ID: 1111767594

View in Genome Browser
Species Human (GRCh38)
Location 13:92552468-92552490
Sequence CTTTGTAAGGGGAAGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111767594 Original CRISPR CTTTGTAAGGGGAAGATAAA TGG Intronic
902349592 1:15844293-15844315 CTTTGTAACAGGAATACAAATGG + Intergenic
904104938 1:28071802-28071824 TTTTGTAAAGGGTAGTTAAATGG - Intronic
904739913 1:32666174-32666196 CACTGTAAGGAGAAGATAAACGG + Intronic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905592662 1:39178061-39178083 ATTTGTAAGGAGAAGACAATGGG - Intronic
906577736 1:46905850-46905872 CCTTAAAATGGGAAGATAAAGGG + Intergenic
907666226 1:56435931-56435953 CTTTGTGAGGGGAAAACAAATGG - Intergenic
909117708 1:71560153-71560175 CTTTGTCAGTTGCAGATAAAAGG - Intronic
910097610 1:83541375-83541397 AATTGTAAGGGGAATATCAAGGG + Intergenic
910719439 1:90269782-90269804 CTTTGTGTGGGGAAGAAAAGAGG + Intergenic
910744340 1:90557109-90557131 CACAGTAAGGGGAACATAAAGGG + Intergenic
910828710 1:91437428-91437450 TTTTGTAAGGAAAAGACAAAGGG - Intergenic
911388062 1:97202736-97202758 CTTTGTAAAGGACAGATACAAGG - Intronic
911393961 1:97282363-97282385 CTTTGTAAAGATAAAATAAATGG - Intronic
913504920 1:119508071-119508093 CTTTGTGAGGGCAAAATAAAAGG + Intronic
913519954 1:119635682-119635704 CCTTCTAAGGGGATGAAAAATGG + Intronic
915494648 1:156273167-156273189 TGGTGGAAGGGGAAGATAAATGG - Intronic
916698090 1:167261464-167261486 CTTTTTAAGAGCAAGATATAGGG + Intronic
918702549 1:187623330-187623352 TTTTTTAAGGGTAAGAGAAAGGG + Intergenic
919971345 1:202581463-202581485 CTTTGAAGGGGGAAGATAAGTGG - Exonic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
922966088 1:229692128-229692150 CTTTGGGAGGTCAAGATAAAAGG - Intergenic
923617348 1:235548814-235548836 CTCTGTCAGTGGAAGATGAATGG - Exonic
923987926 1:239402392-239402414 CCTTGTAAGGGGGAGATGATGGG - Intronic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1064294146 10:14062855-14062877 CAGTGAAAGGGGAAGATACATGG + Intronic
1064532006 10:16320071-16320093 TTTTGGAAGGGAAAAATAAATGG + Intergenic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1065011621 10:21426438-21426460 CTATGTAAAGTGAAGAAAAATGG - Intergenic
1065421455 10:25549259-25549281 CTTAGGAGGGGGAAGACAAATGG - Intronic
1065642434 10:27797851-27797873 CTTAATAAGGAGAAAATAAATGG + Intergenic
1066504764 10:36029568-36029590 CTTTGCACTGGGAAGAGAAATGG - Intergenic
1066528436 10:36308449-36308471 CTTGGAAAGGGGAAAAAAAAAGG + Intergenic
1067757756 10:49017876-49017898 CTTTGGGAGGGGAGGATATATGG - Exonic
1068043727 10:51859692-51859714 GTTTGGAAGGTAAAGATAAAAGG - Intronic
1068684122 10:59851915-59851937 CTTTGAAAGGGGGAAAAAAAAGG + Intronic
1069120955 10:64568196-64568218 CTTTGGAAGGTCAAGATAAGAGG - Intergenic
1069589786 10:69634595-69634617 CTTTGCAAGGGGAAAATGAAAGG - Intergenic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG + Intergenic
1071459204 10:85876404-85876426 CTTTATAAGAGGAACACAAAGGG - Intronic
1071906731 10:90182438-90182460 CTTTGATAGGGGAAGAGAAAAGG + Intergenic
