ID: 1111761203

View in Genome Browser
Species Human (GRCh38)
Location 13:92467652-92467674
Sequence CTCTTTTACATGCTAGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111761203_1111761205 16 Left 1111761203 13:92467652-92467674 CCTAAAACTAGCATGTAAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 305
Right 1111761205 13:92467691-92467713 AGAGTCGTATTTTTAACTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1111761203_1111761206 17 Left 1111761203 13:92467652-92467674 CCTAAAACTAGCATGTAAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 305
Right 1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111761203 Original CRISPR CTCTTTTACATGCTAGTTTT AGG (reversed) Intronic
901596466 1:10389381-10389403 CTCTTTCACAGGCTGGATTTGGG - Intergenic
901775515 1:11558125-11558147 CTCCTTTACATGCTAAGTTTTGG - Intergenic
902639668 1:17758879-17758901 TTGTTTTATATGCAAGTTTTTGG + Intronic
902973762 1:20073992-20074014 CTCTTTTACTTACTTGTTTATGG - Intronic
903281691 1:22253916-22253938 TTCTTTGGCATTCTAGTTTTAGG + Intergenic
907624938 1:56020991-56021013 CTCTTTTTCTTCCCAGTTTTGGG - Intergenic
907990882 1:59581573-59581595 GTCTATTATATGCTAGTCTTTGG - Intronic
908435748 1:64104222-64104244 CTCTTCTATGTACTAGTTTTAGG - Intronic
908729077 1:67207715-67207737 CTCTTTTTCTTCCTAGTCTTGGG + Intronic
910101538 1:83583184-83583206 CTCTTTTTCTTCCCAGTTTTGGG + Intergenic
910172359 1:84391429-84391451 CTCCTTTGCCTGCTATTTTTTGG + Intergenic
910268329 1:85364959-85364981 CTCTTCTATATTCTAATTTTAGG + Intronic
910995527 1:93100694-93100716 CTCTTTGACATTCTACTTTCAGG + Intronic
911562725 1:99426080-99426102 CTCTTTTAAATTCCATTTTTAGG + Intergenic
911619201 1:100047830-100047852 TTTTTCTCCATGCTAGTTTTAGG + Intronic
911681136 1:100717303-100717325 CTCTTTTTCTTCCTGGTTTTGGG - Intergenic
911763541 1:101644489-101644511 CTCTGCTACATGATAGATTTGGG + Intergenic
911994983 1:104755735-104755757 ATTTTTTAAATTCTAGTTTTTGG - Intergenic
912056804 1:105610674-105610696 ATATTTTACTTGCTAATTTTTGG + Intergenic
912121839 1:106480548-106480570 CTCTTTTACTTCCCAGTCTTGGG + Intergenic
912388581 1:109285641-109285663 CTTGTTTACTTTCTAGTTTTTGG + Intergenic
912937828 1:114019381-114019403 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
913700395 1:121368648-121368670 GACTGTTACATGCTAGCTTTGGG + Intronic
914040946 1:144049106-144049128 GACTGTTACATGCTAGCTTTGGG + Intergenic
914137143 1:144911370-144911392 GCCTGTTACATGCTAGCTTTGGG - Intronic
914321717 1:146569624-146569646 CCCTTTTACAGTCAAGTTTTTGG + Intergenic
914384988 1:147160003-147160025 TTGTTTTTCTTGCTAGTTTTAGG - Intronic
916734925 1:167599114-167599136 CTCTTTTTCTTCCTAGTTTTGGG - Intergenic
917166407 1:172117614-172117636 CTCTTTTTCGTCCTAGTCTTAGG + Intronic
919475527 1:198028731-198028753 CTCATTTACCTGCTCATTTTTGG - Intergenic
920487811 1:206387375-206387397 GACTGTTACATGCTAGCTTTGGG + Intronic
921293423 1:213679751-213679773 CTCTTTAACATGCTGCTTTTAGG - Intergenic
921317247 1:213904350-213904372 CTTTTTTACATGATGGTCTTTGG - Intergenic
