ID: 1111756200

View in Genome Browser
Species Human (GRCh38)
Location 13:92398835-92398857
Sequence TTCTGGGTATGTAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111756200 Original CRISPR TTCTGGGTATGTAGTCAAGA AGG (reversed) Intronic
900164383 1:1238888-1238910 TTCTGGGTTTGTTCTCAAGGGGG + Intergenic
904110225 1:28120401-28120423 TTCTAGGATTATAGTCAAGAAGG + Intergenic
904862783 1:33551469-33551491 TTCTGGGTATGATGTCTACAGGG - Intronic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
910332088 1:86085613-86085635 TTCTGCGTTTGGAATCAAGATGG - Intronic
910905346 1:92171918-92171940 TTTTGTGTATTTAGTAAAGATGG - Intronic
912414040 1:109496114-109496136 TTCTGGGCATGTACTCAGTATGG + Exonic
912511797 1:110194852-110194874 TTCTGGGTGTGGGGTCATGAAGG - Intronic
915115203 1:153594118-153594140 TTCTGGATATGTTTTGAAGATGG + Intergenic
917452776 1:175160951-175160973 TTCTTGGTGTTTGGTCAAGATGG + Exonic
917473649 1:175349231-175349253 TTCTGGGCATATATTCCAGAAGG + Intronic
917718964 1:177767778-177767800 TAGTGGGTATGAAGTCAAGGAGG + Intergenic
918503148 1:185220991-185221013 CTCTGGGGAAGTAATCAAGAAGG + Intronic
918535082 1:185565031-185565053 TTCTTTGTATGAAGGCAAGAGGG + Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
920218242 1:204377054-204377076 TTATGGGGCTGTGGTCAAGAGGG - Intronic
920757681 1:208750021-208750043 TTCTGAGCCCGTAGTCAAGATGG - Intergenic
921709040 1:218355071-218355093 TTTTGTGTTTTTAGTCAAGATGG + Intronic
921736928 1:218639328-218639350 TTCAGTGTTTGTAGTCAAAAAGG - Intergenic
922388780 1:225116129-225116151 TTCTGGATTTGTAAGCAAGATGG + Intronic
923130397 1:231069850-231069872 TTTTGGGTATGTACCCAAGGGGG - Intergenic
923393901 1:233541975-233541997 TTTTGTGTTTTTAGTCAAGACGG + Intergenic
923489120 1:234467700-234467722 TTATGAGTATGTAGTCTTGATGG - Intronic
924179051 1:241423433-241423455 ACCTGGGTATGTAGTCAAAAGGG - Intergenic
924269470 1:242317981-242318003 TACTGGGTACCTAGTCAAGGAGG + Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1064310959 10:14211368-14211390 TTCTGGGTTTGAAGTCACGTGGG + Intronic
1065437089 10:25714045-25714067 TTGTGGGTGTGTAGACAAAAGGG - Intergenic
1066715429 10:38280790-38280812 TACTGGGTACCTAGTCAAGGAGG - Intergenic
1066782664 10:38969922-38969944 TACTGGGTACCTAGTCAAGGAGG + Intergenic
1067359000 10:45559705-45559727 TTATGGGTTTCTAGCCAAGAAGG - Intronic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1069007272 10:63331977-63331999 TTCTGAGCATGTAGTGAATATGG - Intronic
1070476712 10:76836219-76836241 TTCTGGCTATGTGTTCAAGGAGG + Intergenic
1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG + Intronic
1073631227 10:105151383-105151405 TTCTGGGTATGTAAATATGAGGG - Intronic
1074916080 10:117956373-117956395 TCCTGGGTATGGACTCATGAGGG - Intergenic
1075071496 10:119322794-119322816 TTTTGGGTATATACTCAGGAGGG - Intronic
1078029152 11:7731195-7731217 TTTTGTGTTTTTAGTCAAGATGG + Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1083325214 11:61869642-61869664 TTCTGGGTGTGTTGGCAAGGGGG - Intergenic
1087440287 11:98175205-98175227 TTTTGGATATGTAGTACAGAAGG - Intergenic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1092186605 12:6484617-6484639 TTCTGGGAAGCTAGTCTAGAGGG - Intergenic
