ID: 1111765090

View in Genome Browser
Species Human (GRCh38)
Location 13:92517612-92517634
Sequence CTGAGGGTCTGACTGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 3, 1: 9, 2: 12, 3: 45, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111765088_1111765090 -8 Left 1111765088 13:92517597-92517619 CCAGCAGACCTGCAGCTGAGGGT 0: 60
1: 4496
2: 2647
3: 1522
4: 975
Right 1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG 0: 3
1: 9
2: 12
3: 45
4: 241
1111765085_1111765090 5 Left 1111765085 13:92517584-92517606 CCTCTGGCAAACTCCAGCAGACC 0: 3
1: 101
2: 1840
3: 3046
4: 2096
Right 1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG 0: 3
1: 9
2: 12
3: 45
4: 241
1111765082_1111765090 30 Left 1111765082 13:92517559-92517581 CCAGGCAAACAGGGTCTGGAGTG 0: 2880
1: 2381
2: 1178
3: 583
4: 480
Right 1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG 0: 3
1: 9
2: 12
3: 45
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111765090 Original CRISPR CTGAGGGTCTGACTGTTAGA AGG Intronic
904430090 1:30458794-30458816 CTGAGGTCCTGACTATTAGAAGG - Intergenic
904969189 1:34405774-34405796 TTCAGGGTTTGACTGGTAGAAGG - Intergenic
910067267 1:83168350-83168372 CTGAGGTCCTGTCTGTTAGAAGG + Intergenic
910550485 1:88468405-88468427 CTGAGTGTCTGTCTGTCACATGG - Intergenic
910827715 1:91427674-91427696 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
911041415 1:93593841-93593863 CTCAGGGGCTGATTTTTAGATGG + Intronic
913512565 1:119574765-119574787 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
913526267 1:119696622-119696644 TGAGGGGTCTGACTGTTAGAAGG - Intronic
913632239 1:120721971-120721993 TGGAGGGACTGTCTGTTAGAGGG + Intergenic
914286480 1:146230946-146230968 TGGAGGGACTGTCTGTTAGAGGG - Intergenic
914547511 1:148681688-148681710 TGGAGGGACTGTCTGTTAGAGGG - Intergenic
914619001 1:149388665-149388687 TGGAGGGACTGTCTGTTAGAGGG + Intergenic
915688552 1:157662521-157662543 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
915906603 1:159882652-159882674 CTCAGGGAGTGCCTGTTAGAAGG + Intronic
916608011 1:166362170-166362192 CTGGGGATCTGAGGGTTAGATGG - Intergenic
918501391 1:185200487-185200509 AGAGGGGTCTGACTGTTAGAAGG - Intronic
918904951 1:190479085-190479107 CTGAGGCGCTGAATGATAGAGGG + Intergenic
920516258 1:206586489-206586511 CTGAGGGTCTGCATGTTGGGAGG + Intronic
921626292 1:217380565-217380587 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
923421834 1:233823182-233823204 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
923766941 1:236901215-236901237 TTGAGGGGCTCACTGTGAGAAGG - Exonic
1062944270 10:1448860-1448882 CTGAGGCTCTGGCTGTTGGTGGG - Intronic
1063289811 10:4733830-4733852 TTGGGGGTCTGACTGGCAGAAGG + Intergenic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1068469849 10:57447715-57447737 AGAGGGGTCTGACTGTTAGAAGG - Intergenic
1068489777 10:57708436-57708458 CTGACTGTATGACTGTTAGAAGG - Intergenic
1068495435 10:57779739-57779761 TGAAGGGTCTGACTGTTAGAAGG + Intergenic
1068646287 10:59471255-59471277 CGGGGGGCCTGACTGTTAGAAGG + Intergenic
1069074120 10:64020585-64020607 CTGAGGGTCCTTCTGTTAGAAGG - Intergenic
1070951098 10:80431546-80431568 ATGAGGGTCTCTCTTTTAGATGG + Intronic
1071443459 10:85724805-85724827 CTGAGAGTCTGAATATTATAAGG + Intronic