1072440987 10:95454961-95454983 CTTCATTAGGGGAAGTTAAAAGG + Intronic
1073015445 10:100395465-100395487 CTTTGGAAGGGGAGGAGAAAGGG - Intergenic
1074157299 10:110810248-110810270 CCTTGTGTGGGGAAGACAAAAGG - Intronic
1074855977 10:117473847-117473869 TTTTGTAAGAGCAAGACAAAAGG - Intergenic
1076208331 10:128621072-128621094 GTTTGTGAAGGGAACATAAATGG + Intergenic
1076208542 10:128622789-128622811 GTTTGTGAAGGGAACATAAATGG + Intergenic
1079381676 11:19943888-19943910 CTTTGTAAGGCTAAAAGAAACGG + Intronic
1079590893 11:22181295-22181317 CTTCTTAAGGGGAAGATAGAGGG - Intergenic
1079777712 11:24554867-24554889 CTTTGCAAGTGGAAGATTAGGGG + Intronic
1080711868 11:34756133-34756155 CTTTTTAAGAGGAAGAACAAAGG + Intergenic
1082935787 11:58655192-58655214 CTCTGTCAGGTGAAAATAAAAGG - Intronic
1086358507 11:86032095-86032117 CTTTGCAACAGGAAGATAACAGG + Intronic
1086781925 11:90917619-90917641 CTTTGTAGGAAGAAGATATATGG + Intergenic
1088512489 11:110592499-110592521 CTTTAAAATGGGAAAATAAATGG - Intronic
1088589447 11:111390806-111390828 CCTTGTTTTGGGAAGATAAATGG - Intronic
1089828903 11:121307162-121307184 TTGTGTAATGGAAAGATAAAAGG - Exonic
1090990358 11:131811759-131811781 GTATGTGAGGGGAAGATAAGAGG + Intronic
1091686948 12:2569328-2569350 CATTGTAAGGGGTAAATATATGG - Intronic
1092107687 12:5934288-5934310 CTGTGCAAAAGGAAGATAAATGG + Intronic
1093633314 12:21435824-21435846 CTTCACAAGGGGAAGAAAAAAGG + Intergenic
1094006102 12:25753201-25753223 TTTTGAAAGGGGAGAATAAAGGG + Intergenic
1094080983 12:26535431-26535453 CTTTTTCATGGGAAGATAATTGG - Intronic
1095970740 12:47900534-47900556 ATTTGTAAAGGGAACATAACTGG + Intronic
1096414121 12:51398710-51398732 TTTTTTTAGGGGAAGATAACAGG - Intronic
1099043719 12:77688864-77688886 ATTTATAAGGGGTAAATAAAAGG + Intergenic
1099093461 12:78341931-78341953 ATTTTTAAGGAGAAGAGAAAAGG - Intergenic
1101509320 12:105378907-105378929 ATTTGTAAAAGGAATATAAATGG + Intronic
1102620442 12:114190467-114190489 CTCTGTAAGGGGGAGAGCAATGG - Intergenic
1102784738 12:115595227-115595249 CTTAATAAGAGGAAGAGAAATGG + Intergenic
1105382921 13:19904064-19904086 CTTTTTAATGGGAAGGCAAAGGG - Intergenic
1108034706 13:46277611-46277633 TTTGGTAAGAGAAAGATAAAAGG + Intergenic
1108475043 13:50807629-50807651 TATTGTAAGGGGAAGAAAGAGGG + Intronic
1108822813 13:54374694-54374716 GTTAGTAAGAGGAAGAAAAAGGG + Intergenic
1110261863 13:73493734-73493756 CTTTATAATGGGAAAATGAAGGG + Intergenic
1110646096 13:77886248-77886270 CTATATAATGGGAAGAAAAAAGG + Intergenic
1110654370 13:77979514-77979536 ATTTATAAGGGGAAGAAATATGG + Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1111826037 13:93268964-93268986 CTTTAAAAGGGGAAGAAAAGAGG - Intronic
1111945890 13:94665502-94665524 CTTTGGACGGGAAAGTTAAATGG - Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114585262 14:23806329-23806351 TTTGGGAAGGGGAAGAAAAATGG - Intergenic
1114843394 14:26292008-26292030 ATTTGAAAGGGGGAGCTAAATGG - Intergenic
1115865977 14:37746860-37746882 CTCAGTAAAGGGAAGATAAGTGG + Intronic
