ID: 1111769038

View in Genome Browser
Species Human (GRCh38)
Location 13:92573148-92573170
Sequence ACTTGCTAGTGAAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111769038_1111769042 1 Left 1111769038 13:92573148-92573170 CCCTCAAACTTTCACTAGCAAGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1111769042 13:92573172-92573194 GTTTTAAAGATCGTGGCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 69
1111769038_1111769045 19 Left 1111769038 13:92573148-92573170 CCCTCAAACTTTCACTAGCAAGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1111769045 13:92573190-92573212 ACTGGTCTGATGGGAATTTATGG 0: 1
1: 1
2: 2
3: 27
4: 321
1111769038_1111769044 10 Left 1111769038 13:92573148-92573170 CCCTCAAACTTTCACTAGCAAGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1111769044 13:92573181-92573203 ATCGTGGCTACTGGTCTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1111769038_1111769043 9 Left 1111769038 13:92573148-92573170 CCCTCAAACTTTCACTAGCAAGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1111769043 13:92573180-92573202 GATCGTGGCTACTGGTCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 42
1111769038_1111769041 -6 Left 1111769038 13:92573148-92573170 CCCTCAAACTTTCACTAGCAAGT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1111769041 13:92573165-92573187 GCAAGTGGTTTTAAAGATCGTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111769038 Original CRISPR ACTTGCTAGTGAAAGTTTGA GGG (reversed) Intronic
901743700 1:11358799-11358821 ACTTGGCAATCAAAGTTTGATGG - Intergenic
901904966 1:12400522-12400544 CCTTGCAGGTGACAGTTTGATGG + Intronic
907073860 1:51561637-51561659 ACTCGCTAGTGAAAATTAAATGG + Intergenic
908876232 1:68680361-68680383 ATTTTTTAGTGAAAGTTTGTTGG + Intergenic
910566024 1:88643665-88643687 ACTTGCTAGTGGGAATATGAGGG - Intergenic
912257045 1:108070758-108070780 ACTTGCCAGAGTAACTTTGATGG - Intergenic
916511965 1:165480219-165480241 ACTTGCTCTTTAAAGCTTGAAGG + Intergenic
917955273 1:180090147-180090169 ACTTGCATGTAAAAGTTTGAAGG + Intronic
918502527 1:185213511-185213533 ACTTGCTTGTGAAATCCTGAAGG - Intronic
923892846 1:238235086-238235108 ACTTGAGAGGGACAGTTTGATGG - Intergenic
1063289617 10:4732072-4732094 ATTTACTAGTGAAAGTTATAGGG - Intergenic
1064260207 10:13779409-13779431 ACTTTCAAGTGAAGATTTGATGG - Intronic
1066584682 10:36919425-36919447 ACTTGCTATTGCTGGTTTGAAGG + Intergenic
1067554746 10:47260874-47260896 AGTCTCTAGTGAAGGTTTGAAGG + Intergenic
1068584557 10:58782638-58782660 AGTTGAGAGTGAAATTTTGAAGG + Intronic
1069269957 10:66514034-66514056 ACTTGTTAGTGCATTTTTGATGG + Intronic
1073475970 10:103753903-103753925 ACTTGCTGGTGAAAGACAGAGGG - Intronic
1075862895 10:125692804-125692826 ATTTGGTGGTGAAAGGTTGAAGG - Intergenic
1076604378 10:131679885-131679907 GGTTGCAAGTGAAAGGTTGAGGG + Intergenic
