ID: 1111774282

View in Genome Browser
Species Human (GRCh38)
Location 13:92640006-92640028
Sequence CAGAATTAGGAGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 1, 1: 0, 2: 8, 3: 138, 4: 764}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111774282 Original CRISPR CAGAATTAGGAGAGGGAGAA GGG (reversed) Intronic
900824654 1:4916683-4916705 CATAATTGGGAGAGGAACAATGG + Intergenic
900841894 1:5056683-5056705 CAGAAGTGGGGGAGGGTGAAAGG + Intergenic
901078218 1:6568947-6568969 TAGAGGTTGGAGAGGGAGAAAGG + Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901681536 1:10915742-10915764 CAGAAGCAGGAGGGAGAGAAGGG + Intergenic
902567614 1:17322842-17322864 AAGAAGTGGGAGGGGGAGAAGGG - Intronic
902744160 1:18462008-18462030 CAGAATTTGGAGAGCGATTATGG + Intergenic
902987826 1:20166209-20166231 CAGACTTTGCAGAGGGAGAGTGG - Intronic
904275841 1:29383818-29383840 AAGAGGTAGGAGAGGGGGAAAGG - Intergenic
904557323 1:31373580-31373602 AAGAAATAGGAGGGGGTGAATGG + Intronic
904590535 1:31612837-31612859 CAGGAGTGGGAGAGGAAGAAGGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907097547 1:51795505-51795527 CAGAATGAAGATAGAGAGAAAGG + Intronic
907289896 1:53407059-53407081 GAGAATTAGGAGAGGGCCGAGGG + Intergenic
907659743 1:56381049-56381071 CAAACTTAGAAGAAGGAGAAAGG + Intergenic
908274057 1:62450927-62450949 TAGAAGTAGGAGATGTAGAAGGG - Exonic
908290762 1:62664902-62664924 CAGATTCAGGAGAGGGCAAAGGG + Intronic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
908828577 1:68157054-68157076 CAGAATTGGGAGAAGGACATGGG + Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910149294 1:84122756-84122778 TAGATTTATGAGAGGGAAAATGG + Intronic
910451348 1:87349152-87349174 CAGAATTTGTTGAGTGAGAAAGG + Intergenic
910684458 1:89902064-89902086 CAGAAGTAGGCCAGGGAGAGAGG + Intronic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911906907 1:103581080-103581102 TTTAATTAGGAGAGGGAGCAAGG - Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913011279 1:114686328-114686350 CAGACCTAGGATAGTGAGAAGGG - Intronic
913037701 1:114988184-114988206 CAGAAGGAGAAGAGGGAGAGAGG + Intronic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913370355 1:118092314-118092336 AAGGATTGGGAGAGGGAGAATGG - Intronic
913468686 1:119169523-119169545 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
914680866 1:149937290-149937312 AAGAATTAGGTGAGGAAGCAGGG + Intergenic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
914762329 1:150609023-150609045 AAGAATTAGGGGAGTGAGATTGG - Intronic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915231966 1:154452334-154452356 CAGAGCGAGGAAAGGGAGAATGG - Intronic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
915721871 1:157992040-157992062 CACAATTAGAAGACAGAGAAAGG - Intergenic
918125894 1:181583322-181583344 CAGAATGAGGAGTGGTAGAAAGG - Intronic
918320510 1:183359718-183359740 CAGCAGTGGGAGAGGGAAAATGG + Intronic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
919074274 1:192795053-192795075 CAGAATTAGAAAAGTGAAAATGG + Intergenic
919691416 1:200531645-200531667 AAGAATTAGGATAGAGAGATTGG - Intergenic
919991041 1:202709020-202709042 CAGCAGTAGGGGAGGGAGAAGGG + Intronic
920101499 1:203519801-203519823 CAGAAAGAGGAAAGGGAGAGAGG + Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920146983 1:203870257-203870279 CAGTATTGGGAGGTGGAGAAGGG + Exonic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920937821 1:210452190-210452212 GCGAATTATGGGAGGGAGAAGGG - Intronic
921114936 1:212081145-212081167 AGGAAATAGGAAAGGGAGAAGGG + Intronic