1071491708 10:86140753-86140775 CTGAGGGGCTGTCTGTAAAATGG + Intronic
1071844424 10:89506475-89506497 TGAGGGGTCTGACTGTTAGAAGG + Intronic
1078392791 11:10951497-10951519 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1078998452 11:16728481-16728503 AGAGGGGTCTGACTGTTAGAAGG + Intronic
1079308415 11:19344627-19344649 CAGAAGGTCTGGCTGTTAGTTGG + Intergenic
1080534507 11:33208325-33208347 CTGATGGTCTGACGGTAAGATGG - Intergenic
1085253489 11:75159222-75159244 CTGTGTGTCTGACTGTCAGTCGG - Intronic
1085349202 11:75787791-75787813 CTGAAGGGCTGTCTGTTAGTGGG + Intronic
1089910861 11:122099647-122099669 CTGAGGTTTTCATTGTTAGATGG - Intergenic
1091758847 12:3074195-3074217 CTGAGGGGCTGACAGTTGGAAGG - Intergenic
1091975175 12:4818694-4818716 GTGAGGGTCTAACTGTTATTGGG + Intronic
1092049334 12:5456660-5456682 CTGAGGGTCTGGCTCTGGGAGGG + Intronic
1092581573 12:9848841-9848863 CAGAGGGCCTGACTGTCAGAAGG - Intergenic
1093402399 12:18761817-18761839 GAGAGGGCCTGAGTGTTAGAAGG + Intergenic
1093479445 12:19589782-19589804 CTGAGGGTCTTACATTAAGAGGG - Intronic
1093780870 12:23135866-23135888 GTGAGAGTGTGGCTGTTAGAGGG + Intergenic
1094059004 12:26293644-26293666 CTGAGGCTCTGCCTGTTGGGAGG - Intronic
1094123814 12:27001475-27001497 CTGAGAGTCTGAGTTTTTGAAGG + Intronic
1094751301 12:33412616-33412638 CTAAGGGTCTGACTGTTAGAAGG + Intronic
1095356531 12:41281116-41281138 AGAAGGGCCTGACTGTTAGAAGG + Intronic
1095722517 12:45415884-45415906 CTGAAGGTCTGCCAGTTAGGAGG + Intronic
1095830874 12:46585560-46585582 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
1096789858 12:54037926-54037948 CAGAGGGCCTGGCAGTTAGAGGG + Intronic
1096941956 12:55356130-55356152 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
1099492154 12:83300650-83300672 CAGAGGGCCTAACTGTTAGAAGG + Intergenic
1104175295 12:126325893-126325915 CTGAGGGACTGACTGTTAGAAGG - Intergenic
1108189331 13:47921455-47921477 CTGAGGGTTTAAATGTTAAAGGG - Intergenic
1109366710 13:61365117-61365139 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
1110818626 13:79887953-79887975 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG + Intronic
1113348699 13:109507524-109507546 CTGGGGGCCTGACTGTTAAAAGG - Intergenic
1114342656 14:21760959-21760981 TGAAGGGTCTGACTGTTAGAAGG + Intergenic
1115522391 14:34246093-34246115 CTGAGGTTCTGTCTCTCAGAGGG - Intronic
1116165479 14:41329607-41329629 CTGGGGGTCTGACTGTTAGAAGG - Intergenic
1116801234 14:49445579-49445601 TTGAGAGTCTGATTGTTTGAGGG - Intergenic
1117238072 14:53799073-53799095 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
1117614384 14:57518788-57518810 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
1120201435 14:81541557-81541579 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
1123576526 15:21675736-21675758 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1123613150 15:22118204-22118226 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1125219941 15:37320844-37320866 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1125232161 15:37468785-37468807 CTGAGAGCCTGACTGTTAGAAGG - Intergenic
1125731649 15:41895569-41895591 CTGAGGGTCTTACTAGGAGAAGG - Intergenic
1125837453 15:42765033-42765055 TGAAGGATCTGACTGTTAGAAGG + Intronic
1126104327 15:45137758-45137780 TGGAGGGTCTGACTTTTGGAAGG - Intronic