923936310 1:238764166-238764188 CCCTCTTATATGCTAGTTGTAGG - Intergenic
924199175 1:241641167-241641189 CTCCTATACCTGCTAGATTTAGG - Intronic
1065085395 10:22169781-22169803 TTCTTTTATCTGCTAGTTTTGGG - Intergenic
1067184891 10:44018174-44018196 CTGTTTTTAATGTTAGTTTTTGG - Intergenic
1067901701 10:50248447-50248469 CTCTCTTAGATGCAATTTTTAGG - Intronic
1069069645 10:63980029-63980051 CTCTTTAACATACGAATTTTGGG + Intergenic
1070461556 10:76675656-76675678 TTTTCTTAAATGCTAGTTTTGGG - Intergenic
1071369691 10:84938721-84938743 CTGTTTTAGATGTCAGTTTTGGG + Intergenic
1072129639 10:92481492-92481514 CTCTTTTAAAAGTTAGTTTAGGG - Intronic
1072164828 10:92803082-92803104 TTCTTTTACATCTGAGTTTTTGG + Intergenic
1072253187 10:93597940-93597962 CTGTTTTACATGCTTGTTTTGGG - Intronic
1072659668 10:97356034-97356056 CTCGTTTCCATTCTAGTTTAAGG - Intergenic
1072867981 10:99084731-99084753 CTCTTGTAAATGCTTGTCTTTGG + Intronic
1072943825 10:99791494-99791516 CTCTTTTAGCTGCTAAGTTTTGG - Intronic
1073232987 10:101988337-101988359 TTATTTTATATCCTAGTTTTAGG - Intronic
1077003790 11:340711-340733 CTCTTTGATATGCAAATTTTGGG - Intergenic
1077960788 11:7074432-7074454 CTCTTTCACATGATAGCCTTGGG + Intergenic
1078225355 11:9386714-9386736 GTATTTCACAAGCTAGTTTTTGG + Intronic
1079114584 11:17633207-17633229 CTGTTCTACATGCTTGTATTAGG + Intronic
1079651668 11:22937290-22937312 ATCTTTTAAAAGCTATTTTTTGG + Intergenic
1080356101 11:31447810-31447832 CTTTTTTTCATTCTTGTTTTAGG + Intronic
1081301764 11:41460521-41460543 CTCTTTTAAATGCCAGTTCTAGG - Intergenic
1082268164 11:50142065-50142087 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
1082969423 11:59003827-59003849 CTCCTTTATATGCTAGTTGTAGG + Intronic
1083393164 11:62370327-62370349 CCCTCTTATATGCTAGTGTTAGG - Intronic
1083451925 11:62752085-62752107 CTCCCTTAGATGTTAGTTTTTGG + Exonic
1083518979 11:63289407-63289429 ATCTTTTCCATGTTAGTTTTGGG - Intronic
1085131374 11:74041910-74041932 CTCTTTTGCATGTTAGTATCAGG - Intronic
1085492769 11:76936053-76936075 CTCTTTTTCTTCCTAGTCTTGGG - Intronic
1086979646 11:93179289-93179311 CACTCTTAGATGCTAGTTTACGG + Intronic
1087904653 11:103681714-103681736 CTCTTTGCCATACTGGTTTTAGG - Intergenic
1088175713 11:107050812-107050834 CTCTTTTTCGTTCCAGTTTTGGG + Intergenic
1089285636 11:117406151-117406173 CTCTTTTTCTTCCCAGTTTTAGG - Intronic
1090111204 11:123911179-123911201 CTCTGAGACATGCTAGCTTTAGG + Intergenic
1092550335 12:9491866-9491888 CTATTTTATATGATAGTTTCTGG + Intergenic
1093116947 12:15222787-15222809 CTTTTTTACATACTGGATTTAGG + Intronic
1093401619 12:18753438-18753460 CTCTGTGTCAAGCTAGTTTTGGG - Intergenic
1093483181 12:19626023-19626045 CTCTTTTTCCTCCCAGTTTTGGG + Intronic
1093684187 12:22037978-22038000 CTCTTTTACTTACAAGTGTTTGG - Intergenic
1094521476 12:31194505-31194527 CTATTTTATATGATAGTTTCTGG - Intergenic
1095234698 12:39782534-39782556 CTCTTTTTCTTCCCAGTTTTGGG + Intronic
1096762879 12:53857753-53857775 CTCTTTTTCAAGATTGTTTTGGG - Intergenic