921351142 1:214236485-214236507 CAGTATTAGGTAAGGGAGCAGGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922167902 1:223130990-223131012 CAGAATTGGAAGAAGGGGAATGG - Intronic
922198931 1:223384829-223384851 CAGAATTAGAGTAGGGGGAATGG + Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
923127853 1:231047683-231047705 AAGAAAGAGGAGAGGGAGAAAGG - Intergenic
923231526 1:231990819-231990841 CAAAGTTAGGAGCAGGAGAAGGG - Intronic
923284678 1:232481982-232482004 AAGAATTAGGTATGGGAGAATGG - Intronic
923393398 1:233536102-233536124 CAGAGTTGGGATAGGGAGAGGGG + Intergenic
923650369 1:235867375-235867397 AGGAGTCAGGAGAGGGAGAAAGG + Intronic
924328298 1:242917778-242917800 GAGAATAGGGAGTGGGAGAAGGG - Intergenic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924416588 1:243861974-243861996 CAGATTTACAAGGGGGAGAAAGG + Intergenic
924615280 1:245607215-245607237 CAGGCTTATGAGAGGGAAAAAGG - Intronic
1063156091 10:3380559-3380581 GAGAATGAGGAGCTGGAGAATGG - Intergenic
1063506979 10:6608473-6608495 CATACCTAGGAGAGGGAGACGGG + Intergenic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1064380209 10:14835075-14835097 CAGGTTTAGGGGAGTGAGAAGGG + Intronic
1064592637 10:16910187-16910209 GAGAAGGAGAAGAGGGAGAAGGG - Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1066028556 10:31392266-31392288 CAGAATTTGAAGAGAGAAAAAGG - Intronic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067249351 10:44574181-44574203 CAGACTTGGGAGAGGCAGAAGGG + Intergenic
1067713179 10:48666523-48666545 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068584050 10:58776681-58776703 CATAAGTATGAGAGGGAGATGGG - Intronic
1068791497 10:61035396-61035418 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
1069344487 10:67452012-67452034 AAGAATAGGAAGAGGGAGAAAGG + Intronic
1069606973 10:69744974-69744996 CAGAGTAAGAAGTGGGAGAAAGG + Intergenic
1069941804 10:71961871-71961893 GAGAGATTGGAGAGGGAGAAAGG + Intergenic
1070350086 10:75583428-75583450 CAGAAGGAAGAGAGAGAGAAGGG + Intronic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1070625207 10:78046175-78046197 CAGAATTCTCAGAGGCAGAACGG - Intronic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071327047 10:84528001-84528023 CAGAATTAGAACATGGAGATTGG - Intergenic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071781748 10:88853972-88853994 CACAACTAGGAGTGGGAGCATGG + Intergenic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1071894752 10:90053658-90053680 TATAATAAGGAGAGGGACAAGGG - Intergenic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072748240 10:97957276-97957298 CAGAAGTGGGTGATGGAGAAAGG + Intronic
1072872910 10:99139280-99139302 CAGAAGCAGAAGGGGGAGAAAGG + Intronic
1074076089 10:110127088-110127110 GAGAATGGGGAGAGGGAAAAAGG - Intronic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074691336 10:116007335-116007357 GACAAGTAGGAGAGGGAGGAGGG + Intergenic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1075957778 10:126538788-126538810 TAGAATAAGCAGAGGTAGAATGG - Intronic
1076030742 10:127155764-127155786 TAGAATTAGCTGATGGAGAAAGG - Intronic
1076153520 10:128184724-128184746 AACAATTAGGAGAGGGGGAAAGG - Intergenic
1076480032 10:130778963-130778985 GAGGATTAGGATAGGGACAAGGG - Intergenic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077304910 11:1864685-1864707 CTGAAGTAGGAGAGGGGAAAGGG + Intronic
1077445770 11:2589977-2589999 GAGAGTTAGGAGAGGTGGAAGGG + Intronic
1077552328 11:3206193-3206215 CACAAGTGGGGGAGGGAGAAGGG - Intergenic
1077714243 11:4565804-4565826 AAGAATTGGGAAGGGGAGAAAGG - Intergenic
1077933397 11:6757071-6757093 CAGAAACAGGAAAGAGAGAATGG + Intergenic