1116175630 14:41466541-41466563 CTTTGAAATGGGAAGATAGTAGG - Intergenic
1116232097 14:42230069-42230091 CCTTTTAAGGGGAAGAAGAATGG + Intergenic
1117274530 14:54179338-54179360 CTTTGAAAGGGGCAGAAATATGG - Intergenic
1117693384 14:58333398-58333420 TTTTCTAAGGGTAAAATAAATGG + Intronic
1120204047 14:81568367-81568389 TATTGTAAGAGGGAGATAAATGG - Intergenic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1121740022 14:96245133-96245155 ATTTGTAAGTGGGAGCTAAATGG - Intronic
1122173139 14:99893384-99893406 CATTGTAAGGGGAGGATCCATGG + Intronic
1124498220 15:30201177-30201199 TTTTGTGAGGGGAAGATGAAAGG - Intergenic
1124745363 15:32337497-32337519 TTTTGTGAGGGGAAGATGAAAGG + Intergenic
1124889961 15:33723751-33723773 CTCTGTGAGGGGAAGATACATGG - Intronic
1125031580 15:35081032-35081054 CTTTGTGAGGGAAAGACACAGGG - Intergenic
1126074971 15:44900384-44900406 CCTTGTAAGAGGGAGATAGAGGG + Intergenic
1126174147 15:45719963-45719985 CTTGGTAAGAGAAAGGTAAAGGG + Intergenic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1126662760 15:51048580-51048602 CTTGGTAAGGGAAAGCTAAAGGG + Intergenic
1126789898 15:52211561-52211583 CACTGTTAGGGAAAGATAAATGG - Intronic
1127505814 15:59596745-59596767 CTTTGTAGGGGAAAGACATATGG + Intronic
1128811165 15:70573769-70573791 CTTGGTAAGGGGGAGAGAAAAGG + Intergenic
1130536454 15:84788739-84788761 CTTGGGAGGAGGAAGATAAATGG - Intronic
1130542191 15:84828326-84828348 CCTTGGAAGGGGAAGATAATGGG + Intronic
1131137306 15:89947567-89947589 ACTGGAAAGGGGAAGATAAAGGG - Intergenic
1131736225 15:95335267-95335289 CTCTGTAAGGGCAGGCTAAAGGG - Intergenic
1133895088 16:9919510-9919532 CATGGTAAGGAGAAGAGAAATGG + Intronic
1137705643 16:50533983-50534005 CTTTGGAAGGGAAAGATGATCGG + Intergenic
1137817383 16:51411407-51411429 CTTTGTAGGTGGAAGAGAACTGG + Intergenic
1141198373 16:81878534-81878556 CTTTAAAGGGGGCAGATAAATGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1144251899 17:13425745-13425767 CTTCGCAAGGGAAGGATAAATGG - Intergenic
1147193679 17:38751091-38751113 CCTTGTTTGGGGGAGATAAAAGG - Exonic
1147228729 17:39001816-39001838 GTTTGGAAGGAGAAGAGAAAAGG - Intergenic
1147638770 17:41980983-41981005 CTTGGTCTAGGGAAGATAAAGGG - Intronic
1147983937 17:44293501-44293523 TTTTGTGAGGGGAGGACAAATGG - Intergenic
1148286054 17:46392903-46392925 TTTTGAAAGGGGAAGAAAAAGGG - Intergenic
1148308221 17:46610493-46610515 TTTTGAAAGGGGAAGAAAAAGGG - Intronic
1149102638 17:52924526-52924548 TTTTTTAAAGGGAAGATAAATGG - Intergenic
1149610233 17:57954437-57954459 TTTTTTAAGGGGAAAAGAAATGG + Intronic
1153004936 18:489804-489826 GGTTGTTAGGGGAAGGTAAAAGG + Intronic
1153518032 18:5923041-5923063 TTCTTTAAGAGGAAGATAAAGGG + Intergenic
1153796884 18:8631683-8631705 TTTTGTAAGGGGAAGAAATATGG + Intronic
1155052339 18:22159543-22159565 CTTTTTAAGGGGAAGAGAGGAGG - Intergenic
1155410776 18:25542385-25542407 CTGTGTGCTGGGAAGATAAAGGG + Intergenic
1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG + Intergenic