1093621653 12:21297447-21297469 TTCTAGGTATTTAGGCATGAAGG + Exonic
1094471420 12:30804840-30804862 TTCTGGGGAGGAATTCAAGAAGG - Intergenic
1094767215 12:33610786-33610808 TTCTGGTTCTGTAGTCAAAGTGG - Intergenic
1095561015 12:43565012-43565034 TTCTGGGTATGCTGTGAAGTAGG - Intergenic
1096280497 12:50248748-50248770 TTCAGTGTCTGTAGACAAGATGG - Exonic
1099450678 12:82802920-82802942 TTCCTGGTTTGTAGTCATGAGGG + Intronic
1099506257 12:83479877-83479899 TTCTGGATTTGTATGCAAGATGG + Intergenic
1100882807 12:99037342-99037364 TTCTGTATTTTTAGTCAAGATGG - Intronic
1101156763 12:101935093-101935115 TTGAGGGTATGCAGTCGAGAGGG - Intronic
1102467251 12:113137134-113137156 TGCTGGGTGGGGAGTCAAGAAGG - Intergenic
1104045113 12:125156847-125156869 TTTTGTGTTTTTAGTCAAGACGG + Intergenic
1104156438 12:126137217-126137239 TTCTGGGGATAGGGTCAAGATGG - Intergenic
1108613929 13:52112422-52112444 TTCTGGCTGTGGAATCAAGATGG + Intronic
1109177402 13:59173406-59173428 TCCTGGGAATGCAGTCCAGAAGG - Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110743493 13:79025470-79025492 TTCTGGGAATGGGGTCAATATGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG + Intronic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113167289 13:107456020-107456042 TTCTGGGTATGTACACAAATGGG - Intronic
1113844793 13:113380727-113380749 TCCTGGGAATGCAGTCCAGAAGG - Intergenic
1118403488 14:65401092-65401114 TTCTGTTTATGAAGTCAAGTGGG - Intergenic
1119035170 14:71223626-71223648 TTTTGGTTCTGGAGTCAAGATGG - Intergenic
1119315793 14:73693312-73693334 TTTGGGGTATGTAGTTAGGAGGG - Intronic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1120584692 14:86297485-86297507 TTCTGGGAATGTAATCCAGTAGG + Intergenic
1122215805 14:100203296-100203318 TTCAGGGTATGAATTCAACATGG + Intergenic
1122647505 14:103205109-103205131 TTCTTGCTATGCAGTCCAGATGG + Intergenic
1124497802 15:30196929-30196951 TTCTGTGTCTTTAGTAAAGACGG + Intergenic
1124745783 15:32341756-32341778 TTCTGTGTCTTTAGTAAAGACGG - Intergenic
1125120067 15:36145699-36145721 TTCTGGGAATATAGTGGAGAAGG + Intergenic
1125407866 15:39371639-39371661 TTCTGGGAATGAATTCAAGCTGG - Intergenic
1126419044 15:48452134-48452156 TTTGGGGTATGCAGCCAAGATGG + Intronic
1126903531 15:53339430-53339452 TTGTGTGTATGTAGGCATGAAGG + Intergenic
1128901406 15:71425860-71425882 TTCTGGGTATTTGGCCAAGGGGG - Intronic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1133085922 16:3363485-3363507 TTCTGGGTATATTTTGAAGAGGG - Intergenic
1133748153 16:8702936-8702958 TTCTGGATCTGTTTTCAAGATGG + Intronic
1136038427 16:27559036-27559058 AGCTGGGAATGTAGTCAAAACGG - Intronic
1136642931 16:31582339-31582361 TTCTGTGTCTGTAGTCATTAGGG - Intergenic
1136662695 16:31778798-31778820 TTCTGTGTCTGTAGTCATTACGG + Intronic
1137074325 16:35943701-35943723 TTCTGGGGATAGAGCCAAGATGG + Intergenic
1139713028 16:68790957-68790979 TTCTGGCCTTGTTGTCAAGAAGG + Intronic
1142486222 17:249166-249188 TTCAGGGTATTTAGTCAGGAGGG + Intronic
1142514231 17:416490-416512 TTCTGGGAAAGTAGCTAAGATGG + Intronic
1144826749 17:18109434-18109456 TTCTGGATCTGTGGTCAGGATGG + Intronic
1145885921 17:28382422-28382444 TTTTGAGTCTGGAGTCAAGATGG + Intronic