1126749495 15:51862167-51862189 GGGAGGGTCTGACTGTGGGAAGG - Intronic
1126862825 15:52903291-52903313 AGGGGGGCCTGACTGTTAGAAGG + Intergenic
1127373835 15:58363806-58363828 AGAAGGGCCTGACTGTTAGAAGG + Intronic
1127570695 15:60238060-60238082 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1128782295 15:70368630-70368652 CTGAGGGGCCTACTGTTAGAAGG + Intergenic
1128940275 15:71782272-71782294 CTGAGGGTGTGACCGCAAGAGGG + Exonic
1129457220 15:75682426-75682448 CTGAGGGTCTGACTGCTGAGTGG + Exonic
1131347806 15:91667089-91667111 CTGAGGGCCTGTCTGTGAGATGG + Intergenic
1131347816 15:91667153-91667175 CTGAGGGTGAGTCTGTGAGATGG + Intergenic
1202985394 15_KI270727v1_random:409981-410003 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1132805215 16:1772070-1772092 CTGAGGGTCTGCATCTTAGGGGG - Exonic
1133258451 16:4533306-4533328 CTATGGGTCTGACTGGGAGATGG - Intronic
1133453919 16:5926043-5926065 GTGATGTTCTGACTGTTAGCTGG + Intergenic
1135123392 16:19785972-19785994 CTGCGGGTGTCACTGGTAGAGGG - Intronic
1135930032 16:26728476-26728498 CTGAGGGTCTGACCGGATGATGG - Intergenic
1137295291 16:47086682-47086704 CTGAGGGTGAGAATGTAAGATGG + Intronic
1137724560 16:50648227-50648249 AAGAGGGACTGACTGTGAGAAGG - Intergenic
1138007238 16:53349617-53349639 CTGAGGGCCTGACTGTTAGAAGG - Intergenic
1140590400 16:76345294-76345316 CTTAGGCTCTGACTGTTGAATGG + Intronic
1141059741 16:80854753-80854775 CTGAGGTTGTGACTTATAGACGG - Intergenic
1142182499 16:88678125-88678147 CCGAGGCTCTGACTCTTGGAAGG + Exonic
1142184853 16:88689860-88689882 CTGAGGGCCGGATTGTCAGAGGG + Intergenic
1142324925 16:89408580-89408602 CTGAGGGTCTGAGTGTGTGTGGG - Intronic
1144099510 17:11931432-11931454 CTGAGACTCTGACTGTTACATGG - Intronic
1146607956 17:34277931-34277953 AAGAGGGGCCGACTGTTAGAAGG + Intergenic
1147326319 17:39671453-39671475 CAGAGGGTCTTACTGTTCCAGGG - Exonic
1149212289 17:54317262-54317284 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1150169011 17:62972031-62972053 CTTTGGGTCTGAGTTTTAGAAGG + Intergenic
1152622269 17:81371090-81371112 CTCAGTGTCTCACTCTTAGAAGG - Intergenic
1155534034 18:26796863-26796885 TTGAGAGTTTGATTGTTAGATGG - Intergenic
1155618454 18:27748058-27748080 TTGATGGTCTGGCTTTTAGAAGG - Intergenic
1157494830 18:48149281-48149303 CTGGGTGGCTGACTGCTAGATGG + Intronic
1160533975 18:79581380-79581402 CTGCTGGTCTGACTTTTGGATGG + Intergenic
1162054014 19:8052234-8052256 ATGAAGGACTGACTGTGAGAGGG - Intronic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1164429969 19:28178377-28178399 CTGAGGTCCTGTCTGTTAGAAGG + Intergenic
1165287923 19:34858263-34858285 CTGAGGTCCTGACTGTTAGAAGG + Intergenic
1166328302 19:42064739-42064761 CTGATGGGCTGAATGTTCGAAGG - Intronic
1166703974 19:44898133-44898155 CAGAGGGGCTGAGTGTTAGGCGG - Intronic
1167818430 19:51904691-51904713 CTGAGGGTCACTCTGTTAGTAGG - Intronic
925729005 2:6904058-6904080 AGAGGGGTCTGACTGTTAGATGG - Intergenic
928480944 2:31683260-31683282 TGAAGGGTCTGACAGTTAGAAGG - Intergenic
929459586 2:42092777-42092799 GTGAGGCTCTGATTGTAAGAGGG + Intergenic
930439998 2:51392411-51392433 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
930908831 2:56606055-56606077 TCAGGGGTCTGACTGTTAGAAGG - Intergenic
931004198 2:57828857-57828879 AGGGGGGCCTGACTGTTAGAAGG + Intergenic
