ID: 1111773484

View in Genome Browser
Species Human (GRCh38)
Location 13:92628606-92628628
Sequence CAGTTTAGTCACAGTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111773484_1111773488 -3 Left 1111773484 13:92628606-92628628 CCAGCATCACTGTGACTAAACTG 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1111773488 13:92628626-92628648 CTGGTACGATTTAAAATGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1111773484_1111773487 -4 Left 1111773484 13:92628606-92628628 CCAGCATCACTGTGACTAAACTG 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1111773487 13:92628625-92628647 ACTGGTACGATTTAAAATGGTGG 0: 1
1: 0
2: 0
3: 5
4: 93
1111773484_1111773489 2 Left 1111773484 13:92628606-92628628 CCAGCATCACTGTGACTAAACTG 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1111773489 13:92628631-92628653 ACGATTTAAAATGGTGGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 134
1111773484_1111773486 -7 Left 1111773484 13:92628606-92628628 CCAGCATCACTGTGACTAAACTG 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1111773486 13:92628622-92628644 TAAACTGGTACGATTTAAAATGG 0: 1
1: 0
2: 0
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111773484 Original CRISPR CAGTTTAGTCACAGTGATGC TGG (reversed) Intronic
904412639 1:30334061-30334083 TAGTTTATTTATAGTGATGCCGG - Intergenic
908280589 1:62530797-62530819 CAGTTACGGCACAGGGATGCAGG - Intronic
909021325 1:70434485-70434507 CAGATTAGTCAAAGTGTTCCTGG + Intronic
909134516 1:71781188-71781210 CAGATTAGTCACCGTGATGCTGG - Intronic
909226404 1:73029879-73029901 CTGTATAGACAGAGTGATGCAGG + Intergenic
909794090 1:79711769-79711791 CAGTTTATTTCCAGTGATTCTGG + Intergenic
912034899 1:105300826-105300848 CAGTGTAGTCACAGTGGTGGTGG - Intergenic
912235549 1:107846361-107846383 CAGTTTCTTCACAGTGTTGATGG - Intronic
912644005 1:111373331-111373353 CAGTATAGTCCCAGTGGTGGTGG + Intergenic
913474177 1:119220947-119220969 CAGTTTTGCCACACTGATGATGG - Intergenic
913585206 1:120268034-120268056 CAGTTGAGCTGCAGTGATGCTGG - Intergenic
913622979 1:120630328-120630350 CAGTTGAGCTGCAGTGATGCTGG + Intergenic
914567208 1:148879895-148879917 CAGTTGAGCTGCAGTGATGCTGG - Intronic
914605615 1:149250347-149250369 CAGTTGAGCTGCAGTGATGCTGG + Intergenic
915810273 1:158901790-158901812 CAGTTTAGTCATAGTTAAGAGGG + Intergenic
915932248 1:160068029-160068051 GAGCTTATGCACAGTGATGCAGG + Intronic
916813664 1:168329072-168329094 CTGTTTAGTTCCAGTGATGATGG + Intergenic
917476160 1:175371046-175371068 CAGGTTAGACACAGTTCTGCTGG + Intronic
917508822 1:175652752-175652774 CAGTTGACTCACAGTTCTGCAGG - Intronic
918018640 1:180663559-180663581 CAGTGTGGTCCCAGTGATGGTGG - Intronic
918989842 1:191684579-191684601 CAGTGTATTCCCAGTGATGGTGG - Intergenic
1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG + Intronic
1063533824 10:6863241-6863263 CCATTTAGTCCCAGTGATGCAGG + Intergenic
1063758028 10:9038472-9038494 CAGTTTTTTCACAGTTATCCAGG + Intergenic