1146105673 17:30033658-30033680 TTCTGGGAATCTACTCAACAGGG + Intronic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1149071615 17:52550431-52550453 TTTAGGGTATAAAGTCAAGAAGG + Intergenic
1150016345 17:61561224-61561246 TTCTTAGTTTGTAGTCAAAATGG + Intergenic
1150821473 17:68437647-68437669 GTCTGCGTCTGCAGTCAAGATGG + Intronic
1151928845 17:77218003-77218025 TTCTGTGTCTGTTGTCAAGTCGG + Intergenic
1153740182 18:8117174-8117196 TTTTGACTATGTAGTCAAGATGG - Intronic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1155437868 18:25832037-25832059 TGCTGGGTTTATAGTCCAGAAGG - Intergenic
1156335156 18:36164876-36164898 TTGTGATTATGTAGTCAAGATGG + Intronic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1157865341 18:51178687-51178709 TTTTGTGTATTTAGTAAAGACGG - Intronic
1159182620 18:64928167-64928189 TTCTGGGTATTTATTTGAGAGGG + Intergenic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1159783613 18:72688467-72688489 TTCTGTGTATTTAATAAAGAAGG + Intergenic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164713902 19:30377834-30377856 TTCTGGGAATGCAGTCCAGCAGG + Intronic
1164900577 19:31917767-31917789 ATCTGGGAATGTAGTCCAGTAGG + Intergenic
1165304769 19:34996634-34996656 TTTTGTGTTTTTAGTCAAGATGG - Intronic
1168422257 19:56212262-56212284 GTCAGGATAGGTAGTCAAGAAGG - Intergenic
927626966 2:24731914-24731936 TTTCAGGTATGTAGTCAAAATGG - Intronic
929752305 2:44728339-44728361 TTCTGTGTCTGTGGTCATGAGGG + Intronic
930049928 2:47207195-47207217 TTCTGGACATGTTTTCAAGACGG - Intergenic
931132316 2:59350398-59350420 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
933257674 2:80099136-80099158 TTCGGGGGGTGGAGTCAAGATGG - Intronic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
935858458 2:107300960-107300982 TTCTGGTTTTGTAGCCAAGCAGG + Intergenic
941821068 2:169843711-169843733 TTTTGTATCTGTAGTCAAGAGGG + Intronic
942755309 2:179334230-179334252 TTCTGGCTATTTTCTCAAGAGGG + Intergenic
944891349 2:204120335-204120357 TCCTGGGAATGCAGTCAAGCAGG + Intergenic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173316321 20:41947855-41947877 TTCTGGGTATTTCGTAAAAATGG - Intergenic
1173752690 20:45489373-45489395 CTCTGGGAATGTAGCCAAGCAGG + Intergenic
1173889351 20:46493458-46493480 TCTTGGGTCTGTGGTCAAGATGG + Intergenic
1177291487 21:19119261-19119283 TTCTGGGAATGCAGCCAAGTGGG - Intergenic
1177496200 21:21895117-21895139 TTCTGGGTAAAAATTCAAGAGGG - Intergenic
1177693848 21:24546089-24546111 TTCTGGTTAAGTTGCCAAGAGGG - Intergenic
1181083499 22:20428811-20428833 TGCTGGGGATGTAGGCAGGAGGG + Intronic
1182656881 22:31897719-31897741 CTCTGGGTATCCAGTCAACACGG + Intronic
1182792508 22:32964760-32964782 TTCTGAGTATATGGTCAAGAAGG - Intronic
1182890814 22:33817488-33817510 TGCTGGGTATGCAGCCATGAAGG - Intronic
951629225 3:24699916-24699938 TTCAGGGTATGCTGGCAAGATGG - Intergenic
953082390 3:39632774-39632796 TTCTGGGTATATATCCAAAAGGG + Intergenic
953520317 3:43636187-43636209 TGAAGGGTATGTTGTCAAGAAGG + Intronic
955672164 3:61412959-61412981 TTCTGGCTATGTTGTGGAGAAGG + Intergenic
957743694 3:84308907-84308929 TTGTGTGTATATAGTAAAGATGG + Intergenic
957744728 3:84324850-84324872 TTTTGTGTTTTTAGTCAAGACGG - Intergenic
957786732 3:84891930-84891952 TTCTGCGTATGTGGTCAAACAGG + Intergenic