931566544 2:63620919-63620941 CAGAGGGGCTGACTGTTAGAAGG + Intronic
932377468 2:71250648-71250670 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
936618039 2:114068388-114068410 CTGAGGCTCTTTTTGTTAGAGGG - Intergenic
936775259 2:115965256-115965278 CTGAGGGACTGACTGTTAGAAGG - Intergenic
936814919 2:116448310-116448332 TTGTGGGACTGAGTGTTAGAGGG + Intergenic
939193301 2:138942190-138942212 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
939421330 2:141974263-141974285 CTGAGTGTCTGACTAGTAGAGGG - Intronic
940095247 2:149966649-149966671 CTGAGGGCCTGACTGTTAGAAGG + Intergenic
940370657 2:152896778-152896800 CAGAGCGGCTGACTGTTAGAAGG + Intergenic
942879199 2:180838874-180838896 CTGAGGGTCTGTCTGTTAGAAGG - Intergenic
946065210 2:216981941-216981963 AGAGGGGTCTGACTGTTAGAAGG - Intergenic
947364783 2:229382166-229382188 AGAGGGGTCTGACTGTTAGAAGG + Intronic
947483666 2:230526314-230526336 TGAGGGGTCTGACTGTTAGAAGG + Intronic
947929679 2:233953191-233953213 CTCAGGGTCTGGCTGTTTGAAGG - Intronic
947957243 2:234202633-234202655 CTGAAGGTCTTGCTTTTAGAGGG + Intergenic
1169464033 20:5821996-5822018 CTGAGGGTGTGAGTGCTAGGAGG + Intronic
1171075199 20:22115547-22115569 CTGAGGGTCCTGATGTTAGAAGG + Intergenic
1171736597 20:28793469-28793491 CTGAGGGTCTGTTTGTTAGAAGG - Intergenic
1172239693 20:33404500-33404522 CACAGGGTCTGACTCATAGAAGG + Intergenic
1175415067 20:58795679-58795701 CTGAAGGTCTGAATCTCAGATGG + Intergenic
1177184080 21:17774980-17775002 CAGAGGGGCTGACTGTTAAAAGG - Intergenic
1179828106 21:43979552-43979574 CTGAGGGTCCAATTCTTAGAGGG - Intronic
1181326878 22:22056827-22056849 CGAGGGGTCTGACTGTTAGAAGG - Intergenic
1181672970 22:24434373-24434395 CTCAGGGGCTGGCTGTTGGAGGG + Intronic
1184061069 22:42081835-42081857 CTGAGGGTATGTCTGTGAGAGGG + Intronic
1184104238 22:42358176-42358198 CTGAGAGCCTGACTATTAGAGGG + Intergenic
1184191392 22:42897652-42897674 CTGAGGGACTGCCTGGCAGACGG + Intronic
949440248 3:4072232-4072254 CAAGGGGCCTGACTGTTAGAAGG + Intronic
949579920 3:5377425-5377447 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
951001898 3:17572533-17572555 CTGAAGAGCTGACTGTCAGAGGG - Intronic
951231903 3:20188606-20188628 TTGAGGTTCTGACTTTTTGAGGG + Intergenic
951450060 3:22827221-22827243 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
952259407 3:31725331-31725353 CTAAGGGTCTGATAGCTAGAAGG + Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
956291622 3:67666770-67666792 CGGAGGATTTGACTGTGAGAAGG - Intergenic
956736746 3:72244274-72244296 CTGAGTGGCTGACTTTGAGATGG - Intergenic
956887994 3:73579719-73579741 CTGAGGATCTGACTGTAATAAGG + Intronic
957306723 3:78467279-78467301 CTGAGGGACTGACTGATAGAAGG - Intergenic
957931208 3:86880477-86880499 CTGAGCCTCTCACTGTTTGATGG + Intergenic
959170756 3:102841510-102841532 AGAAGGGTCTGTCTGTTAGAAGG - Intergenic
962634681 3:137318826-137318848 CAGGGGGCCTGACTGTTAGAAGG - Intergenic
962780824 3:138714484-138714506 CTGATGGTCTGATATTTAGAGGG + Exonic
962834065 3:139171685-139171707 CTGAGGTCCTGACTGTTAGAAGG - Intronic
963980352 3:151529609-151529631 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
964377919 3:156068401-156068423 AGAAGGGCCTGACTGTTAGAAGG - Intronic
964715348 3:159715175-159715197 TGAAGGTTCTGACTGTTAGAAGG + Intronic
