ID: 1111767280

View in Genome Browser
Species Human (GRCh38)
Location 13:92547608-92547630
Sequence TAGGATAGCCCCAGACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111767277_1111767280 16 Left 1111767277 13:92547569-92547591 CCTGTCAACTTCAGACTGGATAC 0: 1
1: 0
2: 0
3: 19
4: 188
Right 1111767280 13:92547608-92547630 TAGGATAGCCCCAGACAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111767280 Original CRISPR TAGGATAGCCCCAGACAGCC AGG Intronic
901885481 1:12220003-12220025 TAGAACAGTCCCAGGCAGCCAGG + Intergenic
902614843 1:17618229-17618251 GAGGAGAGCCCTAGCCAGCCTGG - Intronic
910288251 1:85577284-85577306 CAGGAGAGCCCCAGGAAGCCAGG - Intronic
913282928 1:117202751-117202773 TTGGATGGACCCAGACAACCTGG + Intronic
921257508 1:213355845-213355867 ATGAATAGACCCAGACAGCCTGG - Intergenic
924586271 1:245363814-245363836 TACGACCGCCACAGACAGCCAGG - Intronic
1065417175 10:25501206-25501228 TAGGTTAGCACCAGACAGCGTGG + Intronic
1065869251 10:29941970-29941992 TAGGATAACTCTAGGCAGCCTGG - Intergenic
1065871623 10:29960813-29960835 TTGGCTAACCCCAGAGAGCCAGG + Intergenic
1068357803 10:55933210-55933232 TAGGAATCACCCAGACAGCCTGG + Intergenic
1070911117 10:80119258-80119280 TAGTATAGCCCCAACCAGCTAGG - Intergenic
1073443891 10:103569646-103569668 CAGAAGAGCCCCAGACAGTCTGG - Intronic
1074563457 10:114554793-114554815 TAGGATAGGCCAAGACACACAGG - Intronic
1079097635 11:17521058-17521080 TCGGAGAGCCCCAGCCAGCCTGG + Intronic
1081732517 11:45381526-45381548 TAGGATAGCTCCTGTCACCCTGG - Intergenic
1083619249 11:64040829-64040851 TAGCTGAGCCCCATACAGCCGGG - Intronic
1083661111 11:64252125-64252147 GAGGATGCCCCCAGCCAGCCTGG - Intronic
1084534044 11:69746374-69746396 AAGCATGGCCCCAGCCAGCCTGG - Intergenic
1084603829 11:70161563-70161585 TGGGATGGCCCCCAACAGCCTGG - Intronic
1084774490 11:71366367-71366389 TAGGAAACCCCAAGACGGCCGGG - Intergenic
1086404445 11:86487965-86487987 TAGGACAGCCTCAGACTCCCGGG - Intronic
1088382492 11:109210053-109210075 TAGCATTAACCCAGACAGCCAGG - Intergenic
1094023884 12:25942257-25942279 TAGGATAGGTCTAGACAGTCTGG - Intergenic
1099213814 12:79829230-79829252 TAGCATAGCCCCACACAAACAGG + Intronic
1100215893 12:92448091-92448113 TATGAGATCCCCAGACACCCAGG - Intergenic
1100216131 12:92450536-92450558 TATGAGATCCCCAGACACCCAGG - Intergenic
1100565243 12:95789518-95789540 TAGGGCAGCCCAAGAAAGCCAGG + Intronic
1101492297 12:105220881-105220903 TAGGAGAGACCCAGAGAGTCTGG - Intronic
1110529562 13:76580413-76580435 TAGGATCGGCTCAGGCAGCCTGG - Intergenic
1111767280 13:92547608-92547630 TAGGATAGCCCCAGACAGCCAGG + Intronic
1118699669 14:68421060-68421082 TAGGATAGCCCCTCCCACCCTGG + Intronic
1118920345 14:70144133-70144155 TAGGATGGACCCAGACAACGTGG + Intronic
1118991459 14:70800760-70800782 AAGGATTCCCCCAGACATCCTGG - Exonic
1122284186 14:100641042-100641064 TGAGACAGCCCCAGACTGCCAGG - Intergenic
1123463328 15:20494377-20494399 TAAGATCGCCCCAGACTGGCTGG + Intergenic
1123654731 15:22506034-22506056 TAAGATCGCCCCAGACTGGCTGG - Intergenic
1124274171 15:28311784-28311806 TAAGATCGCCCCAGACTGGCTGG + Intronic
1124308643 15:28601236-28601258 TAAGATCGCCCCAGACTGGCTGG - Intergenic
1124789279 15:32712139-32712161 CAGGATAGCCAGAGACAGCGGGG + Intergenic
1125504309 15:40258156-40258178 TAGGACAGCCCCAGGCCCCCTGG + Intronic
1127640331 15:60910051-60910073 TAGAATGGCTCCACACAGCCAGG - Intronic
1128318398 15:66675727-66675749 AAGCCTGGCCCCAGACAGCCTGG + Intronic
1128631179 15:69269106-69269128 TATGATAGTCCCAGCGAGCCAGG - Exonic