1097091573 12:56509500-56509522 TTCCTTTATTTGCTAGTTTTAGG + Intergenic
1098523842 12:71463989-71464011 CTCTTTGAAGTGCTAATTTTTGG + Intronic
1099099364 12:78418889-78418911 TTCTTTTCCATTCTATTTTTTGG + Intergenic
1099981465 12:89608642-89608664 CTGTCTTACATTCAAGTTTTGGG + Intronic
1100114226 12:91283569-91283591 CTTCTTTACAAGCTTGTTTTGGG - Intergenic
1100144315 12:91658807-91658829 ATTTTTTACATGTTAGGTTTGGG - Intergenic
1101192205 12:102346586-102346608 CTTCTTTGCATTCTAGTTTTGGG - Intergenic
1103491895 12:121327858-121327880 TTCTTTTACACAATAGTTTTGGG + Intronic
1105554295 13:21431154-21431176 CTCTTTTTCTTCCTAGTCTTGGG - Intronic
1106640002 13:31574180-31574202 TTCTTTTTCAAGCTAGTTATGGG - Intergenic
1106828249 13:33548087-33548109 TTCTTTTACAATATAGTTTTTGG + Intergenic
1108768031 13:53658919-53658941 ATCTTTTACATGTTATTTATGGG - Intergenic
1109286170 13:60410181-60410203 CTCTTTTTCTTCCTAGTCTTGGG + Intronic
1109587572 13:64427010-64427032 CTAATTAACATGCTAATTTTGGG + Intergenic
1110135021 13:72056134-72056156 TTCATTTTCATGCTAGCTTTAGG + Intergenic
1110188442 13:72702034-72702056 CTATTTTACATGATGGTTCTCGG + Intergenic
1111155085 13:84310810-84310832 CTCTTTTTCTTCCCAGTTTTGGG + Intergenic
1111699366 13:91666538-91666560 TTCATTTACATATTAGTTTTAGG + Intronic
1111761203 13:92467652-92467674 CTCTTTTACATGCTAGTTTTAGG - Intronic
1112479330 13:99759272-99759294 CACATTTACATTCTAGTTTAGGG - Intronic
1113503567 13:110797465-110797487 GTCTTTTTCATGTTAGTTTAGGG + Intergenic
1113638563 13:111939667-111939689 CACTTTGAAGTGCTAGTTTTAGG - Intergenic
1115075817 14:29389154-29389176 ATTTTTTAAATGCTAATTTTTGG + Intergenic
1116129148 14:40831868-40831890 CACTTTTACATGATAATTTTAGG - Intergenic
1116574759 14:46558373-46558395 TTCTTTTAAATGCTTGCTTTAGG - Intergenic
1117102317 14:52363208-52363230 CTGGTTTACATGATTGTTTTTGG - Intergenic
1117934819 14:60891357-60891379 TTCTTTTTTCTGCTAGTTTTAGG + Intronic
1119721303 14:76892467-76892489 TTATTTTAAATCCTAGTTTTGGG - Intergenic
1120367030 14:83583683-83583705 CTCTTTTTCTTGCCAGTCTTGGG + Intergenic
1120837527 14:89054854-89054876 CTTTTTTAAAGGGTAGTTTTAGG - Intergenic
1121202564 14:92131366-92131388 AACTTTTGCATGCTAATTTTTGG + Intronic
1121913911 14:97818815-97818837 CTCATTAACATGCTCTTTTTTGG - Intergenic
1126044380 15:44625215-44625237 CTCTGTTACCAGCTATTTTTAGG + Intronic
1126546964 15:49884689-49884711 CAATTTTATATGCTATTTTTTGG + Intronic
1127717525 15:61663848-61663870 ATGTTTTACAGGTTAGTTTTGGG - Intergenic
1128057185 15:64708992-64709014 CTCTTTGACATGCTAATTTCAGG + Intergenic
1128504206 15:68255113-68255135 CCCTTTTCCCTTCTAGTTTTGGG + Intronic
1129102050 15:73274202-73274224 CTCTTTTATATGATATGTTTAGG - Intronic
1130181799 15:81637212-81637234 CTCTTTTTCATCCCAGTCTTGGG + Intergenic
1132381828 15:101371493-101371515 CTATTTTCAATGCTAGTCTTCGG - Intronic
1133782282 16:8948757-8948779 GTGTTTTCCATGCTTGTTTTTGG - Intronic
1134349257 16:13421301-13421323 CTCTTTTTCTTCCTAGTCTTGGG - Intergenic
1135030147 16:19031713-19031735 CTCTTTTACATGACAGTCCTGGG + Intronic