960509541 3:118531827-118531849 TTGTGGGTGTTCAGTCAAGATGG + Intergenic
960696311 3:120400091-120400113 TTCTGAGTATGAAGGCATGAAGG + Intronic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961462584 3:127061930-127061952 TTCTGTGGATGTAGTGAACATGG - Intergenic
961500583 3:127330149-127330171 TTCTGGGGTTGTAGCCAAGTGGG - Intergenic
962510481 3:136094928-136094950 TTTTGGGTCTATATTCAAGAGGG - Intronic
963379351 3:144507834-144507856 TTCTGGGTATAAATTCAAGCCGG - Intergenic
963429578 3:145181403-145181425 TTCTGGGTCAGTAGACAGGATGG + Intergenic
964387767 3:156167115-156167137 TTCTGGGTATGTGGACATGGTGG - Intronic
964930385 3:162013694-162013716 ATCTGGGTATCTATGCAAGAAGG - Intergenic
966610955 3:181867618-181867640 CTCTGGGTTTCTAGTCATGAGGG - Intergenic
967599943 3:191374850-191374872 TTCTGGGTACATAGCCAAAATGG - Intronic
968728589 4:2259529-2259551 ACGTGGGTCTGTAGTCAAGAGGG + Intronic
970234122 4:13941071-13941093 TTCATGGTATGCAGCCAAGATGG - Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
970695676 4:18674099-18674121 TTCTGGGAATTAAGGCAAGATGG + Intergenic
973539267 4:51919864-51919886 TTTTAGAGATGTAGTCAAGAAGG + Intergenic
975411168 4:74052379-74052401 TTCTGGGTATGTGGTATAAAAGG + Intergenic
978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG + Intronic
982347773 4:154379829-154379851 TTCTGGTTATATGCTCAAGATGG - Intronic
983336771 4:166404371-166404393 TTCTGGGTATATATCCAAAAGGG + Intergenic
983769756 4:171534878-171534900 TTCTGGGGATGTCTTCAAGGGGG + Intergenic
984678793 4:182582249-182582271 TTCCAGGCATGTTGTCAAGAAGG - Intronic
985607645 5:866912-866934 TTCTGGGGAGGAATTCAAGAAGG + Intronic
989317426 5:40098710-40098732 TTCTGGGAATGCAGCCAAGTAGG - Intergenic
990064670 5:51697952-51697974 TTCTGGATATGCAGAAAAGAGGG - Intergenic
990090157 5:52035080-52035102 CTCTGGATATGTACTCAGGAAGG - Intronic
990469181 5:56097900-56097922 TTTTGTGTATTTAGTAAAGACGG + Intergenic
991336648 5:65555678-65555700 TTCTGGATATATTTTCAAGATGG + Intronic
991625048 5:68592543-68592565 TCCTGGGTATATTGTGAAGAAGG + Intergenic
993172703 5:84439683-84439705 TTCAGATTATGTAGTCTAGAGGG + Intergenic
993369811 5:87078642-87078664 TTTTGGCTATGTACACAAGACGG - Intergenic
994482841 5:100358010-100358032 TACTGGGTCTCTATTCAAGATGG - Intergenic
994873246 5:105380548-105380570 TTATGGGTATTGAGACAAGACGG + Intergenic
995139366 5:108717366-108717388 TCCTGGGTATGTGCTCTAGAAGG + Intergenic
995889934 5:116939773-116939795 TTCTGGGTCTGATGTCAAGAGGG - Intergenic
996140829 5:119906606-119906628 TTCTGGGGATGGAGCCAAGATGG - Intergenic
999417797 5:151415009-151415031 GTCAAGGTATGGAGTCAAGAGGG + Intergenic
1000833829 5:166132490-166132512 TTCTGGGTTTTTAATAAAGAGGG + Intergenic
1002050950 5:176570779-176570801 TTTTTGGTATTTAGTAAAGATGG - Intronic
1002336292 5:178480736-178480758 CTCTAGGTATCTAGTCAACAAGG + Intronic
1003692501 6:8368246-8368268 TTTTGTGTTTTTAGTCAAGACGG - Intergenic
1004065715 6:12241941-12241963 TTATGGGAATGCAGTAAAGATGG - Intergenic
1004417490 6:15438037-15438059 TTCTGGGTATGAAGTTACTATGG + Intronic
1004855834 6:19748862-19748884 TTCAGGGAGTGTTGTCAAGAAGG - Intergenic
1007073175 6:39050743-39050765 TTCTGTCTATGAAGTCAAAAGGG + Intronic