1156219412 18:35036614-35036636 CAGTGTAGAGGGAAGATAAAGGG - Intronic
1156702111 18:39838503-39838525 CTCTGCAAGGGCAAAATAAAAGG + Intergenic
1157093335 18:44662019-44662041 CTTAGGAAGGGGAAAATAATTGG - Intergenic
1158463154 18:57664898-57664920 CTTTGGAAGGAGAAGAACAATGG - Intronic
1159775999 18:72603379-72603401 CTTTGTTAGGAGAAAAAAAAGGG - Intronic
1160303143 18:77704712-77704734 CTTGGTAAGAGGAAGAAATAGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161394903 19:4039853-4039875 TTTTGTAAGGTGAAAAAAAAGGG + Intergenic
1163816312 19:19466642-19466664 GTTTAAAATGGGAAGATAAATGG + Intronic
1164831281 19:31323004-31323026 CATTATAAAGGGAAAATAAAAGG - Intronic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1167343919 19:48933519-48933541 CTCTGTAAGGCGGAGCTAAACGG + Intergenic
1168676384 19:58280919-58280941 CTTTATAAGAGGTAGACAAAGGG - Intronic
925529610 2:4844777-4844799 ATTTATAAAGGGAAAATAAAAGG - Intergenic
926011587 2:9412745-9412767 CTCTCTAAGGGGAAAAAAAATGG - Intronic
926163846 2:10505778-10505800 CTTTTTAAAAGGAAGAAAAATGG + Intergenic
928285045 2:29982795-29982817 CCTTGTAAGTGGAAGAGAGAAGG + Intergenic
928682589 2:33717554-33717576 CTTGGTAAAGGGAAGAACAAGGG + Intergenic
929002284 2:37359339-37359361 ATTAGTAAGGGGAAGTTTAAGGG + Intronic
930359137 2:50357031-50357053 CTTTGGAAGGCGAAGACAGAAGG + Intronic
930978398 2:57492489-57492511 CTTTGTGAGCTGAAGATAAATGG + Intergenic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
933266624 2:80187860-80187882 GGTTGTAAGGTGAGGATAAAAGG - Intronic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937278312 2:120700577-120700599 CTTTGGAAGGCCAAGATAGATGG + Intergenic
937473983 2:122197999-122198021 CTTTGAAAAGGAAAGATCAAAGG + Intergenic
938090672 2:128432045-128432067 TTTAGTGTGGGGAAGATAAAAGG - Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
940354328 2:152721808-152721830 CTTTGCAATTTGAAGATAAAGGG - Intronic
941174353 2:162178653-162178675 AAATGAAAGGGGAAGATAAAAGG + Intronic
941785724 2:169496273-169496295 CTTGGTTAGTGGAAGATAGATGG - Intronic
942345853 2:175002220-175002242 ATTTGAAAGGAGAAGAAAAACGG + Intronic
942563216 2:177242510-177242532 CTTTCTAGTGGAAAGATAAAAGG - Intronic
943063505 2:183062648-183062670 CTTTGGGAGGCCAAGATAAAAGG + Intergenic
944572597 2:201059609-201059631 CTTTGGAAGGGGAGTATTAATGG - Intronic
945364605 2:208936257-208936279 TTTTGTAAGGGAAATAGAAAAGG - Intergenic
945398022 2:209345761-209345783 TTTTGTTAGGGGAAGATACCAGG - Intergenic
945400568 2:209377494-209377516 AATGGTAAGAGGAAGATAAATGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945842545 2:214905233-214905255 ATTTGGAGGGGGAAGAGAAAAGG + Intergenic
945871840 2:215235610-215235632 CTCTGTAAGGAGAGGATACAAGG + Intergenic
946446356 2:219742857-219742879 ATCTGTAAGGGGAAGAAATATGG - Intergenic
946817168 2:223591075-223591097 TTCTGTAAGGGGAAGAGACATGG + Intergenic
948001419 2:234570906-234570928 CTTTGAGAGGAGAAGATAAGGGG + Intergenic
1170760702 20:19248240-19248262 CTTTGAAAGTAGAAGAGAAATGG - Intronic