1135351086 16:21729344-21729366 CTATTTTTAATACTAGTTTTAGG + Intronic
1135449561 16:22545471-22545493 CTATTTTTAATACTAGTTTTAGG + Intergenic
1140011912 16:71141520-71141542 CCCTTTTACAGTCAAGTTTTTGG - Intronic
1140559494 16:75961356-75961378 TTCTTTTACATGCTCTTTCTAGG + Intergenic
1141073799 16:80983592-80983614 CTCTTTTACAGGACAGTGTTTGG - Intronic
1141433979 16:83988265-83988287 CTCTTTTACATTTTACCTTTTGG + Intronic
1142842699 17:2646207-2646229 CTTTTTAAAAAGCTAGTTTTTGG - Intronic
1143288115 17:5806802-5806824 ATCCTTTACATGCCAATTTTTGG + Intronic
1143672568 17:8406489-8406511 CTTTTTTTCATGCTTTTTTTTGG + Intergenic
1144191394 17:12849959-12849981 CTCTTTTATGGGCTATTTTTCGG - Intronic
1144909121 17:18665960-18665982 CTCTTTTACAAACTAGATTACGG + Intronic
1148959603 17:51382219-51382241 CACTTTTACATGTTCGTATTTGG - Intergenic
1152443845 17:80328630-80328652 CTCTTTTAGATTCTTCTTTTTGG + Intronic
1153177401 18:2393275-2393297 GTCTTTTACTTGCTAGGTTTAGG - Intergenic
1155177453 18:23313350-23313372 TGCTTTTAAATGCTTGTTTTGGG - Intronic
1155905593 18:31447404-31447426 CTCTTTTACAAGTTAGATTTTGG + Intergenic
1155949311 18:31891986-31892008 CTTTTTTACTTACTAGCTTTTGG - Intronic
1157377695 18:47181506-47181528 CTCTTTTTCTTCCCAGTTTTGGG + Intergenic
1158266914 18:55669412-55669434 CTCCTCTACATGCTAAATTTTGG - Intergenic
1158340825 18:56464507-56464529 CCTTCTTACATGCTAGCTTTAGG - Intergenic
1158736095 18:60081885-60081907 CTATTTTAACTGCTTGTTTTAGG - Intergenic
1159617215 18:70595365-70595387 TTCTTCTACCTGCTATTTTTTGG + Intergenic
1165913328 19:39243366-39243388 CTGTTCTAGATGCTACTTTTAGG + Intergenic
1167813232 19:51853469-51853491 CTCTTTTACCTGCTGGATCTTGG + Intergenic
925497349 2:4467052-4467074 CTCTTCCACATGCTCGCTTTTGG - Intergenic
926489330 2:13504444-13504466 CTCTTTTAAATGTAAGTTATAGG - Intergenic
926944297 2:18170212-18170234 CTCTTTTACTTCCCAGTCTTGGG + Intronic
927910054 2:26891087-26891109 CTCTGTTACAAACTAGTTGTGGG + Intronic
928399379 2:30966795-30966817 CTCTTTTACATGCCACATTTAGG - Intronic
930766650 2:55091730-55091752 CTCTTTTTCTTCCTAGTTTTGGG - Intronic
930853920 2:55992057-55992079 ATCTTTTGCATCCTACTTTTTGG + Intergenic
931739467 2:65228556-65228578 TTGTTTTACATACTAGTATTTGG + Intronic
935346628 2:102114152-102114174 CTCTTTTAAAAACTAGTTTATGG - Intronic
937367251 2:121272361-121272383 CTCCTTAACATGATAGTTTACGG + Intronic
937381182 2:121378270-121378292 CTCTTCTACATGCTTCTGTTTGG + Intronic
938126325 2:128675118-128675140 CTCTTTTTTATGCTTGATTTGGG - Intergenic
938270240 2:129963805-129963827 CCCCCTTATATGCTAGTTTTAGG - Intergenic
938641148 2:133281776-133281798 TTCTTCTTCATGCTAGCTTTTGG + Intronic
939951894 2:148485193-148485215 TTCTTTTCCATGTTAATTTTAGG + Intronic
940462162 2:153978701-153978723 CTCTTTTTCTTCCCAGTTTTGGG + Intronic
940513164 2:154645601-154645623 CTGGTTTACATGATAATTTTAGG - Intergenic
940790617 2:158026771-158026793 CTCTTTTTCTTCCCAGTTTTGGG - Intronic
940790889 2:158028693-158028715 CTCTTTTTCTTCCCAGTTTTGGG - Intronic