1078144106 11:8711352-8711374 AAGAATTCGGAGTGGGACAAGGG - Intronic
1078260637 11:9704095-9704117 CAGAATTTGGATAGGGATGATGG - Intronic
1078366770 11:10713242-10713264 CAGAAGTTGAAGAGGGAGATAGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078728735 11:13956707-13956729 CAGAAATACAAGAGGGAGAGAGG + Intergenic
1078925747 11:15873308-15873330 CAGAATAGAGAGAGAGAGAATGG + Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079363301 11:19787786-19787808 CAAAATTTAGAGTGGGAGAAAGG + Intronic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079933624 11:26593244-26593266 TTGAATTAGGAGAAGGAAAAAGG - Intronic
1080237797 11:30092335-30092357 CACAATTAGGAGAGAGAAAGAGG - Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080347459 11:31340882-31340904 CAGAATGAGTAGATAGAGAAGGG + Intronic
1080369471 11:31618448-31618470 AAGAACCAGGAGAGTGAGAAAGG + Intronic
1081208254 11:40300095-40300117 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081634068 11:44709109-44709131 CAGACTGTGGAGGGGGAGAAGGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083874799 11:65516319-65516341 CAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085659257 11:78348159-78348181 CAGAAGCAGAAGAGGTAGAAGGG + Intronic
1085682182 11:78587323-78587345 AAGAATTAGAGCAGGGAGAAGGG + Intergenic
1085823195 11:79815086-79815108 GAGAAGGAGGAGAGAGAGAAAGG + Intergenic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086077441 11:82869479-82869501 AAGAAGGAAGAGAGGGAGAAAGG + Intronic
1086398842 11:86444206-86444228 ATGAATTAGGGGAGAGAGAATGG + Intronic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086987601 11:93267225-93267247 AGAACTTAGGAGAGGGAGAAGGG - Intergenic
1087093683 11:94300187-94300209 AAGGATGGGGAGAGGGAGAAAGG + Intergenic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088616012 11:111628918-111628940 AAGTATTAGGAGTAGGAGAAGGG + Intronic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088741425 11:112770471-112770493 GAGGATAAGGAGAGGTAGAAGGG - Intergenic
1088850270 11:113698505-113698527 GACAATCAGGAGAGGGAGAGTGG + Intronic
1088925013 11:114293215-114293237 CAGACCTAGGAGATGTAGAATGG - Intronic
1089028601 11:115298364-115298386 TAGAATGAGGAGAAGAAGAAAGG + Intronic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089944897 11:122460240-122460262 TAAAAAAAGGAGAGGGAGAAGGG + Intergenic
1090461278 11:126893692-126893714 CAGACGTGGGAGAGGGAGATTGG - Intronic
1090951041 11:131473628-131473650 CTGAGCTAGGAGAGGGAAAATGG + Intronic
1091038424 11:132254630-132254652 TAGAAGTGGGAGAGAGAGAAGGG - Intronic
1091169945 11:133511109-133511131 CAGAATCAGGTGAGAGAGAGTGG - Intronic
1091434575 12:462333-462355 AAAAGTGAGGAGAGGGAGAAAGG - Intronic
1091479938 12:817485-817507 CAGCATTTGGAGAGGCAGATTGG + Intronic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1092457199 12:8654537-8654559 CAGAGTAAGAAAAGGGAGAATGG + Intronic
1092487312 12:8914275-8914297 CAGAACTCGGAGAGAAAGAAGGG + Intronic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092867777 12:12779108-12779130 AAAAATTAGGAGAGAGAGGAGGG - Intronic
1093092638 12:14938505-14938527 CAGGAGCAGGAGAGGGACAATGG - Exonic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095139070 12:38640298-38640320 TAGAATTAGGATAAGGAAAAAGG + Intergenic
1096050206 12:48600812-48600834 AGAATTTAGGAGAGGGAGAAGGG - Intergenic
1096180522 12:49548232-49548254 CACACTTGGGAGAGGGACAAAGG - Intronic
1096335871 12:50755538-50755560 CAGATGGAGGAGAGAGAGAATGG + Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096565821 12:52477950-52477972 CAGAAGGAAGAGAGAGAGAAGGG - Intergenic
