAAAGG + Intronic
945974844 2:216262356-216262378 CTGGGCTTAATCAGGGTAAACGG + Intronic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
948149775 2:235736048-235736070 CTGTGCTTCCCCAGGACACAAGG - Intronic
948652362 2:239456278-239456300 CTGTTCTGCTCCAGGGCAAGAGG + Intergenic
1169731515 20:8790545-8790567 CTCTGATTCTCCAGGGGAAACGG - Intronic
1170730612 20:18971861-18971883 CTGTCCTGCTCCAGGGCAGATGG + Intergenic
1173905636 20:46626597-46626619 CTGAGCTTCCTGTGGGCAAATGG + Intronic
1174318416 20:49720985-49721007 CTGGGCTTCTTCACAGCATAGGG - Intergenic
1178032864 21:28547781-28547803 CTGTCCATATTCAGGGGAAAGGG - Intergenic
1178298871 21:31434478-31434500 GTTTGCTTCTTGATGGCAAATGG + Intronic
1178688165 21:34728015-34728037 GTTTGCTTCTTCAAGGCCAATGG + Intergenic
1178894336 21:36546383-36546405 CTGTGCTTGTTCTGAGCAATGGG + Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182401547 22:30081417-30081439 CTGTGCTCATTCAGAGAAAATGG - Intronic
1182985441 22:34712004-34712026 GTGTGCAACTTCATGGCAAAAGG + Intergenic
1183186454 22:36294206-36294228 AGGTGCTGCTGCAGGGCAAAGGG - Exonic
1185355061 22:50363559-50363581 CTCTTCTTCTTGAGGGCATATGG + Intronic
950776549 3:15355348-15355370 TTGTGCATCATCAGGGCCAATGG - Intergenic
950988142 3:17399188-17399210 CCATTCTTCTTCAGGGCACAGGG + Intronic
951805669 3:26641270-26641292 GTGTGCAGCTCCAGGGCAAAGGG - Intronic
951874685 3:27409163-27409185 CTGTGCATCTTCTGTTCAAATGG + Intronic
952348464 3:32510817-32510839 CTGTGTTTCTTTAGTGGAAAGGG + Intergenic
953157706 3:40389821-40389843 CTGTTATTCTTCTGGGAAAATGG + Intronic
954441688 3:50525613-50525635 CTGGGCTGCTTCAGGGCAGCTGG + Intergenic
954787502 3:53105062-53105084 CTGGGCATCTGCAGGGCAATGGG + Intronic
958864275 3:99482928-99482950 ATGTCCTTCTTTAGGGGAAAAGG - Intergenic
959827271 3:110813379-110813401 CTCTGCTTTTTCTGGGGAAAAGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
962402785 3:135075587-135075609 TTGTGCTTCTTCAGGAATAAGGG + Intronic
963094990 3:141526660-141526682 CTCTGTTTCTTCAGGCCAACTGG + Intronic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963528488 3:146444654-146444676 GTGTGTTTCTTGAGGGCAACAGG + Intronic
964835195 3:160930321-160930343 TTGTATGTCTTCAGGGCAAAGGG - Intronic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
967681386 3:192368035-192368057 CAGTTATTCTTCTGGGCAAAAGG + Intronic
969432805 4:7165857-7165879 CTGCGCTCATACAGGGCAAATGG + Intergenic
970413897 4:15837631-15837653 CTGTGCTTTTCCAGGCCTAAGGG + Intronic
971036837 4:22702676-22702698 CTGTGTTTCTACAGTGCACAAGG + Intergenic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
972053112 4:34764984-34765006 CTGTCCTTCTTTAGTGCAAGAGG - Intergenic
973720314 4:53717282-53717304 CTTTGCATTTTCAGGGCAGAAGG + Intronic
974353893 4:60786980-60787002 GTGTTTTTCTTCAGTGCAAAAGG - Intergenic
976191843 4:82494994-82495016 CACTGCTTCTTCAGAGCAATAGG + Intronic
976297539 4:83486986-83487008 ATGGCCTGCTTCAGGGCAAAAGG + Intronic
977437558 4:97018656-97018678 CTGTGCTTCTTCTAAGCAACAGG + Intergenic
978487727 4:109275275-109275297 GGGTCCTTTTTCAGGGCAAAAGG - Intronic
980717231 4:136642198-136642220 CTGTGCTATTCCACGGCAAAGGG + Intergenic
980901264 4:138907591-138907613 CACTGCTTCTCCAGGGAAAAAGG + Intergenic
982765754 4:159346639-159346661 CTGTGCTTCATAAAGGCAACAGG + Intronic
984764109 4:183386339-183386361 CTGTGCTGCCTCAGGGACAATGG + Intergenic
986025258 5:3844679-3844701 CTGTGCTTCTGGAGTGGAAAGGG - Intergenic
986615701 5:9615159-9615181 CTGTGTGTGTTCTGGGCAAAGGG + Intergenic
988846009 5:35129029-35129051 CTGTGGGTCTTCACTGCAAAGGG + Intronic
990602142 5:57369836-57369858 CTGTGCTGCATCAGGGCACCTGG + Intergenic
990778637 5:59332889-59332911 CTGTTCCTCTTGATGGCAAATGG - Intronic
991214308 5:64144629-64144651 CTTTGCTGCTTCAGGACTAAGGG - Intergenic
991565051 5:67996683-67996705 CTGTGCTGCTTCAGGCCAGGTGG + Intergenic
991957318 5:72008044-72008066 CTCTGTTTCTTCACTGCAAAGGG + Intergenic