1066352668 10:34651179-34651201 AATTTTTGTCAAAGTGATGCTGG - Intronic
1067130793 10:43563722-43563744 CAGAGCAGTCACAGTGATACTGG + Intronic
1068478672 10:57562230-57562252 CAGTGTAGTCATAGTGGTGGTGG - Intergenic
1068864223 10:61878092-61878114 CAGTTGTTTCACAGTAATGCAGG + Intergenic
1069876587 10:71566864-71566886 CGGTATCGTCACAGTGATCCGGG + Intronic
1070899878 10:80019307-80019329 CAGATTATTCACTGTAATGCGGG + Intergenic
1070901681 10:80035502-80035524 CAGATTATTCACTGTAATGCGGG + Intergenic
1071018169 10:81021958-81021980 CAGTGTAGTCATAGTGATGGTGG + Intergenic
1071899335 10:90101929-90101951 CAGTATAGTCTCAGTGATGGTGG + Intergenic
1071975651 10:90953377-90953399 CGGTTTATTCACAGTGTTGATGG + Intergenic
1072382521 10:94890061-94890083 CAGTTTGCTCACAGTTATGCAGG - Intergenic
1072396733 10:95050496-95050518 CAGTGCAGTCACAGTGGTGGTGG + Intronic
1075958362 10:126545074-126545096 CAGCTTAGCCAAAGTCATGCAGG + Intronic
1076510170 10:131007826-131007848 ACGTTTAGTCACATTGAAGCGGG - Intergenic
1077912116 11:6580974-6580996 CAGCATAATCACAGTGATGGTGG + Intronic
1079109634 11:17597526-17597548 CAGTTTATTCAGAGTAATGGTGG + Intronic
1079530453 11:21446689-21446711 CAGTGAAGTCCCAGTGGTGCTGG - Intronic
1080084109 11:28258296-28258318 CAGCATAGTCACAGTGGTGGTGG - Intronic
1083116525 11:60464984-60465006 CAGTTTAGTAACAGTGTTGGGGG - Intronic
1085981545 11:81732546-81732568 CAGTGTAGTCATAGTGGTGGTGG - Intergenic
1089687728 11:120167660-120167682 AAGTTTAGTCACAGCGACGAGGG + Intronic
1090111304 11:123911764-123911786 CAGTTCAGTCCCAGTGGTGGTGG + Intergenic
1090357489 11:126149854-126149876 CTGTTTAGTCCCTGTGATGAGGG - Intergenic
1090689079 11:129158138-129158160 CAGTTTATTCATAGTGTTGATGG - Intronic
1093663585 12:21785919-21785941 CATTATAGTCTCTGTGATGCTGG - Intergenic
1099837840 12:87929937-87929959 CAGTTTAGTAAATATGATGCAGG - Intergenic
1101487786 12:105183335-105183357 CAGTTTCTTCACAGTGCTGATGG + Intronic
1104534157 12:129602825-129602847 CAATTGATTCACAGTTATGCAGG + Intronic
1106874096 13:34053632-34053654 CAGTTTATTCACAGTGTCGTTGG + Intergenic
1107265908 13:38554092-38554114 CAGTGCAGTCATAGTGATGATGG - Intergenic
1107808130 13:44174158-44174180 CAGAGCAGTCCCAGTGATGCTGG - Intergenic
1108384066 13:49881775-49881797 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1109030645 13:57183771-57183793 CAAAGTAGTCACAGTGATTCAGG + Intergenic
1111773484 13:92628606-92628628 CAGTTTAGTCACAGTGATGCTGG - Intronic
1111802206 13:92995016-92995038 CAGTTTTGTCACATTAATGCAGG + Intergenic
1112397439 13:99046116-99046138 AATTCTAGACACAGTGATGCTGG - Intronic
1112920686 13:104608449-104608471 CATTGGAGTCACAGTGATGTAGG - Intergenic
1114363746 14:22004610-22004632 GAGTTTAATGACTGTGATGCAGG + Intergenic
1116641277 14:47466543-47466565 CAGCTTTGTCACAGAGAGGCTGG - Intronic
1117264814 14:54076216-54076238 CAGTGCAGTCACAGTGGTGAGGG - Intergenic
1117483007 14:56168087-56168109 CAGTGCAGTCACAGTGGTGCTGG - Intronic