941092032 2:161188162-161188184 TTCTTCTTTATGCTAGTTTTGGG - Intronic
941360383 2:164543951-164543973 ATCTAATACATGTTAGTTTTGGG + Intronic
941377276 2:164747112-164747134 CTCTTTTCCTTCCCAGTTTTAGG - Intronic
941592678 2:167439425-167439447 TTGTTTTACTTGCTAGATTTGGG + Intergenic
941600730 2:167540631-167540653 CTCTTTTTCATTGTTGTTTTTGG + Intergenic
942659511 2:178249267-178249289 ATGTTTTACATGCTAGATTGTGG + Intronic
944095941 2:195968223-195968245 CTCTGATACATGCTGGCTTTGGG - Intronic
944204948 2:197148430-197148452 CTAACATACATGCTAGTTTTAGG - Intronic
945069879 2:205979021-205979043 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
945762218 2:213927898-213927920 TTTTTTTACATGCATGTTTTTGG + Intronic
946480941 2:220055895-220055917 CTCTTTTTCTTCCCAGTTTTGGG + Intergenic
948815571 2:240508608-240508630 CTGTGTTACATACTAGTTTATGG + Intronic
1168870599 20:1124748-1124770 CTTTTTTATTTGATAGTTTTTGG - Intronic
1171377569 20:24703809-24703831 CTCGTTTACATGCAGATTTTGGG + Intergenic
1173636358 20:44562313-44562335 CTCTTTTTCATTCTTGATTTTGG - Intronic
1174059779 20:47824734-47824756 CTTTCTTACATGATTGTTTTTGG - Intergenic
1179509684 21:41864463-41864485 CTTTTTGACATGTTGGTTTTTGG - Intronic
1183278307 22:36915956-36915978 CTCTTTTACATCTTAACTTTTGG + Intronic
1203294245 22_KI270736v1_random:25376-25398 GTCTTTTTCATGCTCGTTATTGG + Intergenic
949538913 3:5017184-5017206 CTCTTTTACCTTCTAGTCTTTGG - Intergenic
951161813 3:19432019-19432041 ATTTTTTAACTGCTAGTTTTGGG + Intronic
951594603 3:24303724-24303746 TTCTGTTACTTGTTAGTTTTTGG + Intronic
951731079 3:25810716-25810738 TTAGTTTACATTCTAGTTTTTGG + Intergenic
952111486 3:30128928-30128950 CTATTTTACATGGGATTTTTAGG + Intergenic
952361593 3:32635698-32635720 CTCTTTTACATCTTGGTTCTTGG + Intergenic
955841372 3:63116554-63116576 CTCTTTTTCTTCCCAGTTTTGGG - Intergenic
957050539 3:75408493-75408515 CTCTTTTACCTGATTGTATTAGG + Intergenic
957529376 3:81421574-81421596 ATCATATACAAGCTAGTTTTGGG - Intergenic
957848026 3:85764571-85764593 GTCTTTCAAATGCTAATTTTAGG - Intronic
957880205 3:86202082-86202104 CTCTTTTACATACTCATGTTCGG + Intergenic
958044225 3:88264526-88264548 ATCTTTTACATCATAGTTGTGGG - Intergenic
958518642 3:95156139-95156161 TGCTTTCACAGGCTAGTTTTGGG + Intergenic
958574103 3:95924880-95924902 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
959070648 3:101699145-101699167 CCCTCTTATATGCTAGTTGTAGG + Intergenic
959893509 3:111582602-111582624 CTCTTTTTCTTCCCAGTTTTGGG - Intronic
960268090 3:115644320-115644342 GTATTTTACCTGATAGTTTTTGG + Intronic
960490283 3:118309063-118309085 CCCTTTTACACACTAATTTTTGG - Intergenic
961460935 3:127050003-127050025 CTTTTTTACTGGCTATTTTTAGG + Intergenic
961882838 3:130074933-130074955 CTCTTTTACCTGATTGTATTAGG + Intergenic
962126306 3:132623001-132623023 CTGTTTTACATGCTATTTTTAGG + Intronic
963494350 3:146041692-146041714 CTCTTTTACTTCCCAGTCTTGGG - Intergenic
965253584 3:166374837-166374859 CTCTTTTACATGGCCCTTTTGGG + Intergenic
965516389 3:169625941-169625963 ATTTTCAACATGCTAGTTTTTGG - Intronic