1007916882 6:45569413-45569435 TTCTGGGTATGTACACAGGTTGG - Intronic
1009539810 6:64940097-64940119 CTCTGGATAAGTTGTCAAGAAGG - Intronic
1010609508 6:77936649-77936671 TTCTGGGTATCTACTTAGGAAGG - Intergenic
1012396555 6:98804309-98804331 TTCTGGGTATATTTTGAAGAAGG + Intergenic
1014450032 6:121571910-121571932 TTCTGGGGATGAACTCAAGCTGG + Intergenic
1016141588 6:140618752-140618774 TTTTGTGTATGTATTCATGAAGG + Intergenic
1016725197 6:147357165-147357187 CTATAGGTATGTAGTCAAGAGGG + Intronic
1017468170 6:154714392-154714414 TTCTGGTTATTTATACAAGAGGG + Intergenic
1019763306 7:2830390-2830412 TTTTGGGTTTGTAGCCAAGTAGG + Intronic
1023123632 7:36934066-36934088 CTCTGGGAATGAAGCCAAGAGGG + Intronic
1024405108 7:48970016-48970038 TTCTGAGTATGGAGTATAGAGGG - Intergenic
1024840329 7:53578195-53578217 TTTTGGGTTTGTGGTCATGAAGG - Intergenic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1030442336 7:109602246-109602268 TTCTTGGTATAAAGACAAGATGG - Intergenic
1030827323 7:114175170-114175192 TTCTGGTTATAAAGACAAGATGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1032521460 7:132548731-132548753 TTCTGGGAATGTAGCCCAGTAGG - Intronic
1035069262 7:156129353-156129375 TTCAGGATATGTAGCCAACAGGG + Intergenic
1035922542 8:3693240-3693262 TTCTGGGTATATAACCAAGTAGG + Intronic
1037478683 8:19283511-19283533 TTTGGGGTATGAAATCAAGACGG - Intergenic
1041491432 8:58437777-58437799 TCCTGGCTATGTAGTAGAGAAGG + Intronic
1042288546 8:67141689-67141711 TTTTGTGTATTTAGTAAAGATGG + Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043751826 8:83946366-83946388 TTCTTCATATGTAGTCAAGTAGG + Intergenic
1045865139 8:106856684-106856706 TTCTGACTATGTCCTCAAGATGG - Intergenic
1046119890 8:109832508-109832530 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050185672 9:2970218-2970240 TTCTGGGTATGTTTTAAAGGTGG + Intergenic
1050687714 9:8190574-8190596 TCCTGGGCATGTAGTGTAGAGGG - Intergenic
1055687091 9:78787031-78787053 TTCTGGGGAGGTCATCAAGAAGG - Intergenic
1059110837 9:111557130-111557152 TTCTGGGGAGGAATTCAAGAAGG - Intronic
1059927560 9:119226446-119226468 TTCTTGGTATGTAGCCATGTGGG - Intronic
1060600513 9:124874292-124874314 TTCTGGGTGTGAACACAAGAGGG + Intronic
1187441315 X:19323209-19323231 TTCTAGGTATCTACTCAAGAGGG - Intergenic
1187974656 X:24693411-24693433 TTCTGGTTATTTGGTTAAGACGG + Intergenic
1188289317 X:28368203-28368225 TTCTGGGGGTGGAGCCAAGATGG - Intergenic
1189801995 X:44699999-44700021 TTCTGTGTATTTAGTAGAGACGG + Intergenic
1193551099 X:82893625-82893647 GTCTGGGCATGTAGCAAAGAGGG - Intergenic
1193780896 X:85699620-85699642 TCCTGGGGGTGGAGTCAAGATGG - Intergenic
1193795891 X:85872653-85872675 TTCTTGGTAAACAGTCAAGAAGG - Intronic
1194024592 X:88736055-88736077 GTCTGGGTGTGTAGCAAAGAGGG + Intergenic
1195877312 X:109555494-109555516 TCCTGGGAATGCAGCCAAGAAGG - Intergenic
1196490738 X:116262859-116262881 TTCTGGGTATCTACCCAAAAGGG - Intergenic
1196613694 X:117743226-117743248 TCCTGGGTATGAAGCGAAGAGGG - Intergenic
1197339713 X:125251695-125251717 ATCTGGGTATGTAATCACAAGGG - Intergenic
1198701629 X:139402989-139403011 TTCTGTATATGTTTTCAAGATGG + Intergenic
1199313669 X:146351077-146351099 TTCTGGGAATGCAGTCCAGCAGG - Intergenic