1119086118 14:71740472-71740494 CGGTTTAGTGACAGTTATGAAGG - Exonic
1124514865 15:30358379-30358401 GTGTTGAGTCACAGTGATTCAGG - Intergenic
1124728056 15:32172383-32172405 GTGTTGAGTCACAGTGATTCAGG + Intronic
1125263092 15:37849706-37849728 AAGTTTAGTCACATTGGTGATGG + Intergenic
1125270552 15:37934348-37934370 CATTTTAGTCACACTGAGGCAGG + Intronic
1125354332 15:38801547-38801569 CAGTTTATTCATAGTGTTGATGG + Intergenic
1126183882 15:45811668-45811690 CAGTGCAGTCATAGTGATGGTGG + Intergenic
1129025106 15:72564494-72564516 CAGTTCATTCACAGTGATCTAGG + Intronic
1132827053 16:1910319-1910341 CAGCTTAGCCCTAGTGATGCTGG - Intergenic
1134163662 16:11913613-11913635 GAGTCTAGTCAGAGTGGTGCTGG + Intronic
1134385923 16:13772343-13772365 CAGTTTACTCCCAGTGAAACAGG - Intergenic
1135693007 16:24559896-24559918 CAGTATAGTCACCCTGATGAAGG - Intronic
1138173382 16:54874043-54874065 CAGTTGACTCACAGTTCTGCAGG + Intergenic
1141416850 16:83882373-83882395 CAGTTCAGTCACAGAAATGGTGG - Intergenic
1141492433 16:84383185-84383207 CAGTTTTGGGACAGTGAGGCTGG - Intronic
1142649554 17:1339014-1339036 TTGTTTAGTTACAGTGATGCTGG - Intergenic
1144371984 17:14599829-14599851 CAGTTTTTTCACAGTGTTGTTGG - Intergenic
1144701134 17:17341340-17341362 CAGTTTCCTCACAGTGTTGCTGG - Intronic
1146364321 17:32207699-32207721 CTGTATAGTCGCAGTCATGCTGG - Intronic
1146727104 17:35165335-35165357 CACTGGAGTCACACTGATGCTGG - Intronic
1147009251 17:37431282-37431304 CAGATTAGGCACAGTGAGGGTGG + Intronic
1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG + Intronic
1153823622 18:8854724-8854746 CAGATAAGTCACAGTGAAGCTGG - Intergenic
1154008134 18:10551725-10551747 GATTTTAGTCACAGTTCTGCGGG + Exonic
1156912287 18:42425424-42425446 TAGTGTAGTCCCAGTGATGGTGG - Intergenic
1157091639 18:44643630-44643652 CAGAATAGTCACAGTCATGGAGG + Intergenic
1158256115 18:55550895-55550917 CATTTTGGTCACATTGAAGCAGG - Intronic
1160422589 18:78757288-78757310 CAGTTTAGCAACAGTGAGGCTGG - Intergenic
1161671711 19:5615588-5615610 CTGTGTAGTCTCAGTTATGCAGG + Intronic
1162666666 19:12219625-12219647 CAGTGCAGTCACAGTGGTGGTGG - Intergenic
1164457028 19:28417538-28417560 CAGCACAGTCACAGTGATGGTGG - Intergenic
1165970188 19:39622473-39622495 CAGTTTATTCATAGTGTTGATGG + Intergenic
1166339752 19:42130597-42130619 CAGTGTAGACACAGAGATCCAGG - Intronic
924967956 2:95371-95393 CAGTTTCTTCACAGTGTTGACGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926541866 2:14190599-14190621 CAGTAAAGTCACAGTGAGGGCGG + Intergenic
930770176 2:55122679-55122701 CAGATTAGTGACAGTGGTGGTGG + Intergenic
935813059 2:106818297-106818319 CAGTACAGTCCCAGTGATGGTGG + Intronic
939224667 2:139349889-139349911 CAGTTTCTTCATAGTGATGATGG - Intergenic
940131461 2:150387618-150387640 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
941085956 2:161118577-161118599 AAGCTCAGTAACAGTGATGCTGG + Intergenic
941845520 2:170127971-170127993 CAGTTTCTTCACAGTGTTGATGG - Intergenic