965686637 3:171310418-171310440 ATCTTTTCTGTGCTAGTTTTAGG - Intronic
966578868 3:181536578-181536600 CTCTTCTAAATGCCAGTCTTTGG + Intergenic
968291386 3:197542338-197542360 CTATTTTATGTGCTGGTTTTGGG - Intronic
970198998 4:13582841-13582863 CTCTTTTTAAGGATAGTTTTTGG + Intronic
970339266 4:15087136-15087158 CTCTTTTTCTTCCTAGTCTTGGG - Intergenic
973968546 4:56188142-56188164 CTGTTTTAAATGCTCCTTTTGGG - Intronic
974708777 4:65559832-65559854 TTCTTTTACATGGTTGATTTCGG + Intronic
974834048 4:67225469-67225491 GTCTTTTTCATGGGAGTTTTTGG - Intergenic
977000713 4:91497905-91497927 CTCTTTCACATGTTAGGGTTGGG - Intronic
977129132 4:93211990-93212012 TTCATTTACATGCTTGTTTATGG + Intronic
977238899 4:94542449-94542471 CTCATTTGCCTGCTAGTTTTTGG + Intronic
978774459 4:112491711-112491733 CTCTTTTTCTTCCCAGTTTTGGG - Intergenic
980292335 4:130859540-130859562 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
980384259 4:132066042-132066064 CTCTTTTGCTTGCTCGTTTCTGG - Intergenic
983237221 4:165193206-165193228 CTCATTTGCTTGCTGGTTTTTGG + Intronic
983266077 4:165509643-165509665 CACTGTTACATACTTGTTTTTGG - Intergenic
983573642 4:169236920-169236942 CTCTTCTACTTTGTAGTTTTTGG - Intronic
984104321 4:175526121-175526143 CTATTTTAGATGCTTCTTTTAGG + Intergenic
985304487 4:188523087-188523109 CTCTTTTTCTTCCCAGTTTTGGG + Intergenic
986039307 5:3972511-3972533 CCCTTTTATATGGTACTTTTTGG - Intergenic
986531676 5:8743093-8743115 CTCTTTTTCCTGCCAGTCTTGGG + Intergenic
987655623 5:20801402-20801424 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
987908199 5:24106154-24106176 TTCTTTTACAAGTTAGTTTTAGG - Intronic
988031219 5:25765735-25765757 CTCTTTTACATATGAATTTTTGG - Intergenic
988809082 5:34767080-34767102 CTCTTTTTCTTCCCAGTTTTGGG + Intronic
989291028 5:39766072-39766094 CTCTTTTAAATGCTACTTCCAGG + Intergenic
989389330 5:40883660-40883682 CTCTTTTTCTTCCCAGTTTTTGG + Intergenic
991266000 5:64718919-64718941 CATTTTGAAATGCTAGTTTTTGG - Exonic
993109734 5:83642609-83642631 TTCTTATACATCTTAGTTTTAGG + Intronic
993608203 5:90020660-90020682 CGGTTTTACATGCTAGTCTTTGG - Intergenic
994839308 5:104901361-104901383 ATCTTTTAACTGCTTGTTTTAGG - Intergenic
995066569 5:107869458-107869480 CTCATTTACATGCAAATTTGGGG - Intronic
995139018 5:108713134-108713156 ATCTTTTACCTTATAGTTTTGGG + Intergenic
996519633 5:124412807-124412829 CTCTTTTTCTTGCCAGTTTCAGG - Intergenic
998576475 5:143323237-143323259 CTCTTTTTCTTCCCAGTTTTAGG - Intronic
1000976546 5:167770944-167770966 CTCCTTTAAATTCTAATTTTGGG - Intronic
1001809285 5:174614959-174614981 CTCTTTTCCATGATTGGTTTGGG + Intergenic
1003046712 6:2740114-2740136 CTCTTTTGCATGTGGGTTTTGGG + Intronic
1005291193 6:24380633-24380655 TTCTTATACATGCTAGTTTCTGG + Intergenic
1007959298 6:45944318-45944340 TTCATTTACATACTAGTTTATGG + Intronic
1008295771 6:49774579-49774601 CTCTTTTACATGTTAATTTGAGG - Intergenic
1008822550 6:55651155-55651177 CTCTTACACATGCTGGCTTTAGG - Intergenic