1171505446 20:25629430-25629452 CTCTGTACTGGGAAGTTAAAAGG + Intergenic
1173749318 20:45464327-45464349 GTTGGGAAGGGGAAGAGAAAGGG + Intergenic
1174301057 20:49582703-49582725 CTTCGTAAGAGGAAGACCAAGGG - Intergenic
1175055100 20:56190863-56190885 CTTTGTAAGGGTCAGAGAAGCGG - Intergenic
1175407747 20:58745775-58745797 CATTGCAAGGGGAAGAAAAAGGG - Intergenic
1177369031 21:20177977-20177999 GCTTCTAAGGGGAAGACAAAAGG + Intergenic
1177431265 21:20995333-20995355 CTGTGTATGGAAAAGATAAATGG - Intergenic
1178277574 21:31252885-31252907 CTTTGAAAGGGCAAGGTAATTGG - Intronic
1178981674 21:37269734-37269756 CTTCCTATGCGGAAGATAAATGG - Intergenic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1184179819 22:42813156-42813178 CTCTGCTAGGGGAAGACAAAGGG + Intronic
1184570301 22:45319394-45319416 ATTTGGAAGGGGACGATAAGAGG - Intronic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
950481726 3:13248261-13248283 CTGTCTATGAGGAAGATAAAGGG - Intergenic
950851350 3:16064757-16064779 ATGTGCAAGGGGAAGATTAATGG + Intergenic
951251582 3:20400242-20400264 CTTTGTTAGGAGATAATAAAGGG - Intergenic
951398172 3:22197116-22197138 CTTTAAAAGGGAAAGACAAAAGG - Intronic
952653894 3:35760496-35760518 CTTTATTTGGGGAAGATAACAGG + Intronic
955417092 3:58702620-58702642 GTGTGTATGGGGTAGATAAATGG - Intergenic
956214619 3:66835680-66835702 CTGTGTAAAGGGAAGAAAATGGG + Intergenic
956244467 3:67166545-67166567 ATTTTTAAGGGGTTGATAAATGG - Intergenic
957330542 3:78757895-78757917 CTCTGATAGGGGAAGATACAAGG - Intronic
957660207 3:83140431-83140453 CTGTGTTAATGGAAGATAAAGGG + Intergenic
958660000 3:97054468-97054490 CTTTTAAAGAGGAAAATAAATGG - Intronic
959372411 3:105544290-105544312 CTTTGATAGGGGAAGATGTAAGG - Intronic
960528947 3:118741943-118741965 ATTTGTGAGGGGAACAAAAAAGG - Intergenic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961585836 3:127922931-127922953 ATTTCTAAGGGAAAGAAAAAAGG - Exonic
961671560 3:128535735-128535757 GATTGTAAGAGGAAGATGAATGG + Intergenic
962037456 3:131667815-131667837 CTTTTTATGAGGAGGATAAAAGG - Intronic
963282868 3:143403916-143403938 TTTTGGAAGGAGAAGAGAAAGGG - Intronic
963402833 3:144823052-144823074 CTTTGTAGAGGCAAGATAACTGG + Intergenic
963673037 3:148276609-148276631 CTTAATAAGGGAAAAATAAATGG - Intergenic
963819965 3:149879549-149879571 CTTTGGAAGGCCAAGGTAAAAGG - Intronic
963826997 3:149966557-149966579 CTTTGTAATGGGAAAAGAAGGGG - Exonic
964246340 3:154658364-154658386 CTGTATAAAGGGAAAATAAAAGG - Intergenic
965253032 3:166367809-166367831 CTTTGCAATGGGATGATTAATGG - Intergenic
965326274 3:167308725-167308747 ATTTATAAGAGGAAGCTAAATGG + Intronic
965509070 3:169548371-169548393 CTTTGCAAGTGGGAGATTAAGGG - Intronic
966108460 3:176365135-176365157 CATTGTATTGGAAAGATAAAAGG - Intergenic
966188161 3:177246826-177246848 ATTTGTAAGGTAAGGATAAAAGG - Intergenic
966707838 3:182936075-182936097 CCTTGTAAGGGTAAAATAGAGGG - Intergenic
967292021 3:187930658-187930680 CATGGTAGGGGGCAGATAAAGGG - Intergenic
967726793 3:192869659-192869681 CTTTTTATGGGGAGGAGAAAGGG - Intronic