1128845565 15:70891916-70891938 GAGGAGAGCTCCAGGCAGCCAGG - Exonic
1129396608 15:75252901-75252923 CAGGATAGGCCCAGCCAGGCTGG + Intergenic
1131259762 15:90882261-90882283 TAGGCCAGCCCCCGACTGCCTGG - Exonic
1132107413 15:99073217-99073239 CAGGAAAGCCCCACACAGACAGG - Intergenic
1132293901 15:100720920-100720942 TAGGAGAGTTCCAGAGAGCCTGG + Intergenic
1132563464 16:609559-609581 GAGGAAAGACCCAGACAGGCAGG + Intronic
1137874583 16:51984028-51984050 TAGGAAAGCACCAGAGAGACAGG + Intergenic
1139208825 16:65056223-65056245 TGAGAAAGCTCCAGACAGCCAGG + Intronic
1144378145 17:14666066-14666088 CAGCATGGCCCCTGACAGCCTGG + Intergenic
1145298499 17:21613349-21613371 CAGTATAACCCCAGATAGCCAGG - Intergenic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146302383 17:31699565-31699587 GAGTATACTCCCAGACAGCCAGG + Intergenic
1156394279 18:36683991-36684013 TAGGAAAGCCACAAAGAGCCAGG + Intronic
1161473594 19:4473010-4473032 CAGGATACCCCCAGACTCCCAGG - Intronic
1163250587 19:16124379-16124401 TTGGATGGCCCCAGACAACTTGG + Intronic
925288740 2:2732380-2732402 TAGGATGGCCTCAGACAGCAAGG + Intergenic
926541569 2:14186477-14186499 TAGGACAGTCCCTGGCAGCCTGG - Intergenic
930162377 2:48171391-48171413 TAGTATAGCCCAAGACAGCTTGG + Intergenic
931622453 2:64224499-64224521 TATCATAGCCCCAGCCAGGCAGG - Intergenic
932775147 2:74524081-74524103 GAGGATTGCCCCAGAAAGCTCGG + Exonic
934473957 2:94580349-94580371 TAGAATGGCCTCAGTCAGCCGGG - Intergenic
937587217 2:123567282-123567304 TAAGATTGCACCAGCCAGCCTGG + Intergenic
948511126 2:238466070-238466092 TGGGAGAGCCACAGGCAGCCCGG - Intergenic
949036164 2:241816614-241816636 GGGGATGGCCCCAGGCAGCCTGG + Exonic
1170778065 20:19396536-19396558 TAGGATAGCCACTGACAACGTGG - Intronic
1175383079 20:58577105-58577127 TAGGAGAAACCCAGACAGCACGG + Intergenic
1175466672 20:59194279-59194301 CAGGACATCCCCAGAGAGCCTGG - Exonic
1175893414 20:62325286-62325308 TAGGACAGCACCAGACTGCGAGG - Intronic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1179880251 21:44290629-44290651 CAGAATCCCCCCAGACAGCCAGG - Intronic
1182409389 22:30170295-30170317 GAGGGCAGCCCCAGGCAGCCAGG - Intronic
1183089215 22:35509820-35509842 TAGCATGGACCCACACAGCCAGG + Intergenic
1183270701 22:36860967-36860989 CAGGCTAGGCCCAGAGAGCCTGG + Exonic
1183731480 22:39621051-39621073 TATAAAAGCCCCAGGCAGCCAGG - Intronic
1184182884 22:42842928-42842950 CAAGAGAGCCCCATACAGCCTGG - Intronic
1184333823 22:43841673-43841695 GCAGATAGCCCCAGATAGCCAGG - Intronic
949782395 3:7704780-7704802 CAGGATATGCCCAGAGAGCCAGG - Intronic
950501189 3:13364996-13365018 TAGGGGAGCCCCAGACTCCCTGG - Intronic
950637018 3:14322641-14322663 TAAGAGAGCTCCAGGCAGCCTGG + Intergenic
951676777 3:25250274-25250296 GAGGATAGACCCACACAGGCTGG - Intronic
951844374 3:27069866-27069888 TAGGAGAGTCCCAGACAAACTGG - Intergenic
952071726 3:29645383-29645405 TTGGACAGCACCAGACACCCTGG - Intronic
955666856 3:61358511-61358533 TGGGAGAGCAACAGACAGCCAGG - Intergenic
958890254 3:99775253-99775275 TGGGAGAGCACCAGACAGCCTGG - Intronic
960908688 3:122626716-122626738 CAGGAAAGCCCCTCACAGCCAGG - Intronic
962974461 3:140434034-140434056 GAGGGCAGCCCCAGCCAGCCTGG + Intronic
964549500 3:157871047-157871069 TAGGAGAGTCCCAGACAAACTGG + Intergenic
968473938 4:794285-794307 TGTGATAGCTTCAGACAGCCAGG - Intronic
977637989 4:99322801-99322823 GAAGATAGCCCCAGATAACCTGG + Intergenic
977918863 4:102622396-102622418 GGCGATAGCCCCAGTCAGCCAGG + Intergenic
988554007 5:32221054-32221076 TAGGCTAGACCAAGCCAGCCAGG + Intergenic