992083331 5:73255818-73255840 CTGTGATAATTCAGGTCAAAAGG - Intergenic
992686995 5:79208831-79208853 CTGTGCTTCTTCTGGAAAAGAGG + Intronic
993092259 5:83440932-83440954 GTGTGCATATTCTGGGCAAAGGG + Intergenic
997429224 5:133825984-133826006 GTGTGCCACTTCAGGGCAAAAGG + Intergenic
1000489762 5:161896910-161896932 TTGTACTTCTTGATGGCAAAAGG + Intronic
1001320614 5:170677796-170677818 CTTTGTTTCTTTAAGGCAAATGG + Intronic
1001656717 5:173356309-173356331 CTGTGCATCTTCAGGGGACGGGG + Intergenic
1002775383 6:323977-323999 CTTTTCTTCTTCAGGGCATAGGG - Intronic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1005172325 6:23002211-23002233 CTGTGCTTCATCAGGCCATGTGG - Intergenic
1005234112 6:23740184-23740206 GAGTGCTTCCTGAGGGCAAAGGG - Intergenic
1005255760 6:24001403-24001425 AGGTGCTTCTTGAGGACAAATGG + Intergenic
1007317547 6:41001483-41001505 CAGTGCTTCTTCTGGATAAATGG + Intergenic
1011759967 6:90553058-90553080 CCTTGCTTCTTCAGGAGAAAAGG + Intronic
1012572846 6:100752079-100752101 CTGTGCTTTTCCAGATCAAATGG + Intronic
1019493769 7:1326784-1326806 CTGAGCTTCTTCAGAGCACAGGG + Intergenic
1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG + Intergenic
1021293493 7:18874934-18874956 CTGTGCTTTTCCAGGGAGAATGG + Intronic
1021902981 7:25306054-25306076 CTGTGTTTCTTCAGAGGAAAAGG - Intergenic
1023999790 7:45182812-45182834 CCATGCTTCTCCAGGGCCAAAGG - Intronic
1028360385 7:89960628-89960650 ATGTGCTTGCTGAGGGCAAAAGG - Intergenic
1029606912 7:101604771-101604793 CTGTGCTTCTTCAGCTCCACAGG + Intergenic
1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG + Intronic
1034160284 7:148989102-148989124 CTGTCCTTTTGCACGGCAAAAGG + Intergenic
1034733276 7:153406339-153406361 CTGTGCATGTTCAGAGGAAAGGG + Intergenic
1034860593 7:154591768-154591790 CTGGGTTTCTTTAGGGGAAAAGG + Intronic
1035375195 7:158402936-158402958 CTGTGATTCTCCACAGCAAAGGG + Intronic
1035588484 8:795174-795196 CTGTGTTTCTTCAGGAGCAAGGG - Intergenic
1036769660 8:11570338-11570360 CTGTGCTGCCTCAGGGTCAAGGG + Intergenic
1039146533 8:34453196-34453218 CTGGGCTTTTTCTGGGCAAGAGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041935571 8:63327942-63327964 ATGTGCTTCCTGAAGGCAAAGGG + Intergenic
1042089477 8:65143418-65143440 CAGTGCTTCTGAAAGGCAAATGG - Intergenic
1042809021 8:72803803-72803825 CTGTGCTTCTTCTGGGCTGCTGG + Intronic
1045577849 8:103445220-103445242 TTGTGGTCCTTCAGGGAAAAGGG - Intergenic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046887988 8:119389723-119389745 GTGTGCTGCTCCATGGCAAAGGG + Intergenic
1047650468 8:126914683-126914705 CTGTGCTTCTTACAAGCAAAAGG + Intergenic
1047987965 8:130256225-130256247 GTGTGCATCTTCAAGGAAAAAGG - Intronic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1053282036 9:36826704-36826726 CTCTGCTTCTTCAAGGCCAAAGG + Intergenic
1054927304 9:70601692-70601714 CTATGCCTCTTCAGGAGAAATGG + Intronic
1056628769 9:88275609-88275631 CTGTCCTTCTTTTAGGCAAATGG + Intergenic
1057479133 9:95430344-95430366 CTTTGCTCCTTCATGGCAGAAGG + Intergenic
1058692942 9:107534546-107534568 CAGTGCTGCTTCTGGGCAAGGGG + Intergenic
1059477833 9:114561981-114562003 CTCTGCTACTTCAGGGCTACAGG + Intergenic
1060005056 9:119992460-119992482 CTGTGATTCTTTGGTGCAAATGG - Intergenic
1060053348 9:120392521-120392543 CTGTGACTGTTCAGGGCCAAAGG + Intronic
1060384508 9:123212045-123212067 CTTTTCTTATTCAGAGCAAAAGG - Intronic
1061057858 9:128233746-128233768 CTGGGCAACTTCAGGGCAGAGGG - Intronic
1187158745 X:16745126-16745148 CTGAGCCTCTCCAGGCCAAAAGG - Intronic
1187301109 X:18050702-18050724 GTGTCCTTCATCGGGGCAAAGGG - Intergenic
1187363090 X:18645816-18645838 CTGAGTTTCATCTGGGCAAATGG + Intronic
1187933982 X:24318338-24318360 CTGTGCACCTCCATGGCAAAGGG - Intergenic
1191915871 X:66200666-66200688 CTGTGCAGCTTCAGGGCATGAGG + Exonic
1194703747 X:97148878-97148900 CTTTGCTTCTTCAAGGGAAATGG + Intronic
1197198897 X:123732305-123732327 CGGTGGTTCTTCAGGGAAAGCGG + Intronic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic