ID: 1111751113

View in Genome Browser
Species Human (GRCh38)
Location 13:92333368-92333390
Sequence TTTTATCAGAACCTAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111751108_1111751113 -3 Left 1111751108 13:92333348-92333370 CCAGAGCTTATCCTCTTGGGTTT 0: 1
1: 0
2: 2
3: 26
4: 174
Right 1111751113 13:92333368-92333390 TTTTATCAGAACCTAGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111751113 Original CRISPR TTTTATCAGAACCTAGGGGA AGG Intronic
901083466 1:6596819-6596841 TTGTACCAGAACCAAGGGGAGGG + Intronic
905919246 1:41708431-41708453 CTTTCTCACAACCAAGGGGAGGG + Intronic
906548253 1:46638126-46638148 TTTTATCTGAAGCTTGGGGTGGG + Intronic
907291716 1:53418164-53418186 TTTGTTCAGCACCTATGGGAAGG + Intergenic
907678285 1:56538854-56538876 CTTTGTGAGAACCAAGGGGAAGG + Intronic
907908170 1:58803791-58803813 TTCTTTCAGAAACTAAGGGAAGG - Intergenic
912051200 1:105529882-105529904 GTTTTTCAGGAACTAGGGGAGGG - Intergenic
912343056 1:108936426-108936448 TTTTATATGAAACTATGGGAAGG + Intronic
913335641 1:117707086-117707108 TTTTGTCACAATTTAGGGGACGG - Intergenic
913658623 1:120985897-120985919 TCTTATCAGAACGGAGTGGATGG + Intergenic
914009987 1:143769022-143769044 TCTTATCAGAACGGAGTGGATGG + Intergenic
914648605 1:149677679-149677701 TCTTATCAGAACGGAGTGGATGG + Intergenic
915082872 1:153363974-153363996 TTGTTTCAGACCCTGGGGGAAGG + Intergenic
917962817 1:180157923-180157945 TCTTATGGGAACCCAGGGGAGGG + Intronic
919800467 1:201350994-201351016 GTGGATCAGAACCTGGGGGAAGG + Intergenic
921209391 1:212879947-212879969 TGTTATCTGAACCTAGAGTATGG - Intronic
922627182 1:227060533-227060555 TTGTATGGGAACCTAGAGGAGGG + Intronic
924401496 1:243687254-243687276 TTTTATCAGAATATAAGGAATGG - Intronic
924480069 1:244422102-244422124 TTTTTTTAGAACTTAGTGGATGG + Intronic
1065081499 10:22134110-22134132 TTTTTTCAGAACCTAGTAGTAGG - Intergenic
1066356207 10:34686652-34686674 AATTATCTGAACCTGGGGGAAGG + Intronic
1066401643 10:35082377-35082399 TGTTATCAGATGCTGGGGGAAGG + Intronic
1072295591 10:94006714-94006736 TTTTATCAGATACTTGGAGAAGG + Intronic
1072424319 10:95316566-95316588 TTTTATGAGAACTTAGGTGTGGG - Intronic
1073856097 10:107674875-107674897 GGTTGTCAGAAACTAGGGGAAGG - Intergenic
1077396798 11:2328068-2328090 TCTTATTAGAAACTGGGGGAGGG - Intergenic
1078424418 11:11237822-11237844 ATTAATTAGAACCTAGGGAAGGG + Intergenic
1085693895 11:78687817-78687839 TGTTATCAGAACAAAGGGTAGGG - Intronic
1087947021 11:104175089-104175111 TTTTATTAGAAAAGAGGGGAGGG - Intergenic
1089331830 11:117694712-117694734 TTAGATGAGAACCCAGGGGAAGG + Intronic
1092929761 12:13304875-13304897 TTTGATAAGAAGCTATGGGAGGG - Intergenic
1095935896 12:47680799-47680821 TTTTATCAGCAGGTAGGGAATGG - Intronic
1096600826 12:52727569-52727591 TTTTATAAAAGGCTAGGGGAAGG + Intergenic
1097009157 12:55940257-55940279 TCTGAGCAGGACCTAGGGGAGGG - Intronic
1098368685 12:69734819-69734841 TTCTCACAGAACCTATGGGAAGG + Intergenic
1098845609 12:75531416-75531438 TATTTTCAGTACCTAGGTGATGG + Intergenic
1098947657 12:76606492-76606514 TGGTATCAGCACCTAGGGAAGGG - Intergenic
1100624295 12:96314971-96314993 TTTTATAAGATCCTTGGGGATGG + Intronic
1101862403 12:108493771-108493793 TGTTATCAGAACCCAGGAGCTGG - Intergenic
1102724174 12:115044124-115044146 GATTATCGGAACCTAGGGAAAGG - Intergenic
1103323437 12:120104718-120104740 GATTATCAGACCCTGGGGGAAGG - Intronic
1103348098 12:120264784-120264806 TTTCACCAGAATCTAGGGGTGGG + Intronic
1104345310 12:127991336-127991358 TTTCAGCAGAATTTAGGGGAAGG - Intergenic
1105756040 13:23465496-23465518 GTTTTTCAGGAGCTAGGGGAAGG + Intergenic
1109141424 13:58717287-58717309 TTTCACCGGAACCTAGGGAATGG - Intergenic
1109818841 13:67624371-67624393 TTTTATCTGAAGCTAGTAGAAGG - Intergenic
1110030902 13:70611947-70611969 TTTTATCAGATCCAAACGGAAGG - Intergenic
1111285884 13:86091331-86091353 TTTGATCATTACCTAGGGGTGGG - Intergenic
1111655103 13:91141848-91141870 TTTTATGAGGACCCATGGGAGGG + Intergenic
1111751113 13:92333368-92333390 TTTTATCAGAACCTAGGGGAAGG + Intronic
1112116330 13:96359552-96359574 ATTAATCAGAACATTGGGGATGG + Intronic
1113472534 13:110557163-110557185 TGTTATCAGAAGCTGGAGGAGGG + Intronic
1117522100 14:56561140-56561162 TTCTAAGAGATCCTAGGGGATGG + Intronic
1118455279 14:65940353-65940375 ATTTATTAAAAACTAGGGGAGGG + Intergenic
1121773552 14:96574491-96574513 TTTCCTCAGAAACTGGGGGAAGG - Intergenic
1124847836 15:33309588-33309610 GTTCATCAGAACATATGGGACGG + Intergenic
1132343603 15:101093306-101093328 TTTTTTAAGAACTTAGGGGCAGG - Intergenic
1133561921 16:6958132-6958154 TTTTTTGAGAAGCAAGGGGAGGG + Intronic
1134032838 16:11006308-11006330 GTTTATCAGAAGCAAGGGGCAGG + Intronic
1137604031 16:49775378-49775400 TTATGTCAAAACCTAAGGGAAGG - Intronic
1137934990 16:52626186-52626208 TTTTGTCATAACCTAGCAGAAGG - Intergenic
1138547385 16:57727907-57727929 TGTTCTCAGATCCCAGGGGAGGG + Intronic
1139360229 16:66393527-66393549 TGAGAACAGAACCTAGGGGATGG + Intronic
1141816171 16:86410652-86410674 TCTTACTAAAACCTAGGGGAAGG - Intergenic
1142868364 17:2804964-2804986 TTTTCTCAGGACCTTGGTGATGG + Intronic
1146566763 17:33920187-33920209 TTATATCAGAATCTTGTGGAGGG + Intronic
1147039836 17:37710071-37710093 TCTTGTCAGTACCAAGGGGATGG + Intronic
1149589624 17:57818880-57818902 TATTCTCAGTAGCTAGGGGATGG - Intergenic
1149751218 17:59147203-59147225 TTTTTTAATAACCTAGAGGAGGG - Intronic
1150912073 17:69398911-69398933 TTAAATCAAAACCTAGGGGCTGG + Intergenic
1151138379 17:71969205-71969227 CTTTAGCAGGACCTAGGGGAAGG - Intergenic
1154064021 18:11089864-11089886 TTTTATCAGAGGCTAGGTCAGGG - Intronic
1154389502 18:13924285-13924307 TTGTAGCAGCACCTGGGGGAAGG - Intergenic
1155733861 18:29196904-29196926 TTTTTTCATAAACTGGGGGAAGG + Intergenic
1158192169 18:54842745-54842767 TTTTGTCTGAAACTAGTGGATGG - Intronic
1160064363 18:75561411-75561433 TTGTATCAAGACCTAGAGGAGGG - Intergenic
1161366628 19:3883633-3883655 TTTTGTCACAACTGAGGGGAAGG - Intronic
1161851551 19:6740232-6740254 TTTAATCAACACCTAGGGGCTGG + Intronic
1164082802 19:21875253-21875275 TTCTCCCAGAACCTAGGCGATGG + Intergenic
1165217397 19:34286019-34286041 TTTTCTGAGAACCAAGGGGCTGG - Intronic
1165712476 19:38021915-38021937 TATCTTCAGAACCTTGGGGAGGG - Intronic
1165838619 19:38773709-38773731 TATTATCAGCTCCTAGGAGAGGG - Intergenic
1165840943 19:38788988-38789010 TATTATCAGCTCCTAGGAGAGGG + Intergenic
926227394 2:10978130-10978152 TTTTATCAGAACTTATGGAAAGG + Intergenic
928315441 2:30240872-30240894 TTTTATTTGAACCAATGGGAAGG + Intronic
929052188 2:37847329-37847351 TATTTTCAGATCCAAGGGGAGGG - Intergenic
933678922 2:85081429-85081451 TATTATTAGAAACTAGAGGAAGG - Intergenic
933760860 2:85670985-85671007 TTTTATCAGAACCTCAAAGAGGG + Intergenic
937316495 2:120935127-120935149 TCTTTTCAGAGCCTAGAGGAAGG + Intronic
939355061 2:141090789-141090811 TTTTATTAGTATCTAGGGGTAGG + Intronic
939715369 2:145577639-145577661 TTTTCTCAGAGCCAAGAGGAAGG + Intergenic
943277971 2:185892523-185892545 TATTATCTGAACCTAGAAGAGGG + Intergenic
944076029 2:195731790-195731812 GTTTATTAGAAGCAAGGGGAAGG + Intronic
945266181 2:207893504-207893526 TTTAACCATAAACTAGGGGATGG + Intronic
945620919 2:212136040-212136062 TTTTATTAGACACGAGGGGATGG - Intronic
946502133 2:220260706-220260728 AATGATCAGAACATAGGGGAAGG + Intergenic
946698237 2:222383693-222383715 TTACATCAGAATCTAGGGGCAGG - Intergenic
948330580 2:237161232-237161254 TTTTCACAGAACCTAGGGATGGG - Intergenic
1169343181 20:4811403-4811425 TTACATCAGACTCTAGGGGAGGG + Intronic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1172673766 20:36652788-36652810 TTGTATCAGAACCTCAGCGATGG + Exonic
1173990221 20:47296583-47296605 TATCATCAGAACCTAGAGGCAGG - Intronic
1178667694 21:34563497-34563519 GTTTATCAGCACCAAGGGCAGGG + Intronic
1181803068 22:25359724-25359746 TTGCATCAGAACCTGGAGGAAGG - Intronic
1182672016 22:32004354-32004376 GGTTACCAGGACCTAGGGGAAGG - Intergenic
1183540395 22:38426484-38426506 TGCTCTCAGAACCTTGGGGAAGG - Exonic
949095905 3:85356-85378 ATTTACCAGATCCTTGGGGAGGG - Intergenic
950989738 3:17419988-17420010 ATTTATCAAGAACTAGGGGAAGG - Intronic
951063151 3:18234062-18234084 TTTTATCAGAACGATGGTGATGG + Intronic
956706488 3:72003582-72003604 ATTGGTCAGAACCTAGGGAAAGG - Intergenic
957205891 3:77198341-77198363 TCTTATAAAGACCTAGGGGAAGG + Intronic
958268065 3:91463313-91463335 TTAAATAAGAACTTAGGGGAGGG + Intergenic
962421800 3:135235434-135235456 GTGTATCAGAACCTACTGGAGGG - Intronic
962508371 3:136072091-136072113 TTTTATCAGATGATAGGAGATGG - Intronic
962965569 3:140350639-140350661 TTTTATCAAAACATCTGGGAAGG - Intronic
963719155 3:148840189-148840211 TTTTCTCAGAACCTAGAGACAGG + Intronic
964052232 3:152408806-152408828 GTTTATCAGAACTGAGGGTAGGG + Intronic
965116250 3:164493056-164493078 TTTAATCAGAATCTTGGGAATGG - Intergenic
965126619 3:164638780-164638802 TTATATGAGAATCTAGGGGTGGG + Intergenic
965491273 3:169339325-169339347 TTGAATCAGAAACTCGGGGATGG + Intronic
970658950 4:18262910-18262932 TTTTACCAGAAGCTAGGGAGGGG + Intergenic
972869423 4:43278800-43278822 TTTTATCAGATCCCAGGAGCAGG - Intergenic
972980983 4:44700830-44700852 TTTTATCAGAACCTGGAAGAGGG - Exonic
973656778 4:53056137-53056159 TTTTTTCAGGTCATAGGGGAAGG + Intronic
976467993 4:85393253-85393275 TTTTATAAGAATATAGGGAATGG + Intergenic
978475976 4:109130537-109130559 TTTTATCAGTAAAAAGGGGAAGG + Intronic
979083147 4:116368926-116368948 TTTTTTAAGAATCTAGGGCATGG - Intergenic
979688480 4:123537640-123537662 TTTAATCAGAATCAAGGGGTAGG + Intergenic
982713533 4:158782755-158782777 TTGTATCAGAAACTGGGGGTGGG + Intronic
983159805 4:164398328-164398350 TGTTATCAGACGCTGGGGGACGG - Intergenic
983870532 4:172820289-172820311 TTTTATCAGAACCTTATTGATGG + Intronic
984018498 4:174454999-174455021 CTTTATCAAAACCTTGGGAAAGG - Intergenic
986800431 5:11254600-11254622 TGTTCTCAGAACCTAGGAAATGG - Intronic
988462474 5:31452546-31452568 ATTCATCAGAACCTGGAGGATGG + Intronic
988788586 5:34586473-34586495 TTTTCTCAGAACTTAGTGGTGGG - Intergenic
989588674 5:43093610-43093632 TTTTATTGGAACCTTAGGGAAGG + Intronic
989707050 5:44347069-44347091 TATAATCAGTACCTAGAGGAAGG + Intronic
990795397 5:59534468-59534490 TTTCAACAGAACCAAGGGCAGGG + Intronic
991469265 5:66950429-66950451 TATTGTCAGAGACTAGGGGAAGG - Intronic
992136534 5:73751734-73751756 TTTTAACAGAATCTAGAGGCAGG + Intronic
995966537 5:117914386-117914408 TGAGAACAGAACCTAGGGGATGG - Intergenic
996348926 5:122517163-122517185 GGTTATCAGAGGCTAGGGGATGG - Intergenic
1000104769 5:158048975-158048997 TTTTCTCAGGACCAAGTGGATGG + Intergenic
1000998761 5:167985231-167985253 TTTGATCAAAAGCTAGGGGAAGG - Intronic
1001102817 5:168828240-168828262 TGGAATCGGAACCTAGGGGAAGG + Intronic
1001108835 5:168878413-168878435 TTTTATCAGAGCCCAGAGAAAGG - Intronic
1002280423 5:178126722-178126744 TTTTATGAGATGCTAGGGAAAGG - Intergenic
1003429492 6:6025880-6025902 TTTTATCAACACCTAGTGAAAGG - Intergenic
1003457219 6:6293867-6293889 TGTTCTCAGAACCTAGGTCATGG - Intronic
1003667187 6:8122233-8122255 TGTTACCAGAAGCTAGAGGAAGG - Intergenic
1006695183 6:35925117-35925139 TGTTATCAGAACCCAGGGAGAGG + Intergenic
1006762144 6:36472299-36472321 GTTTATGAGAAGCTATGGGATGG + Intronic
1008987140 6:57558251-57558273 TTAAATAAGAACTTAGGGGAGGG - Intronic
1009175097 6:60450819-60450841 TTAAATAAGAACTTAGGGGAGGG - Intergenic
1011329622 6:86189106-86189128 TTTAATCAGAATCTCTGGGAGGG - Intergenic
1012244218 6:96908539-96908561 TTTGATAAGAATCTAGTGGATGG - Intergenic
1012874069 6:104705223-104705245 TTTTATCAGATCTCAGGGAAAGG - Intergenic
1013016560 6:106165188-106165210 TGTTCTCATAACCTAGGAGAGGG + Intergenic
1013072871 6:106744784-106744806 ATTTATCAGAAACAAAGGGAGGG + Intergenic