991956083 5:71997189-71997211 TAGGTAAGCCCCAGACGGCAGGG - Intergenic
996190227 5:120531399-120531421 CTGCAAAGCCCCAGACAGCCAGG + Intronic
997474459 5:134134519-134134541 TAGAATAACACCAGCCAGCCAGG - Intronic
999658373 5:153832894-153832916 TAGGACAGTGCCAGACAGCCTGG - Intergenic
1001804711 5:174573569-174573591 TTGGCTGGCCCCAGACAGCCAGG + Intergenic
1002061004 5:176626145-176626167 CAGGATACACGCAGACAGCCAGG + Intronic
1002567092 5:180118362-180118384 AAGGATGACCCCAGGCAGCCCGG + Intronic
1006116567 6:31779008-31779030 CAGGATAGCCCGAGGCAGCACGG + Exonic
1017122744 6:151039619-151039641 TAGAATGGCCTCAGTCAGCCGGG + Intronic
1017709096 6:157150232-157150254 GAAGATAGCCACAGAGAGCCAGG + Intronic
1019616214 7:1963735-1963757 TGGGAGTGCCCCAGACACCCAGG - Intronic
1021891349 7:25188838-25188860 TAGCAGAGCCGCAGACAGCCAGG - Intergenic
1021993232 7:26156060-26156082 TATGCTAGACCCAGACTGCCTGG + Intronic
1023863621 7:44228815-44228837 TAGGAGAGCCGGAGACAGGCAGG + Exonic
1024434215 7:49330118-49330140 AAGAAAAGCCCAAGACAGCCAGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1026999705 7:74643786-74643808 AAGGATAGCCCTGGACAGCCAGG + Intergenic
1027044313 7:74981475-74981497 TAGAATAGAAGCAGACAGCCTGG - Intronic
1027443447 7:78245577-78245599 TAGGATGGCCCCAGAGAGGATGG + Intronic
1028540910 7:91941149-91941171 TAGGAGAGCCCGAGGCAACCGGG + Intronic
1033736703 7:144229451-144229473 TAGGATTGGCCCAGGCATCCAGG - Intergenic
1037401200 8:18496912-18496934 TATGCTAGCCCCTGAGAGCCAGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1045599297 8:103694508-103694530 CAGGATAGCCCCAGCCATCCTGG - Intronic
1047783405 8:128130117-128130139 TAGGAGATCCCCAGAGAGTCAGG - Intergenic
1048378504 8:133843927-133843949 AAGGATTTCCCCAGACAGCCTGG - Intergenic
1048691861 8:136974735-136974757 AAGGAGAGTCCCAGACAGCAAGG + Intergenic
1048844576 8:138594511-138594533 CAGGACAGCCACGGACAGCCAGG + Intronic
1050063625 9:1736063-1736085 AATGATGGCTCCAGACAGCCAGG - Intergenic
1051576872 9:18626092-18626114 GAGGATAGCCCAAAGCAGCCAGG - Intronic
1052477497 9:28979104-28979126 TAAGATAGCCCGAGACAGAAAGG - Intergenic
1053162229 9:35821072-35821094 TAGGAGGGGCCCAGACAGACAGG - Intronic
1053684118 9:40505783-40505805 TAGAATGGCCTCAGTCAGCCGGG + Intergenic
1053934091 9:43134065-43134087 TAGAATGGCCTCAGTCAGCCGGG + Intergenic
1054279604 9:63119170-63119192 TAGAATGGCCTCAGTCAGCCGGG - Intergenic
1054297212 9:63341247-63341269 TAGAATGGCCTCAGTCAGCCGGG + Intergenic
1054395232 9:64645755-64645777 TAGAATGGCCTCAGTCAGCCGGG + Intergenic
1054429879 9:65150955-65150977 TAGAATGGCCTCAGTCAGCCGGG + Intergenic
1054500504 9:65870577-65870599 TAGAATGGCCTCAGTCAGCCGGG - Intergenic
1058198507 9:102008888-102008910 TAGGAAATGCCCAGACAGCAGGG + Intergenic
1062082142 9:134629815-134629837 TGGGCCAGCCCCAGACAGGCTGG - Intergenic
1062182392 9:135197544-135197566 AAGGAAAGCCCCAGACTGCAAGG + Intergenic
1062303896 9:135891082-135891104 GAGGGCAGCCCCAGACAGCCAGG + Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1186845009 X:13522061-13522083 GAGAATAGCCCCTGGCAGCCTGG - Intergenic
1187399712 X:18948645-18948667 TTGGTGAGCCCCAAACAGCCTGG + Intronic
1190756290 X:53404863-53404885 TAGCATAGAGTCAGACAGCCAGG - Intronic
1191015452 X:55805147-55805169 AAGGAAAGCCGCAGACAGCCAGG - Intergenic
1197769488 X:130081190-130081212 TCAGATAGACACAGACAGCCAGG - Intronic
1200763328 Y:7059515-7059537 AAGGAAAACCCCAGCCAGCCTGG - Intronic
1200769181 Y:7107911-7107933 AAGGAAAACCCCAGCCAGCCTGG + Intergenic