942560664 2:177214998-177215020 CAATTTAGTTGAAGTGATGCTGG + Intronic
942743665 2:179207353-179207375 CGGTTTAGCCAGAGTGTTGCAGG - Intronic
946235950 2:218324273-218324295 CAGTTTAGGGACAGTAATGTTGG + Intronic
948091117 2:235296615-235296637 CAGTTAATTCTCTGTGATGCTGG + Intergenic
948398223 2:237663180-237663202 TAGTTTAGTTAAACTGATGCAGG - Intronic
949020724 2:241739778-241739800 CTGCTTATTCACAGTGATGTGGG - Intronic
1168819015 20:761184-761206 CAGTTACGTCAAGGTGATGCTGG - Exonic
1173825794 20:46047035-46047057 CAGTTGTGTCACAGTCTTGCTGG - Intronic
1174577604 20:51547683-51547705 GAGTTGAGGCACAGTGAGGCAGG - Intronic
1175754452 20:61520653-61520675 CAGCTCAGTGACGGTGATGCGGG + Intronic
1177069525 21:16486141-16486163 CAGTGCAGTCACAGTGGTGGTGG - Intergenic
1177133076 21:17280334-17280356 CAGTGCAGTCATAGTGATGGTGG + Intergenic
1178174756 21:30083669-30083691 CAGAAAAGTCACTGTGATGCAGG - Intergenic
1178792236 21:35711299-35711321 CAGTTGAGGCAGAGTGATGCTGG + Intronic
1178970104 21:37166969-37166991 CAGGTAAGGCACTGTGATGCAGG - Intronic
1179009930 21:37548640-37548662 CAGTTTTATCACCGTGTTGCAGG - Intergenic
1179305329 21:40148984-40149006 CTTTTTAGTGACAGTGATGGTGG - Intronic
950684767 3:14608598-14608620 CAGTTCAGCCACAGTTATTCAGG + Intergenic
950909745 3:16576578-16576600 CAGTTTAGCCTCAGTGATGAAGG - Intergenic
951102421 3:18703970-18703992 CAGTTCAGTCATAGTGGTGGTGG + Intergenic
951254278 3:20431191-20431213 CAGTTTCTTCACAGTGTTGATGG + Intergenic
951324249 3:21283817-21283839 CAGTTTCCTCACAGTGTTGATGG + Intergenic
951695053 3:25437682-25437704 CATTTTTGTCACAGTGGAGCGGG + Intronic
953316085 3:41927410-41927432 CAGTTTCTTCACAGTGTTGATGG - Intronic
956228926 3:66990862-66990884 CAGATTAATCACAGTTAAGCTGG - Intergenic
958078457 3:88713411-88713433 CAGTGTAGTCATAGTGGTGTTGG + Intergenic
959913606 3:111792956-111792978 CAGTGTAGTCCCAGTGTTGGTGG - Intronic
962483431 3:135817196-135817218 CAGTGCAGTCCCAGTGATGGTGG + Intergenic
963448154 3:145440731-145440753 CAGTGCAGTCACAGTGGTGGTGG + Intergenic
963629088 3:147711238-147711260 CAGTTTCTTCACAGTGTTGATGG + Intergenic
965345097 3:167538640-167538662 CACTTTGTTCATAGTGATGCAGG + Intronic
969383725 4:6827663-6827685 CAGTTTGGTCTCAGTTGTGCAGG + Intronic
969418082 4:7074051-7074073 CAGTTTACTGACAGTGAGGTGGG - Intergenic
971524759 4:27603101-27603123 CAGAATAGTCACAGTGAATCTGG + Intergenic
972934343 4:44114024-44114046 CAGTGTAGTCCCAGTGGTGGTGG - Intergenic
975252826 4:72198844-72198866 CAGTGTAGTTACAGTGGTGGTGG + Intergenic
976907620 4:90259787-90259809 GAGTTTAGTCACAGAGATGCAGG - Intronic
979826287 4:125237085-125237107 CAGGATAGTCATACTGATGCAGG - Intergenic
980672054 4:136022432-136022454 TAGTTTACTCAGAGTGCTGCAGG - Intergenic
981159585 4:141481971-141481993 CAGTGTAGAAACAGTGATTCAGG + Intergenic
982393836 4:154894024-154894046 CAGTTTCTTCACAGTGTTGTTGG - Intergenic
982794320 4:159627806-159627828 CAGTTTCTTCACAGTGCTGATGG + Intergenic