1017435566 6:154412489-154412511 TTCTATCAGAAACTGGAGGAAGG - Intronic
1022384428 7:29888361-29888383 ATTTAACAGAACCTATGGGCTGG - Intronic
1022889273 7:34678965-34678987 TTTTAACAGAACCTGGGGTTGGG + Intronic
1023266703 7:38413672-38413694 TTTTATGAGAACCTTGGAGATGG - Intronic
1027593401 7:80141904-80141926 TGTTATCAAAAACTAGAGGAAGG - Intronic
1027865378 7:83639529-83639551 TTTTGTAAGACCCTTGGGGATGG - Intronic
1028022483 7:85793253-85793275 TTTTGTCAAAAAATAGGGGAAGG + Intergenic
1028959028 7:96728075-96728097 TTTCATAAGAACCTAGGTGGTGG - Intergenic
1030502338 7:110375568-110375590 TTTAAACAGAACCTAGGGAATGG + Intergenic
1033500456 7:141943846-141943868 GTGCATGAGAACCTAGGGGATGG + Intronic
1033582631 7:142751250-142751272 ACTGATCAGAACCTTGGGGAAGG - Intronic
1033585654 7:142772743-142772765 ACTGATCAGAACCTTGGGGATGG - Intergenic
1033886495 7:145954500-145954522 ACTTAACAGAACCTAGGGTAAGG - Intergenic
1033982257 7:147179912-147179934 TTTTGTCACAACCTGGGGCAGGG - Intronic
1034083178 7:148299376-148299398 TTGCATCAGAAACTAGAGGAGGG + Intronic
1035292651 7:157849520-157849542 TCTTGTCAGAACCCAGGGGTTGG - Intronic
1037523149 8:19699813-19699835 TTTTAAAAGAACTTAGGGGCTGG + Intronic
1039015554 8:33144942-33144964 TATGATCAGTACCTAGGTGATGG + Intergenic
1040384845 8:46907543-46907565 TTTCATCAGAGCCTTTGGGATGG - Intergenic
1044440992 8:92223267-92223289 TTTTATCAAAGGCTAGGGGAGGG + Intergenic
1044611467 8:94096348-94096370 TTTTATCAATACCTTGGGAAAGG + Intergenic
1047149450 8:122244404-122244426 TATTATCAGAACCGGGGGGGAGG + Intergenic
1050979104 9:11986622-11986644 TATTATCACTACCTAGGTGATGG - Intergenic
1051382501 9:16472444-16472466 ATATATAAGAACCTAGGTGAAGG - Intronic
1052901363 9:33797304-33797326 GCTGATCAGAACCTTGGGGATGG - Intronic
1054882987 9:70164488-70164510 TATTATCAGAACCTAAGGACTGG + Intronic
1056091309 9:83208382-83208404 TTTTAGAGGAACCTGGGGGAGGG - Intergenic
1058487230 9:105453925-105453947 TTCTATCAGAACCTTGTGGCTGG - Intronic
1060114161 9:120927888-120927910 TTTTATCCCAAACCAGGGGAAGG - Exonic
1185767450 X:2737120-2737142 TCTTTTCAGTACCTAGGGAAAGG - Intronic
1189127658 X:38464860-38464882 TTTTCTCAGACACTAGGAGAAGG - Intronic
1189756612 X:44278418-44278440 TTAAATCAGAACCTTGGGGAGGG + Intronic
1192100201 X:68256153-68256175 TTTGATCAGGAGCAAGGGGAAGG + Intronic
1193070325 X:77299533-77299555 TTTGAACAGTACCAAGGGGAGGG - Intergenic
1193137685 X:77991230-77991252 TGTTATCAGGAGCTTGGGGAGGG - Intronic
1194155508 X:90383000-90383022 TTTGATTACAACCTAGGGTAAGG + Intergenic
1195469680 X:105218564-105218586 TTTTACCAGACACTAGGGCAGGG + Intronic
1196739550 X:119012560-119012582 CTTTATCATAACATAGTGGAAGG + Intronic
1197466674 X:126813064-126813086 TTGAATCAGAATCTAAGGGATGG + Intergenic
1200501857 Y:3959934-3959956 TTTGATTACAACCTAGGGTAAGG + Intergenic
1202080897 Y:21083174-21083196 TTGTTCCAGAACCTAGGTGATGG + Intergenic