969191810 4:5527270-5527292 CCTTCTAAGGGGAAGACAAAGGG - Intronic
971188912 4:24408138-24408160 GTTTACAAGAGGAAGATAAAAGG + Intergenic
972046990 4:34678547-34678569 ATTTATAAGGGTAAGAGAAAGGG - Intergenic
972103926 4:35459122-35459144 CTGTGTAAAATGAAGATAAAAGG - Intergenic
972352862 4:38253023-38253045 CTTTGTGATGGGAATATAATGGG - Intergenic
972525681 4:39908403-39908425 CTTTGTAAGGGAAAGAACACTGG - Exonic
973187969 4:47353369-47353391 ATTTGTAAGGGAAACATCAAGGG - Intronic
973533487 4:51856813-51856835 CTGTGTAAGGTGAAGATCATTGG + Intronic
973716114 4:53678150-53678172 CGTTGTAAGGGCATGTTAAAGGG + Intronic
973945615 4:55951630-55951652 ATTTGTATAGGGAATATAAAAGG - Intronic
977020419 4:91752231-91752253 CTTTTAAAGGGGATTATAAATGG + Intergenic
977302957 4:95288787-95288809 CCTTGTAAGAGAAAGACAAAGGG - Intronic
978317989 4:107461373-107461395 ACTTGTAAGTGGAAGCTAAATGG + Intergenic
978784603 4:112595472-112595494 CTTTGGAAGGCGAAGGCAAAAGG + Intronic
979192135 4:117874687-117874709 CTTTGTAAGTGGGAAGTAAAGGG - Intergenic
980106469 4:128593167-128593189 CTTAGGAAGAGGAAGATAATTGG - Intergenic
980424325 4:132607116-132607138 CTCTATAAGAGGAAGACAAAGGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981277536 4:142919258-142919280 ATTTCGAAGGGTAAGATAAAAGG - Intergenic
983555063 4:169052589-169052611 CTTTGGAAGGGAAGGAGAAAGGG + Intergenic
985206423 4:187542430-187542452 CTTTGGAAGGCCAAGATAGAAGG + Intergenic
986031920 5:3902614-3902636 CTTTTTCAGGGAAAAATAAACGG - Intergenic
988169880 5:27639697-27639719 CTTTGTGAGGGGATGATCAGTGG + Intergenic
988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG + Intergenic
991131367 5:63126013-63126035 CTTTGTAAGAGATAGATCAATGG + Intergenic
992228975 5:74644618-74644640 TTTTGTCTGGGGAAGACAAAGGG + Intronic
992362223 5:76050874-76050896 CTTTCTAAGGGAAAGCTACAGGG + Intergenic
993686951 5:90949374-90949396 ATTTTTAAGGTGATGATAAAGGG + Intronic
994077581 5:95670612-95670634 CTTTGTGTGGGGAAGTAAAAGGG - Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994231826 5:97316333-97316355 TTCTGTAAGGGGAAGGCAAATGG - Intergenic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
995313151 5:110736684-110736706 CTCTGTATGGGGAAGAGTAAAGG - Intronic
996142608 5:119930443-119930465 CTTTGTATTCTGAAGATAAATGG - Intergenic
998497150 5:142600962-142600984 CTTTGGAAGGCAAAGAAAAAGGG - Intronic
998648112 5:144086629-144086651 CTTTTTAAGGGAAAGAATAATGG + Intergenic
998770600 5:145540282-145540304 CATAATAAGGGGAAGATAAGAGG + Intronic
999830728 5:155316642-155316664 CTATGTCAGGGGAACATTAAGGG - Intergenic
999985407 5:156999743-156999765 CTTGCTAATGGGAATATAAATGG + Intergenic
1001553477 5:172620739-172620761 CTTTGTAAGTGCCAGATAGACGG + Intergenic
1004384579 6:15161677-15161699 CTTTCTTTGGGGAATATAAAAGG - Intergenic
1004753372 6:18586098-18586120 CTTTGAAAGAGGAAGATCCAAGG - Intergenic
1006017679 6:31095182-31095204 CTTTGTTAGGTGAAAATAACAGG + Intergenic
1006416217 6:33905630-33905652 ATTTGTAAGGATAAGAGAAATGG - Intergenic
