ID: 1111761206

View in Genome Browser
Species Human (GRCh38)
Location 13:92467692-92467714
Sequence GAGTCGTATTTTTAACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111761203_1111761206 17 Left 1111761203 13:92467652-92467674 CCTAAAACTAGCATGTAAAAGAG 0: 1
1: 0
2: 2
3: 24
4: 305
Right 1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111761206 Original CRISPR GAGTCGTATTTTTAACTGCT GGG Intronic
909857508 1:80556768-80556790 AAGTTGTATTCTTAATTGCTTGG - Intergenic
911272044 1:95813830-95813852 TATTTGTATTTTTAAATGCTGGG + Intergenic
914383362 1:147141461-147141483 GGGTTATATTTTTAACTTCTTGG + Intergenic
914866345 1:151433024-151433046 TAGTCATTATTTTAACTGCTAGG + Intronic
919322328 1:196058844-196058866 GGGGAGTATTTTTAACCGCTTGG - Intergenic
1067491305 10:46706562-46706584 GAGTGGTATTTTGAAATACTAGG + Intergenic
1067603361 10:47633818-47633840 GAGTGGTATTTTGAAATACTAGG - Intergenic
1068333032 10:55597779-55597801 GAGTGGTATTTTGAAATACTAGG - Intronic
1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG + Intergenic
1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG + Intronic
1074233234 10:111558651-111558673 GATACTTATTTTTAGCTGCTGGG + Intergenic
1086430929 11:86736265-86736287 GAGTCAGATTTGTAACTTCTCGG - Intergenic
1088274592 11:108071762-108071784 GACTGGTCTTTTTAACTCCTGGG + Intronic
1093254690 12:16852707-16852729 GATTCATATTTTCAACTACTTGG - Intergenic
1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG + Intergenic
1107324693 13:39229111-39229133 GAGTCTTGTTCTGAACTGCTTGG - Intergenic
1108906308 13:55478581-55478603 GAGTGGTATGTTTCACTTCTGGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG + Intronic
1115014361 14:28591935-28591957 GAGTCTTATTTTTAAGTTTTAGG - Intergenic
1123681323 15:22766142-22766164 GAGTCGTATTTCTGAAAGCTTGG + Intergenic
1124333537 15:28840604-28840626 GAGTCGTATTTCTGAAAGCTTGG + Intergenic
1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG + Intergenic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1133875925 16:9734245-9734267 GAATCTTATTTTTAAATGCCCGG - Intergenic
1134019804 16:10913634-10913656 GAGTTTTATTTTTAACTGTGAGG - Intronic
1135157951 16:20070513-20070535 CAGTCTAATTTTTAACTGGTTGG - Intronic
1142161582 16:88560543-88560565 GAGTAGTATTTTCAGCAGCTTGG + Intergenic
1149332687 17:55602933-55602955 GAGTAGTATTTTTAAGTATTGGG - Intergenic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1151011453 17:70502683-70502705 TATTCTTACTTTTAACTGCTTGG + Intergenic
1159230644 18:65604299-65604321 GAGTCGTATTTTGATATGCTAGG - Intergenic
1166608793 19:44170115-44170137 AAATGGTATTTTTAACAGCTGGG - Intronic
930633829 2:53783480-53783502 GAATCCTATTTTTCACTTCTGGG - Intronic
931240871 2:60451392-60451414 GTTTGGTATTTTTTACTGCTTGG - Intronic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG + Intergenic
939468064 2:142583763-142583785 GACTCGTATTTTTAGCATCTTGG + Intergenic
940829196 2:158449164-158449186 CAGTTGTATTTTTATATGCTAGG - Intronic
942964877 2:181879953-181879975 GAGTGGTATTTCTGAATGCTTGG + Intergenic
945705752 2:213229307-213229329 AAGTGGTATTTTTAAATGGTAGG + Intergenic
947327615 2:228994780-228994802 TAGTTGTATTTTTAAGTGCCTGG - Intronic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
953433029 3:42855178-42855200 GACTCCTTTTTGTAACTGCTAGG + Intronic