984472344 4:180192429-180192451 CAGATAGGTCACAGTGATGTGGG - Intergenic
985228487 4:187789199-187789221 CATGCTAGTCACAGTGATGGCGG + Intergenic
987889419 5:23856899-23856921 CAGTTTATTCATAGTGTTGATGG - Intergenic
987923868 5:24316045-24316067 CAGTTTCTTCACAGTGTTGATGG + Intergenic
992313042 5:75522207-75522229 CAGTTTAGACACTGTGAGTCAGG + Intronic
992632812 5:78698284-78698306 AAGTTTAGCAACAGTGGTGCTGG - Intronic
993287254 5:86015773-86015795 CAGTGCAGTCACAGTGCTGGTGG - Intergenic
993582401 5:89678318-89678340 CAGTGCAGTCACAGTGGTGGTGG + Intergenic
994233987 5:97340115-97340137 CAGTGCAGTCTCAGTGATGGTGG + Intergenic
994425343 5:99577583-99577605 CAATTTATTCACAGTTATGTAGG - Intergenic
994435998 5:99734652-99734674 CAATTTATTCACAGTTATGTAGG + Intergenic
995777877 5:115745347-115745369 CAGTGCAGTCATAGTGATGGTGG - Intergenic
996594595 5:125185946-125185968 CAGTGCAGTCACAGTGGTGGTGG + Intergenic
998443837 5:142183658-142183680 CAGTTTACTGACAGCGATGCAGG - Intergenic
998751816 5:145330942-145330964 TAGTTTTGTCACAGAGATTCTGG + Intergenic
999406482 5:151311766-151311788 CAGTGCAGTCATAGTGATGGTGG - Intergenic
999463939 5:151783151-151783173 CAGATTAGTCACAGAAAGGCTGG - Intronic
1002673755 5:180891762-180891784 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1010182025 6:73097589-73097611 CAGTGCAGTCTCAGTGATGGTGG + Intronic
1011459579 6:87589568-87589590 CACTTTAGTGACATTGATGATGG - Intronic
1014645536 6:123968161-123968183 CAGTATAATCACTGTGAGGCAGG + Intronic
1016820189 6:148339844-148339866 CCGTTTAATTACACTGATGCGGG + Intronic
1019403077 7:867489-867511 CAGTGTTGTCAGTGTGATGCTGG + Intronic
1019711089 7:2518674-2518696 CAGTTTAGCCACGGTGGTGGCGG + Intronic
1020281092 7:6650460-6650482 CTGTTTTTTCACAGTGAAGCCGG + Intronic
1021641093 7:22736433-22736455 CAGTGCAGTCACAGTGGTGGTGG + Intergenic
1022741036 7:33122151-33122173 CAGTGCAGTCACAGTGGTGGTGG - Intergenic
1022855829 7:34313137-34313159 CAGTTTAGTGACAGTGGTCTAGG - Intergenic
1023244836 7:38190627-38190649 CAGTTTAGTAATGGTTATGCAGG - Intronic
1024321935 7:48079394-48079416 CAATTCTGTCACAGTGAGGCCGG - Intergenic
1024891778 7:54211590-54211612 CAGTGTAGTCACATTGATGGTGG + Intergenic
1028555830 7:92123638-92123660 CAGTTAAAAAACAGTGATGCTGG - Intronic
1029817242 7:103108654-103108676 CAGTTTATTCATAGTGTTGATGG - Intronic
1033399308 7:141006847-141006869 CTGTTTAGTCTTAGTGTTGCAGG - Intronic
1035307532 7:157942876-157942898 CAGTTAGGCCACAGTGATTCAGG - Intronic
1037295748 8:17397800-17397822 CAGTGTAGTCCCAGTGGTGGTGG + Intronic
1047634338 8:126744107-126744129 CTGTTTAGCCAGAGTGGTGCAGG + Intergenic
1047779453 8:128099415-128099437 CCGTTTTCCCACAGTGATGCTGG - Intergenic
1048577166 8:135701913-135701935 CAGTTTAGCCTCAGAGATGAAGG + Intergenic
1048646759 8:136429012-136429034 CAGCACAGTCACAGTGATGGTGG + Intergenic
1049053089 8:140214445-140214467 CAGGTCAGTCACAGTCCTGCTGG - Intronic