1009667728 6:66705246-66705268 CTCTTTTCCAAGCTAGACTTGGG + Intergenic
1010202280 6:73293172-73293194 TTCTTTTAGAAGCTAGATTTTGG + Intronic
1010288578 6:74108816-74108838 CTCTTTTATCTGCTATTCTTGGG + Intergenic
1010595983 6:77764469-77764491 CTCTTTTTTCTGCTAATTTTTGG + Intronic
1010708339 6:79141193-79141215 TTATTTTACATGTTAGTTTCAGG + Intergenic
1011791687 6:90905922-90905944 CTCTTTTACAGGCTATTTTCTGG + Intergenic
1012099189 6:95008985-95009007 TTCTTTTATATGCAAATTTTTGG - Intergenic
1012410813 6:98954707-98954729 TTCTTTGAAATTCTAGTTTTTGG - Intergenic
1013286253 6:108684709-108684731 CTCTTTTACAAACTAGATTACGG - Exonic
1013298921 6:108784975-108784997 CACTTTTCCATGATAATTTTTGG + Intergenic
1013574873 6:111472540-111472562 TTTTTTTAGATGATAGTTTTGGG - Intronic
1014429850 6:121355371-121355393 TTGTTTTAAATGCTAGGTTTTGG - Intergenic
1014771197 6:125459381-125459403 CTCTTTTTCTTCCTAGTTTTGGG - Intergenic
1015782203 6:136880412-136880434 CTCTTTCTCATGATGGTTTTAGG + Intronic
1015822397 6:137278508-137278530 CTGTTTTAACTGCTAGATTTTGG - Intergenic
1015848686 6:137549590-137549612 CTCTTTTATAGGCTATATTTTGG + Intergenic
1016640085 6:146338293-146338315 GTCTTTTCCATGCCAGTCTTAGG - Intronic
1017557005 6:155582715-155582737 CTCTTTTCCTTTCTAGTTCTTGG + Intergenic
1018341328 6:162854121-162854143 CTCATTAACCTGCTAGTTCTGGG + Intronic
1018541656 6:164886938-164886960 CTCTTTTTCTTCCTAGTCTTGGG - Intergenic
1018875981 6:167823389-167823411 CTCTATTACCTGGTACTTTTAGG + Intergenic
1019067124 6:169311777-169311799 CTCTTTTTCTTCCTAGTCTTGGG - Intergenic
1020535744 7:9395223-9395245 CTCTTTTACATGAAAGATTGAGG + Intergenic
1020604769 7:10323240-10323262 CTTTTATACTTGCTTGTTTTAGG + Intergenic
1021457670 7:20847144-20847166 CTCGTTCACATGCTGGTTCTAGG + Intergenic
1022157603 7:27675925-27675947 ATCTTTTTCATGCCAGTCTTGGG + Intergenic
1022953239 7:35358527-35358549 CTTTTTTCCATGTTACTTTTAGG - Intergenic
1023032494 7:36102921-36102943 CTCATTTACATGCTTGTTGTTGG - Intergenic
1024137762 7:46428733-46428755 CTCTTTTTCTTCCCAGTTTTGGG - Intergenic
1027966767 7:85020933-85020955 CTCTTTTAAATGTCAATTTTTGG - Intronic
1028309323 7:89310652-89310674 CTCTTTTATACTCTAGTTTAGGG - Intronic
1030161894 7:106517754-106517776 CTCTTTTACTTCCTAGTCTCAGG + Intergenic
1031357448 7:120804674-120804696 CTCTTTAACATACGAATTTTGGG - Intronic
1032965470 7:137092146-137092168 CTCTTTTACATGGTGGGCTTTGG + Intergenic
1034082569 7:148293371-148293393 CAGTTTTACAGGCTTGTTTTCGG + Intronic
1034540115 7:151752784-151752806 AACTTTCACTTGCTAGTTTTAGG - Intronic
1035867103 8:3096585-3096607 CTCTTTTTCTTCCTAGTCTTGGG + Intronic
1037021583 8:13978309-13978331 CTCTTTTTCTTTCCAGTTTTGGG - Intergenic
1037103674 8:15079080-15079102 ATCTTTTAGAGGCTAGATTTGGG - Intronic
1037225552 8:16585157-16585179 TTCTTCTACTTGTTAGTTTTCGG + Intergenic
1038138921 8:24821695-24821717 CTCTTTTTCTTCCTAGTTTCGGG + Intergenic
1038368693 8:26965261-26965283 TTCTTTTCCATGATACTTTTAGG + Intergenic
1041740187 8:61149787-61149809 CTATTTCACCTTCTAGTTTTGGG - Intronic