1077241335 11:1512038-1512060 ACTTGTTAAAGACAGTTTGAGGG - Intergenic
1079678817 11:23266018-23266040 ACTTGAAAGTCAAAGTTTAATGG + Intergenic
1079869388 11:25778103-25778125 TCTTGCTATTGAAAGTTTTTAGG - Intergenic
1081393943 11:42562794-42562816 AGGTGCTAGTGAAGGTTTGTAGG - Intergenic
1083028048 11:59567176-59567198 ACTTGCTTCTTAGAGTTTGAGGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1085901687 11:80707852-80707874 ACTTGATAGTGGAGGTTAGAGGG + Intergenic
1085903379 11:80729486-80729508 ACTTGCTATTGTGGGTTTGAAGG - Intergenic
1085988885 11:81816002-81816024 ACTTGACAGTGAAAGGTGGAAGG - Intergenic
1086316879 11:85604363-85604385 TCTGGTTAATGAAAGTTTGAAGG + Intronic
1087763173 11:102123590-102123612 ATTTTCTCGTGAAATTTTGATGG + Intronic
1089926086 11:122259286-122259308 ACTGGCTAGTGAATGAGTGATGG - Intergenic
1093223784 12:16455862-16455884 ACTTACTATTGAAAATTTTATGG - Intronic
1095740340 12:45599917-45599939 ACTTGCAAGTGGAATTGTGAGGG - Intergenic
1100274181 12:93056605-93056627 ACTTGTCAGAGAAATTTTGAAGG - Intergenic
1105503976 13:20994300-20994322 ACTTGCTAAAGAAGGGTTGATGG - Intronic
1106434771 13:29713646-29713668 ACTTGCTCCTGAAAGTCTGTGGG + Intergenic
1110622708 13:77616635-77616657 ACATTCTATTGAAAGGTTGAAGG + Intronic
1110784870 13:79511868-79511890 ACTTGCAAGTGAATGTTTCCTGG + Intronic
1111769038 13:92573148-92573170 ACTTGCTAGTGAAAGTTTGAGGG - Intronic
1122556011 14:102580495-102580517 ACATGCGAGTGAGAATTTGAAGG + Intergenic
1128733496 15:70036060-70036082 ACTTGGAATTGAAAGTTTCATGG - Intergenic
1129094218 15:73185477-73185499 ACATCCTTGTGAGAGTTTGATGG - Intronic
1129896585 15:79112807-79112829 ATTTTCTCGTGAAAATTTGAAGG + Intergenic
1132181523 15:99756450-99756472 ACCTGCTAGTGAAGGTTTGAGGG + Intergenic
1134220688 16:12351435-12351457 AGTTGCTATTGAAATTTTGGGGG + Intronic
1136747067 16:32600072-32600094 ATTTGATAGTGAAAATTTAAGGG - Intergenic
1138919009 16:61503922-61503944 AATAGCTAGTGAATCTTTGAGGG + Intergenic
1140195342 16:72850363-72850385 ACTTGGTAGTGACAGTGGGATGG - Intronic
1141327018 16:83070281-83070303 ACTTGATACTGACAGTTTAAGGG + Intronic
1203049197 16_KI270728v1_random:859279-859301 ATTTGATAGTGAAAATTTAAGGG - Intergenic
1143991911 17:10972450-10972472 TCTTGCTAGTGAAAGGTGTAAGG + Intergenic
1146747460 17:35345197-35345219 ACCTGCTAGTGCAAAATTGAAGG - Intergenic
1146763045 17:35495267-35495289 ACTTGCTAGTCCAAAATTGAAGG - Intronic
1150651414 17:67012647-67012669 ACGTGCAACTGGAAGTTTGAGGG - Intronic
1152984585 18:310289-310311 ACATCATAGTGAAAGGTTGAAGG + Intergenic
1153645320 18:7190838-7190860 AGTTACAAGTGACAGTTTGAAGG - Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1156437624 18:37150143-37150165 ATTTGCAAGTGAAGTTTTGATGG - Intronic
1158750445 18:60253501-60253523 ACTTGTTACTGACAGTTTGTGGG + Intergenic