1051966546 9:22835688-22835710 CAGTGCAGTCCCAGTGATGGTGG - Intergenic
1051979454 9:22996911-22996933 CATCTTGGTCACACTGATGCAGG + Intergenic
1052073609 9:24113367-24113389 CGGTTTATTCAGAGAGATGCAGG + Intergenic
1055181122 9:73388395-73388417 CAGTGCAGTCCCAGTGATGGTGG - Intergenic
1056106589 9:83353185-83353207 CAGTTCTGTCACAGTGATCCAGG + Intronic
1056120227 9:83480280-83480302 CAATTCAGTCACAATGCTGCAGG - Intronic
1056672232 9:88640008-88640030 CAGTTTGTTCAAAGTTATGCTGG - Intergenic
1057291731 9:93811050-93811072 CAGTGTAGAAACAGTAATGCAGG - Intergenic
1059413309 9:114147822-114147844 CAGTTTTGTCACCTTGCTGCTGG + Intergenic
1185782472 X:2861519-2861541 CAGCTTTGCCACAGTGATGTGGG + Exonic
1188094260 X:26002740-26002762 CTGTTTAGCCAGAGTGGTGCAGG - Intergenic
1188870456 X:35365027-35365049 CAGGTTAGCCATAGTGGTGCAGG - Intergenic
1189887256 X:45560638-45560660 CTTTGTTGTCACAGTGATGCTGG + Intergenic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1191947964 X:66555931-66555953 CAGTTTCTTCACAGTGTTGTTGG - Intergenic
1191972653 X:66833644-66833666 CAGTACAGTCACAGTGGTGGTGG + Intergenic
1192812670 X:74560685-74560707 CAGTGCAGTCACAGTGGTGGTGG + Intergenic
1193175270 X:78384835-78384857 CAGTGCAGTCACAGTGGTGATGG + Intergenic
1193386938 X:80883596-80883618 CTGTTTAGCCACGGTGGTGCAGG - Intergenic
1193487257 X:82102182-82102204 CAGTACAGTCATAGTGATGGTGG - Intergenic
1193777058 X:85656469-85656491 TAATTTACTCACAGTTATGCAGG - Intergenic
1194218812 X:91166940-91166962 CAGCATAGTCATAGTGATGGTGG - Intergenic
1194489186 X:94526379-94526401 CAATTGACTCACAGTTATGCAGG + Intergenic
1195136309 X:101910002-101910024 CAGCATAGTCACAGTGGTGGTGG + Intronic
1196600826 X:117600230-117600252 CAGTGTAGTCATAGTGGTGGTGG - Intergenic
1196625450 X:117872050-117872072 CAGTACAGTCACAGTGGTGGTGG + Intergenic
1196984438 X:121253218-121253240 CAGTGTAGTCACAGTGGTGGTGG - Intergenic
1197049987 X:122046298-122046320 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
1199304032 X:146245743-146245765 CAGCAAAGTCACAGTGATGGTGG + Intergenic
1199316157 X:146380081-146380103 CAGTTTAGTCCCAGTGGTGGTGG + Intergenic
1200555322 Y:4630694-4630716 CAGCATAGTCACAGTGATGGTGG - Intergenic
1201927737 Y:19307827-19307849 CAGTGTAGTCATAGTTATGGTGG - Intergenic
1202024015 Y:20501388-20501410 CAGCATAATCACAGTGATGGTGG - Intergenic
1202165477 Y:21982784-21982806 CTGTTTAGACACAGTTATGGAGG - Intergenic
1202225880 Y:22603588-22603610 CTGTTTAGACACAGTTATGGAGG + Intergenic
1202275843 Y:23118879-23118901 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202290185 Y:23301812-23301834 CAGTTTAGCCTCAGGGATGAAGG + Intergenic
1202317233 Y:23592073-23592095 CTGTTTAGACACAGTTATGGAGG - Intergenic
1202428837 Y:24752598-24752620 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202441954 Y:24917491-24917513 CAGTTTAGCCTCAGGGATGAAGG + Intergenic
1202553532 Y:26077985-26078007 CTGTTTAGACACAGTTATGGAGG + Intergenic