965651439 3:170938143-170938165 CTGAGGGTCTGACTGTTAGAAGG - Intergenic
967425204 3:189319029-189319051 CTGAGGATCTAAATGTTACAGGG - Intronic
967638713 3:191835351-191835373 AAAAGGGCCTGACTGTTAGAAGG + Intergenic
968868498 4:3228500-3228522 CTAAGGGGCAGACTGTTAGACGG + Intronic
969174011 4:5385430-5385452 CTGAGGTTGTGAGTGTTGGAGGG + Intronic
969979205 4:11137075-11137097 CTTTGGTGCTGACTGTTAGAGGG + Intergenic
970014989 4:11503497-11503519 CTGAGGCTCTCAGGGTTAGAGGG + Intergenic
971438590 4:26655082-26655104 CTGAGGGTCCTGATGTTAGAAGG - Intronic
972500553 4:39674269-39674291 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
972717190 4:41658112-41658134 CCGAGGGTCATACTGCTAGAAGG - Intronic
973081753 4:46002522-46002544 AGGGGGGCCTGACTGTTAGAAGG - Intergenic
975081760 4:70288787-70288809 CTGAGGGACAAACTGTTAAAAGG + Intergenic
975449379 4:74506217-74506239 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
975524351 4:75332205-75332227 ATAGGGGACTGACTGTTAGAAGG + Intergenic
975887324 4:78981652-78981674 CTGAGGTCCTGACTGTTAGAAGG - Intergenic
976809839 4:89089315-89089337 AGAGGGGTCTGACTGTTAGAAGG - Intronic
977154584 4:93556009-93556031 AGAAGGGCCTGACTGTTAGAAGG + Intronic
977771639 4:100868030-100868052 TGAGGGGTCTGACTGTTAGAAGG - Intronic
977887994 4:102273849-102273871 AGAGGGGTCTGACTGTTAGAAGG + Intronic
978194694 4:105957299-105957321 CTGAGGGTCTGGATCTTACATGG - Intronic
978494105 4:109340486-109340508 TGAAGGATCTGACTGTTAGAAGG + Intergenic
979501209 4:121442278-121442300 CAGAGGGCCTGACTGTCAGAAGG - Intergenic
979510615 4:121549917-121549939 TGAAGGATCTGACTGTTAGAAGG - Intergenic
980037737 4:127904733-127904755 TGAAGGGCCTGACTGTTAGAAGG - Intergenic
981131678 4:141163706-141163728 ATAGGGGTCTGACTGTTAGAAGG + Intronic
982899949 4:160986085-160986107 CTGAGAGTCTGACTGGGGGAAGG - Intergenic
982963566 4:161873095-161873117 CTGAGAGTCTAACTGTTAAGAGG + Intronic
985193909 4:187407669-187407691 CAGATGGCCTGACTGTTAGAAGG - Intergenic
988289914 5:29271239-29271261 AGTGGGGTCTGACTGTTAGAAGG + Intergenic
989357991 5:40566625-40566647 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
990098961 5:52157538-52157560 CAGAGGGCCTGTCTGTTAGAAGG + Intergenic
991128236 5:63091199-63091221 TGGGGGGCCTGACTGTTAGAAGG + Intergenic
991364207 5:65852148-65852170 CGGGGGGCCTGTCTGTTAGAAGG - Intronic
992287387 5:75249029-75249051 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
992572976 5:78079067-78079089 CAGATGGTCTGACTTTCAGATGG - Intronic
993960863 5:94295661-94295683 AGAAGGGCCTGACTGTTAGAAGG - Intronic
994265062 5:97705295-97705317 CAGAAGGGCTGACTGTCAGAAGG - Intergenic
994624070 5:102196160-102196182 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
995475142 5:112539856-112539878 GAGGGGGCCTGACTGTTAGAAGG + Intergenic
995541352 5:113189253-113189275 CTGAGAGTCTCACTGTTTAAGGG - Intronic
995620720 5:114022147-114022169 CTAGGGGCCTGACTGTAAGATGG + Intergenic
996243473 5:121230208-121230230 CTGAGGGTCTGACCTTTACATGG - Intergenic
997256953 5:132436217-132436239 CTGAGGGCCTGACAGTTTGAAGG - Intronic
997465737 5:134086961-134086983 CTGAAGGTTTGACTGTTGAAAGG + Intergenic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
998190705 5:140021900-140021922 CTGGAGGTCTGACTGTAGGAAGG - Intronic