1007038681 6:38701781-38701803 CTTTAAAAGGGGTAGATAAGTGG - Intronic
1007972502 6:46067022-46067044 CTTTGTAATGGGACGCTCAAAGG + Intronic
1008008679 6:46439911-46439933 CTTTGCAAGGGGCACATGAAAGG - Intronic
1008156055 6:48015677-48015699 ATTTGTAGGAAGAAGATAAAAGG - Intronic
1009299351 6:61995060-61995082 CTTTGTAAGGCCACAATAAAGGG + Intronic
1009411639 6:63371901-63371923 CTCTGCAAAGGGAAGATTAAGGG - Intergenic
1009960256 6:70511473-70511495 CATGGTAAGGGGGAGAGAAAAGG + Intronic
1010621878 6:78086224-78086246 TTTTGTCAGAGGAAGGTAAAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1016091105 6:139980315-139980337 CTTTGTAAGGTCACGATAAAGGG + Intergenic
1016403607 6:143706686-143706708 CCTTTTAAGGGTAAGATAAATGG - Intronic
1018646741 6:165955545-165955567 CTTTGTAAGAAGAAGATTACGGG - Intronic
1018648810 6:165973477-165973499 TTTTGTGAGTGAAAGATAAAAGG + Intronic
1020836850 7:13164380-13164402 ATTTGTAGGGGGAGGAAAAAAGG - Intergenic
1021016770 7:15545304-15545326 CTTTATAAAGGGAATTTAAAAGG + Intronic
1021407214 7:20285514-20285536 CTTTATTTGGGGAACATAAATGG - Intergenic
1021994557 7:26167066-26167088 CTTTGCAAGGAGAAAAGAAAAGG + Intronic
1022228726 7:28392049-28392071 ACTTGTAAGTGGAAGCTAAATGG + Intronic
1023308869 7:38861594-38861616 CGTTGTATGGGAAAGAAAAAGGG - Intronic
1023477706 7:40599007-40599029 AATTGTAAGGGGAACCTAAATGG + Intronic
1024551530 7:50566400-50566422 CTTGGTAAGGGGAAGAGTGAGGG + Intergenic
1026503605 7:70963643-70963665 GTTGGGAAGAGGAAGATAAAAGG - Intergenic
1026585178 7:71650143-71650165 CTTGGTAAAGGCAAAATAAAAGG - Intronic
1031623923 7:123970341-123970363 CCTTATAAGGGGAAGAAACAAGG - Intronic
1031745798 7:125495952-125495974 CTTGTTGAGGGAAAGATAAAAGG - Intergenic
1032115931 7:129117051-129117073 CTCTGTAAGGGGAATAGGAATGG + Intergenic
1032563016 7:132912256-132912278 CTGTCTAAGTGGAAGATAATAGG + Intronic
1035438062 7:158874144-158874166 CTTTGGGAGGTCAAGATAAATGG - Intronic
1036436639 8:8740709-8740731 TTGTGTATGGGGAAGATAAGGGG - Intergenic
1037995907 8:23352292-23352314 CTCTGTAGGAGGAAGAGAAATGG - Intronic
1038296550 8:26296750-26296772 TTTTGAAAGGGGAAGAGAAATGG + Intronic
1039141328 8:34391915-34391937 TTTTGAAAGGGGAATATACAGGG + Intergenic
1039479524 8:37861923-37861945 CCTTGTAAGGGGCAGAGACAGGG - Exonic
1040013676 8:42682967-42682989 CTTTGCCAGGGGAAGAGAGAAGG + Intergenic
1040352950 8:46586897-46586919 GTTTGTAAGGGGAAAAAGAAAGG - Intergenic
1040847294 8:51857090-51857112 CTTTGTCATGGGACGTTAAATGG - Intronic
1041135530 8:54754059-54754081 CATGTGAAGGGGAAGATAAAGGG + Intergenic
1041689717 8:60677830-60677852 TTTTGTACCGGGAAGAGAAATGG + Intergenic
1041740093 8:61148984-61149006 CTTTTTATGGGGACCATAAATGG - Intronic
1043252698 8:78095597-78095619 CTTTGTAGGTGAAATATAAATGG - Intergenic
1044362775 8:91307940-91307962 CTTTGGAAGGCCAAGATGAAAGG - Intronic
1044527729 8:93270680-93270702 CTTTTTAATGTGAAGGTAAAAGG + Intergenic
1045315484 8:101040358-101040380 CCTTGTAAGGGAAAGACAGAGGG - Intergenic
1045946598 8:107803612-107803634 TTATTTAAAGGGAAGATAAAGGG - Intergenic