956939349 3:74138778-74138800 GAGTAGTATTTTTGTCTCCTTGG - Intergenic
958681661 3:97339721-97339743 GTGTCGTTTATTTTACTGCTTGG - Intronic
959861267 3:111217500-111217522 GATTTATATTTTTAAATGCTTGG - Intronic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
962879427 3:139562256-139562278 GTGTGGCATTTGTAACTGCTGGG + Intronic
964177130 3:153837590-153837612 GTGTAGTATTGTTAACTACTAGG + Intergenic
971103225 4:23493247-23493269 GAGTCAATTTTATAACTGCTGGG + Intergenic
971627414 4:28939900-28939922 CAGTCTTATGTTTTACTGCTTGG + Intergenic
973030581 4:45332368-45332390 GAGCAGTATTTTTTCCTGCTGGG + Intergenic
974257759 4:59483687-59483709 TAGTCGTATTTTTAATTTTTAGG - Intergenic
976473575 4:85456929-85456951 ATGTAGTATTTTTATCTGCTTGG + Intergenic
980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG + Intergenic
980288125 4:130807348-130807370 TATTTGGATTTTTAACTGCTAGG + Intergenic
983210879 4:164956660-164956682 GAATCTTATTTATAACTGGTTGG - Intronic
986392314 5:7298136-7298158 GAGTCGTATTTCTGAAAGCTTGG + Intergenic
989171934 5:38479947-38479969 GAATCCTGATTTTAACTGCTAGG - Exonic
990038122 5:51348074-51348096 GACTTATATTTTCAACTGCTTGG + Intergenic
990583762 5:57190207-57190229 TAGAGCTATTTTTAACTGCTTGG + Intronic
996211044 5:120810577-120810599 GAGCCATATTTTTCACTGTTGGG - Intergenic
999397360 5:151238550-151238572 AAGTTTTATTTTTAGCTGCTGGG - Intronic
1001370069 5:171191008-171191030 CAGTCATATTTTTAATTACTAGG + Intronic
1003078422 6:3002028-3002050 GATTCTTATTCTTAACCGCTAGG + Exonic
1004720275 6:18263048-18263070 GACTCGGATTTTTAAATGTTTGG + Intronic
1004933744 6:20487487-20487509 GAATAGTATTCTTAAGTGCTAGG - Intronic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1005687571 6:28269726-28269748 TAGTCAGACTTTTAACTGCTTGG + Intronic
1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG + Intergenic
1014471705 6:121823351-121823373 GAGTTGTTTTCTTAGCTGCTGGG - Intergenic
1021133152 7:16935102-16935124 GAGGCCTACTTTTAATTGCTTGG + Intergenic
1023405008 7:39824351-39824373 TAGTCTTATTTTCAACTGCAAGG - Intergenic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1027583960 7:80033785-80033807 TAGTCATATTTTTCACTGGTTGG + Intergenic
1029351309 7:100015096-100015118 GAGTGGTATTTTCAAATACTTGG - Intergenic
1030591069 7:111482546-111482568 GAGTCAAATTTATAGCTGCTAGG - Intronic
1031571585 7:123365987-123366009 GAGTGGAAGTTTCAACTGCTAGG + Intergenic
1031707874 7:125004658-125004680 GACTAGTATCTTAAACTGCTTGG + Intergenic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG + Intronic
1046614443 8:116460686-116460708 GAGTAGTCTGTTTAATTGCTAGG - Intergenic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1051820262 9:21157538-21157560 GAGTCTTATTTTTGTTTGCTTGG - Intergenic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1186625681 X:11290805-11290827 GACACTTATTTTTGACTGCTGGG - Intronic
1189377748 X:40478947-40478969 GAGTAGTATTTTTATTTCCTAGG + Intergenic
1194299880 X:92172816-92172838 GAGTCTTATTTTTACATGCATGG + Intronic
1195460101 X:105114877-105114899 GAGTTGTCTTATTAACAGCTAGG + Intronic
1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG + Intergenic
1199264422 X:145813932-145813954 TAGTCGATTTTTTAAATGCTTGG - Intergenic
1200617551 Y:5398113-5398135 GAGTCTTATTTTTACATGCATGG + Intronic