998405553 5:141872616-141872638 CTCAGGTTGTGACTGTGAGATGG - Intronic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
1001362559 5:171102837-171102859 AGAGGGGTCTGACTGTTAGAAGG - Intronic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002957126 6:1877147-1877169 CTGTGCCTCTGGCTGTTAGATGG - Intronic
1002979121 6:2117251-2117273 ATGATGGTTTGGCTGTTAGAAGG - Intronic
1003228281 6:4225847-4225869 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1003264181 6:4551215-4551237 CTGAGGGTCTTACTGTTTGGGGG - Intergenic
1004850608 6:19694854-19694876 GTGAGGTTCTGAATGTTGGATGG - Intergenic
1004850617 6:19694899-19694921 GTGAGGTTCTGAATGTTGGATGG - Intergenic
1005406721 6:25497409-25497431 CTGAGCATCTGACTTTGAGATGG + Intronic
1006431625 6:34000703-34000725 CTGAGGGTGTGACAGTCAGGAGG + Intergenic
1006770173 6:36546854-36546876 CTGAGGGACTGACTGGTGGCAGG + Intronic
1009193979 6:60663187-60663209 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1009305793 6:62088439-62088461 AGAAGGGCCTGACTGTTAGAAGG - Intronic
1009536784 6:64897354-64897376 AAGAGGGCCTGACTGTTAGAAGG + Intronic
1010297945 6:74222538-74222560 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG + Intergenic
1010994120 6:82513178-82513200 CGAGGGGCCTGACTGTTAGAAGG + Intergenic
1011137305 6:84114814-84114836 CAGTGGGCCTGACTGTTAGAAGG - Intergenic
1011452491 6:87509478-87509500 TTGAGTGTCTGAATGTGAGAAGG + Intronic
1011760802 6:90563004-90563026 CTGAGGTCCTGACTGTTAGAAGG + Intronic
1012680248 6:102170460-102170482 CTGAGGTCCTCTCTGTTAGAAGG + Intergenic
1012856518 6:104508309-104508331 CTGAGGGTGGTAGTGTTAGAAGG + Intergenic
1013436721 6:110116933-110116955 TGAGGGGTCTGACTGTTAGAAGG + Intronic
1014058392 6:117043329-117043351 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1014423036 6:121268036-121268058 CGGAGGGTCCTACTGTTAGAAGG + Intronic
1014702872 6:124712028-124712050 CTGAGGGTCCTGCTGTTAGAAGG - Intronic
1014704264 6:124726489-124726511 CTGAGGGTCCTGCTGTTAGAAGG + Intronic
1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG + Intergenic
1015133116 6:129836320-129836342 TGAGGGGTCTGACTGTTAGAGGG + Intronic
1015802175 6:137071033-137071055 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1020061654 7:5157012-5157034 CTGATGGTCTGATGGGTAGATGG - Intergenic
1020166504 7:5811649-5811671 CTGATGGTCTGATGGGTAGATGG + Intergenic
1020564335 7:9777128-9777150 CTGATGGTTTGACTGTTAACTGG + Intergenic
1020810073 7:12840412-12840434 TTGGGGGCCTGTCTGTTAGAAGG + Intergenic
1023965414 7:44961293-44961315 CTGAGGGGCTGAGTGGTTGAGGG + Intergenic
1023965462 7:44961418-44961440 CTGAGGGGCTGAGGGTTTGAGGG + Intergenic
1023965501 7:44961531-44961553 CTGAGGGGCTGAGTGGTTGAGGG + Intergenic
1025552805 7:62271418-62271440 CTGAGGGTCCTTCTGTTAGAAGG - Intergenic
1028458525 7:91064715-91064737 CAGAGGATCTGAGTGCTAGATGG - Intronic
1028801294 7:94969383-94969405 AGGGGGGCCTGACTGTTAGAAGG - Intronic
1030202557 7:106919695-106919717 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1031711110 7:125047199-125047221 GAGGGGGCCTGACTGTTAGAAGG + Intergenic
1032911177 7:136432111-136432133 CTGCAGACCTGACTGTTAGAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034387760 7:150754501-150754523 GTGAGGATCTGCCAGTTAGAGGG + Intergenic
1034426778 7:151018201-151018223 CGGAGGGTCTGTCTGGGAGAGGG - Intronic