928555372 2:32418090-32418112 AATTTCTAGTGAAAGTATAATGG + Intronic
929043252 2:37767406-37767428 ACTTGCTAATAAAAGTATGTTGG + Intergenic
930080511 2:47443425-47443447 AGATGCTAGTGAAAGCTTGGAGG + Intronic
930841256 2:55848462-55848484 ACCAGCTAATGAAAGGTTGAAGG + Intergenic
935295940 2:101649681-101649703 ACTTGGTAGTTAAAATGTGAAGG + Intergenic
936042907 2:109163316-109163338 AATTGCAAGTGCAAGTTTAAGGG + Intronic
936444173 2:112583377-112583399 ACTTCCAAGTGTATGTTTGATGG - Intergenic
936692092 2:114902069-114902091 ACTTGCCAGTGAAACTTTCCTGG - Intronic
939594038 2:144102983-144103005 AGGTGATAGTGAAAGTTTGGTGG - Intronic
944922253 2:204427815-204427837 ACTTGAGAGTGAAAGGTTGGAGG + Intergenic
947500094 2:230665253-230665275 AGATGCTAGTGAAAGTCTGAAGG - Intergenic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1172729796 20:37076851-37076873 CCTTGCAAGTGTAGGTTTGATGG - Intronic
1175019349 20:55827672-55827694 ACTTACTAGTGAAAATATGTGGG + Intergenic
1175922111 20:62455097-62455119 ATTTTCTAGTGAAAGATTTAAGG - Intergenic
1178036040 21:28583949-28583971 TCTTTCTATTGAAAATTTGAAGG - Intergenic
1180597265 22:16986304-16986326 ACGTGCATGTGAAAGTATGAAGG + Intronic
1182887879 22:33791210-33791232 ACTTCCTGGGGAAAGTTTAAAGG - Intronic
1183245543 22:36690572-36690594 AATTGCTTGTGAAATTTTGGTGG - Intronic
1203295415 22_KI270736v1_random:38904-38926 ACTTGCTAATAAAAGTATGTTGG + Intergenic
949256817 3:2058182-2058204 AATTGCAAGTGAAAGTTTTTAGG + Intergenic
953756106 3:45647311-45647333 TCTTGCCAGTTAAAGTTTAAAGG + Intronic
957156313 3:76549780-76549802 ACTAACCAGTGAAAGTTTTAAGG - Intronic
963342976 3:144059797-144059819 TAGTGCTAGAGAAAGTTTGAGGG + Intergenic
971062223 4:22985193-22985215 ATTTCCTAGCCAAAGTTTGAGGG + Intergenic
972067823 4:34973106-34973128 ATTTGCTAGTTCTAGTTTGAAGG + Intergenic
974874162 4:67682576-67682598 TGTTGATAGTGAAAGTTTTAAGG - Intronic
975415013 4:74095814-74095836 CCTTCCTAGTGGAATTTTGATGG - Intergenic
975771775 4:77732117-77732139 ACTTTCTAGTAAAAGTCAGATGG - Intronic
977165149 4:93685712-93685734 ACTTGGTAGAGAAAAGTTGATGG - Intronic
980839721 4:138243362-138243384 ACTTGGTTGAGAAAGTTAGAAGG - Intergenic
982369378 4:154617872-154617894 ACTTTCTATTGACATTTTGAAGG + Intergenic
986787363 5:11126818-11126840 ACTTGCTGCTGTAAGTGTGAAGG - Intronic
995034745 5:107520695-107520717 ACTTGCTAATTATAGTTTGAAGG - Intronic
996766657 5:127041106-127041128 ACTTGTAAGTGAAAGTATAATGG - Intergenic
998894960 5:146789322-146789344 ACATGTTACTGAAAGTTTTATGG - Intronic
1000064771 5:157685064-157685086 ACTAGCTAGAAAAAGCTTGAAGG + Intergenic
1000564539 5:162831402-162831424 ACTTGGAAGTGAATATTTGAAGG + Intergenic
1001987191 5:176084632-176084654 ATTTGATAGTGAAAATTTCAGGG - Intronic
1002229677 5:177753515-177753537 ATTTGATAGTGAAAATTTCAGGG + Intronic