1042026827 8:64432898-64432920 CTTTTGTGCATGCTAGTTTTTGG + Intergenic
1043916733 8:85931068-85931090 CTCTTTTTCAAGATTGTTTTGGG - Intergenic
1043974682 8:86571160-86571182 CTCTTTTTCTTTCTAGTTTCGGG + Intronic
1044009420 8:86974283-86974305 AGCTGTTACATGCTAATTTTGGG + Intronic
1044805932 8:96008024-96008046 CTTTTTTAAAAGCAAGTTTTGGG - Intergenic
1044835016 8:96287410-96287432 CTCTGTTACTTGGTAGTTGTGGG + Intronic
1046251656 8:111640379-111640401 CTCATTTAAATGCTATTTTGAGG + Intergenic
1046840049 8:118846396-118846418 CTCTGTTCCTTGCTAGGTTTTGG + Intergenic
1048884152 8:138895535-138895557 CTCATTTCCAGTCTAGTTTTAGG - Intronic
1049352694 8:142172498-142172520 CTCTTTCACCTGCCAGCTTTGGG - Intergenic
1050904363 9:10985555-10985577 TTCTTATACATTCTAGTTTTTGG + Intergenic
1051239317 9:15036238-15036260 ATCTTTTAAATGCTGTTTTTTGG - Intergenic
1051711687 9:19936861-19936883 CTCTTTTAACTGTTTGTTTTTGG - Intergenic
1051860667 9:21622136-21622158 CTCTTTTTCTTCCTAGTCTTGGG - Intergenic
1051981336 9:23023203-23023225 TTCTTTTACTTGCTAGCTTATGG - Intergenic
1052118175 9:24674984-24675006 CTCTCTTACATGTTTGTATTAGG + Intergenic
1052688128 9:31779636-31779658 TTTTTTTTCCTGCTAGTTTTGGG - Intergenic
1054882723 9:70162079-70162101 ATCATTTACATGCTAATTATAGG + Intronic
1054973401 9:71115467-71115489 CTCTTTTTCATGCTAGATAATGG + Intronic
1055241658 9:74193606-74193628 CTTTCTTTCATGCTACTTTTAGG - Intergenic
1055680084 9:78705476-78705498 CTCTTTTTCTTCCTAGTCTTGGG + Intergenic
1055995866 9:82159292-82159314 CCCTGTTACAAGCTAGTTGTTGG + Intergenic
1056082079 9:83106078-83106100 CTCTCTTACCTGGTACTTTTGGG + Intergenic
1056165236 9:83934740-83934762 CTCTGTGTCATGCTGGTTTTAGG - Intergenic
1056491632 9:87113705-87113727 CTGTTTTACTGGCAAGTTTTTGG - Intergenic
1059358724 9:113722029-113722051 CTCTTTTACAAAATTGTTTTAGG - Intergenic
1059790367 9:117636049-117636071 CTCTTGTACTTGCTACTTTCAGG - Intergenic
1060068257 9:120524064-120524086 CTCTATTACTTACCAGTTTTGGG + Intronic
1060486080 9:124047096-124047118 CTCTGTTACATGATAGTTAAGGG - Intergenic
1061155154 9:128855551-128855573 CCCTCTTATATGCTAGTTGTAGG + Intronic
1186503386 X:10070524-10070546 ATCTTTTACATGCTTGCGTTTGG + Intronic
1186692322 X:11991374-11991396 TTGTTTTACATGATAGTTTATGG - Intergenic
1186831614 X:13396158-13396180 CTCTTTTTCTTCCCAGTTTTGGG - Intergenic
1186831640 X:13396341-13396363 GTCTTTTCCATGCTATTCTTGGG - Intergenic
1187376733 X:18762344-18762366 TTATTTGACATGCTAGTTGTGGG - Intronic
1188795880 X:34463848-34463870 CTCTTTCTCAGGCTAATTTTGGG + Intergenic
1194165957 X:90516467-90516489 CTTTTTTTCCTGCTAATTTTGGG - Intergenic
1194669489 X:96713107-96713129 CTCTTTTACATGCATGAGTTTGG - Intronic
1196792092 X:119473120-119473142 CTCTTATACATGCCAGTGTGTGG - Intergenic
1196834914 X:119804812-119804834 CTCTTTTCCATCCCAGTTTCGGG - Intergenic
1198294800 X:135276148-135276170 CTCTTTTTCAAGATTGTTTTGGG - Intronic
1200361893 X:155615901-155615923 CTCTTTTGCTTGTTAGTTTCAGG - Intronic
1200512228 Y:4094238-4094260 CTTTTTTTCCTGCTAATTTTGGG - Intergenic