1036551302 8:9816857-9816879 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
1037627473 8:20620581-20620603 CAGAGGATCTGAGTCTTAGAGGG + Intergenic
1038922397 8:32099238-32099260 CTGAGGGTCTGATAGTAAGTTGG + Intronic
1040968705 8:53111719-53111741 CAGAGGGCCAGACTGTTGGAAGG - Intergenic
1041485465 8:58370953-58370975 CTGAGGTCCTGTCTGTTAGAAGG + Intergenic
1041836738 8:62224326-62224348 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
1041951617 8:63509987-63510009 TGAGGGGTCTGACTGTTAGAAGG - Intergenic
1042431710 8:68714091-68714113 CTGAGGGTTTTAATGTTAAAGGG - Intronic
1042729741 8:71919484-71919506 CTTACGGTCTGACTTTTAGATGG - Intronic
1044748688 8:95395697-95395719 CTGAGAGGCTGACTTTGAGAAGG + Intergenic
1044940142 8:97334380-97334402 AGGGGGGCCTGACTGTTAGAAGG - Intergenic
1045945933 8:107796055-107796077 CTGAGGGTCTGAGTGGGAGCAGG + Intergenic
1046047864 8:108985799-108985821 AGAGGGGTCTGACTGTTAGAAGG - Intergenic
1048382636 8:133880896-133880918 CTGAGGGTCTGTTTTATAGATGG - Intergenic
1049225964 8:141450635-141450657 CTTAGGGTCTGAGTGTTGGGTGG + Intergenic
1050404585 9:5293914-5293936 GAGGGGGCCTGACTGTTAGAAGG + Intergenic
1050407765 9:5327813-5327835 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1050851360 9:10290967-10290989 AGGAAGGTCAGACTGTTAGATGG - Intronic
1051176109 9:14362217-14362239 TTGAGGGCCTAACTCTTAGAAGG - Intronic
1052117585 9:24668080-24668102 CTGAGGGCCTGACTGTTAGAAGG - Intergenic
1053164724 9:35836355-35836377 CTGAGGGTTCTTCTGTTAGAAGG + Intronic
1055537770 9:77267404-77267426 AAAGGGGTCTGACTGTTAGAAGG - Intronic
1057570265 9:96198891-96198913 CTCAGGGGGTGGCTGTTAGAAGG - Intergenic
1057763162 9:97892430-97892452 CCTAGGGTCTGACTTTTAGAAGG + Intergenic
1058009605 9:99961894-99961916 TGGAGGGTCTAACTCTTAGAAGG + Intronic
1058490549 9:105494710-105494732 CTGAGGTCCTGTCTGTTAGAAGG - Intronic
1058593266 9:106587799-106587821 CAGAGGGTTAGACTGTTCGAAGG - Intergenic
1059088961 9:111335194-111335216 AGAAGGGCCTGACTGTTAGAAGG + Intergenic
1059547608 9:115193982-115194004 CTGAGGCTTTGACAGTTAGTAGG - Intronic
1203384652 Un_KI270438v1:12597-12619 CTGAGGGTCTGCCTGTTAGAAGG + Intergenic
1188193328 X:27197889-27197911 AGAGGGGTCTGACTGTTAGAAGG + Intergenic
1190420284 X:50223503-50223525 AGAAGGGCCTGACTGTTAGAAGG - Intronic
1190505992 X:51126128-51126150 CAAGGGGCCTGACTGTTAGAAGG + Intergenic
1191848488 X:65568556-65568578 AGAAGGGCCTGACTGTTAGAGGG - Intergenic
1192703080 X:73497276-73497298 TTAGGGGTCTGACTATTAGAAGG - Intergenic
1192958079 X:76095082-76095104 AGAAGGGCCTGACTGTTAGAAGG - Intergenic
1193040359 X:76998226-76998248 ATAGGGGCCTGACTGTTAGAAGG - Intergenic
1193376494 X:80767457-80767479 CTGAGGACCTAACTGTTAGAAGG + Intronic
1195244994 X:102987473-102987495 CTGAGGGTCTTCCTGTTCTATGG + Intergenic
1195484653 X:105390125-105390147 CTGAGAGTCTGACTGTTAAAGGG - Intronic
1195810526 X:108824461-108824483 CAGAGGGCCTGACTGTTAGAAGG - Intergenic
1195988431 X:110657787-110657809 TGAGGGGTCTGACTGTTAGAAGG + Intergenic
1198112688 X:133515460-133515482 CTGTGGGTGTGAGTATTAGAAGG - Intergenic
1198295287 X:135281727-135281749 AGAAGGGCCTGACTGTTAGAAGG - Intronic
1200407714 Y:2830188-2830210 CAGAGGGGCTGACTGTTAGAAGG + Intergenic
1201682564 Y:16664877-16664899 CTGAGTGTGTGTCTGTTTGAAGG + Intergenic