1002265668 5:178030262-178030284 ATTTGATAGTGAAAATTTCAGGG - Intronic
1003858637 6:10301250-10301272 ATTTGCCTGTGAAAGTTAGAAGG - Intergenic
1005609091 6:27506302-27506324 ACCTGCTAGAGGAAATTTGAAGG + Intergenic
1009026469 6:58006501-58006523 ATTTGCTGGGGAAATTTTGAAGG + Intergenic
1009202019 6:60757974-60757996 ATTTGCTGGGGAAATTTTGAAGG + Intergenic
1009264941 6:61542084-61542106 ACTTGCAAGTGGAAGTTGGCTGG - Intergenic
1012054642 6:94390676-94390698 ACTGACTAGGGAAAGCTTGAAGG - Intergenic
1012955859 6:105569278-105569300 ATTTGCTGGTCAAACTTTGAGGG + Intergenic
1013347439 6:109275784-109275806 ACTTAATGGTGAAAGGTTGACGG - Intergenic
1017025727 6:150178928-150178950 GCTCTCTAGGGAAAGTTTGATGG + Intronic
1017338312 6:153288630-153288652 AGTTGCAAGTGTAAGTTAGATGG - Intergenic
1017358573 6:153539986-153540008 ACTTGGTGGTGAAAGTTGCATGG - Intergenic
1023634083 7:42192540-42192562 ACTTGTTAAAGAAAGTTTGAAGG - Intronic
1024489504 7:49962534-49962556 ACTTAATTGTGAAAGTCTGAGGG + Intronic
1026254390 7:68698020-68698042 ACTTGCTGGGGAAGGTTTGGGGG + Intergenic
1031873832 7:127115774-127115796 ACTTGCTAGTAAAACTTTTAGGG - Intronic
1032243914 7:130190692-130190714 ACTAGTAAGTCAAAGTTTGATGG + Intronic
1032282950 7:130519955-130519977 GCTTGCTAGGGAAGGTTAGAAGG + Intronic
1032514699 7:132498308-132498330 ACTTGGAAGAAAAAGTTTGATGG + Intronic
1034194169 7:149233253-149233275 ACTGACTAGTGAAAGAATGATGG - Intergenic
1035360296 7:158308319-158308341 ACTTGCTAGGGAAGGGTTGTTGG - Intronic
1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG + Intergenic
1041111307 8:54485288-54485310 ACTTGGCAGTGAATGTTTGAGGG + Intergenic
1042009940 8:64231891-64231913 ATTACCTAGTGAAGGTTTGAAGG - Intergenic
1043774671 8:84250857-84250879 ACTTTCTAGCCAAAGGTTGAGGG - Intronic
1044546052 8:93460674-93460696 ACTAACTATTCAAAGTTTGAAGG - Intergenic
1048121163 8:131583178-131583200 TCTTGCCAGTGAAAGGCTGAGGG + Intergenic
1048566738 8:135607963-135607985 AGTTGAGAGTCAAAGTTTGAAGG - Intronic
1050567859 9:6905351-6905373 ACTTGGTAGAGTCAGTTTGAGGG - Intronic
1053259988 9:36654149-36654171 ACTTGCACCTGAAAGTTTAAAGG - Intronic
1054887429 9:70213719-70213741 GCTTGCCAGTGAAAGAATGAAGG + Intronic
1055480499 9:76704814-76704836 ACTTCCCAGTCAACGTTTGATGG + Exonic
1058489420 9:105480678-105480700 AGATGATTGTGAAAGTTTGAAGG + Intronic
1059379125 9:113909595-113909617 ACTTGCTAGCCCAAGCTTGAAGG + Intronic
1062090424 9:134675247-134675269 ACTTAGTACTGAAAGTCTGAGGG - Intronic
1187073216 X:15909242-15909264 ACTGGCTAATGAAAATTTCATGG + Intergenic
1188736113 X:33718340-33718362 ACTGGTTAGTGAAAATATGAAGG - Intergenic
1189459409 X:41226258-41226280 AAATTCTAGTGAAAGTTTGAGGG - Intronic
1198419396 X:136454510-136454532 ACTTTATAGTGTAGGTTTGAGGG - Intergenic
1199780230 X:151051769-151051791 AATTGCTAGAGAATGGTTGAAGG - Intergenic