1046023026 8:108689060-108689082 CTTTGTAATGAAAAGATAAGTGG - Intronic
1046833027 8:118767824-118767846 GTTTGTTTGGGGAATATAAAAGG - Intergenic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048662054 8:136615711-136615733 TTTTGTATGGAGAAGATTAATGG - Intergenic
1050322252 9:4465104-4465126 TTTTGTAAGAGGAAGAGAGAGGG - Intergenic
1051830266 9:21268096-21268118 CTTTGCAAAGGGGAAATAAAAGG - Intergenic
1053367274 9:37532078-37532100 ATTTGTAACAGGAAAATAAATGG - Intronic
1055133232 9:72799892-72799914 CTTTATAAGCAGGAGATAAAGGG + Intronic
1055331379 9:75187556-75187578 CTTTGTAAGGGACAGAAGAAGGG + Intergenic
1055694920 9:78873430-78873452 CTTTGCAGGGGGAAAATCAAAGG + Intergenic
1055700943 9:78945332-78945354 CGTTGGAAGTGGAAGAGAAATGG - Intergenic
1056583285 9:87910312-87910334 CTCAGTAACAGGAAGATAAAAGG + Intergenic
1057040010 9:91841137-91841159 CTTTGTAAAATGAGGATAAAAGG - Intronic
1059598805 9:115753357-115753379 CTTTGCAAGGTGAAGACAAAGGG - Intergenic
1059612078 9:115909289-115909311 CTGTATATGTGGAAGATAAAAGG + Intergenic
1059918135 9:119126775-119126797 TTTTGTAAAGGGAAGAAAATGGG + Intergenic
1060307978 9:122433623-122433645 CTTTCGAGGGGGAAGAGAAAAGG - Intergenic
1060690402 9:125653006-125653028 CTTTGTAAAGGGATGACACAGGG - Intronic
1062392476 9:136339467-136339489 CCTTTTAATGGGAAGAAAAAAGG + Intronic
1186024175 X:5290701-5290723 CTTTATAAGAGGGAGGTAAAAGG - Intergenic
1186237598 X:7530443-7530465 ATTTGTAAGTGGGAGCTAAATGG + Intergenic
1186778312 X:12888125-12888147 TTCTGTAAGGCCAAGATAAAGGG + Exonic
1186831798 X:13398126-13398148 TTTTGTAAGGGTATGATGAAGGG + Intergenic
1187478383 X:19632156-19632178 ATTTGTAAGGGGAAAAAAAGTGG - Intronic
1187693340 X:21893780-21893802 CTTTCTAAGAGGAGGAAAAATGG + Intergenic
1187891208 X:23936512-23936534 CTTAGTAATGGAAAGAGAAAAGG - Intronic
1188041410 X:25373890-25373912 TATTGTAAGTGGAAGAAAAAAGG - Intergenic
1188165106 X:26852851-26852873 GGTTGTAAAGGGAAGAGAAAAGG - Intergenic
1188294446 X:28430548-28430570 GTTTGTAAGTGGGAGCTAAATGG - Intergenic
1189193434 X:39131849-39131871 TTCTGTAAGAGGATGATAAATGG - Intergenic
1189979312 X:46493141-46493163 CTTTGTTAGGGTAAGTTTAATGG - Intronic
1192603328 X:72487552-72487574 CTTTGTAAGGGGTACATGTAAGG + Intronic
1194355924 X:92883856-92883878 CCTTATAAGTGGAAGCTAAATGG + Intergenic
1194801771 X:98282673-98282695 CTTTGAAATGGGAATATTAATGG - Intergenic
1196111607 X:111952559-111952581 CTTTGTAAGCGGAAAAAAGACGG - Intronic
1197764628 X:130051839-130051861 CTCTGTAAGGGGAGCATATAGGG - Exonic
1198436475 X:136621631-136621653 GTTTGAAAGGTGAAGATAACAGG + Intergenic
1198801716 X:140454280-140454302 CTTAGTGAGGGGCAGGTAAAAGG + Intergenic
1198924082 X:141768277-141768299 CTTATGAAGGGGAAAATAAAAGG + Intergenic
1198977491 X:142353172-142353194 CTATGTATGGGATAGATAAATGG - Intergenic
1200664270 Y:6000833-6000855 CCTTGTAAGTGGAAGCTAAATGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic
1202592473 Y:26500913-26500935 CTTTGATGGTGGAAGATAAAGGG - Intergenic