1096750025 12:53752590-53752612 CAGATTGAGGAAAGGCAGAAGGG - Intergenic
1096802099 12:54117397-54117419 CTGATTTAGCAGAGGGTGAAGGG + Intergenic
1097376930 12:58853527-58853549 TAGAATTCGGAGAAGGAAAAAGG - Intergenic
1097406165 12:59193440-59193462 CAAATTTAGGGGAGGGAGCATGG - Intergenic
1097541246 12:60946307-60946329 CATTCTTTGGAGAGGGAGAAGGG + Intergenic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1097925101 12:65118523-65118545 CCGAATGAGTAGAGAGAGAAAGG + Intronic
1099394534 12:82121354-82121376 CAGCAGTGGGACAGGGAGAAGGG - Intergenic
1099426972 12:82535406-82535428 CAGAATGAGGATGGGGACAAGGG - Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1100352642 12:93799000-93799022 CATAATTAGGAGTGGGGGAAGGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100924125 12:99524486-99524508 TATAAGTAGAAGAGGGAGAAAGG + Intronic
1100930748 12:99607091-99607113 CAGAGTTAGGCCAGGGAGGATGG + Intronic
1101122434 12:101597135-101597157 CACAGTTAGGAGAAGAAGAAAGG - Intronic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1101711497 12:107271202-107271224 TAGAATTAGGAGAGTGGGGAGGG - Intergenic
1102121519 12:110445654-110445676 ATTAATTAGGGGAGGGAGAAGGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102348651 12:112175972-112175994 CAGAGTTACGGGAGGGAGAGGGG - Intronic
1102515941 12:113446712-113446734 CAGGATAAGGGGAGAGAGAATGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103434908 12:120917365-120917387 GAAAAATAGAAGAGGGAGAATGG - Intergenic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104557283 12:129812211-129812233 GATAAATAGAAGAGGGAGAAAGG - Intronic
1104669456 12:130670433-130670455 CAGAGCTAGGAGAGAGAGCAGGG - Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105013432 12:132771380-132771402 ATGAGTTAGGAGAGAGAGAATGG - Exonic
1105836155 13:24213597-24213619 GAGAAAAAGGACAGGGAGAAGGG - Intronic
1106708905 13:32311010-32311032 GAGAATTTGGAGACGAAGAAGGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108877000 13:55059821-55059843 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110951229 13:81494147-81494169 CAGAATGAGGAGAGAGACAAAGG + Intergenic
1111299586 13:86330344-86330366 CAGAAATAGAAGAGAGAGAATGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111448201 13:88378310-88378332 TAGAAAGAGGAGAGGGAGTATGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111806290 13:93043292-93043314 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1112199689 13:97262574-97262596 CAAAAATAAGAGAGGGAGAAGGG - Intronic
1112933491 13:104770387-104770409 CAGAATACGGAGAGTCAGAAGGG - Intergenic
1113028068 13:105963069-105963091 CAGAATTAGGAGTGGAAGCCAGG + Intergenic
1113221699 13:108111817-108111839 CACAATGAGGAAAGGCAGAATGG - Intergenic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114158897 14:20140407-20140429 CAGAATTAGCAGGAAGAGAATGG + Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114592880 14:23884315-23884337 CAGATTTAGGAGAGGTCCAATGG + Intergenic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1115771294 14:36666084-36666106 AAGAATGAGGAGGTGGAGAACGG + Intronic
1115904331 14:38190042-38190064 CAGAATTCCAAAAGGGAGAAAGG - Intergenic
1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116552377 14:46257845-46257867 CAGATTTGGGAGGAGGAGAAAGG + Intergenic
1116650334 14:47583226-47583248 TAGAATGACGTGAGGGAGAATGG + Intronic
1116790225 14:49332034-49332056 TAGAATGAAGGGAGGGAGAAAGG - Intergenic
1117063785 14:51988967-51988989 GAGAGTTAGGAGAGACAGAATGG + Intergenic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117659543 14:57989188-57989210 CAGATTTAGTAGATGAAGAAAGG - Intergenic
1118180025 14:63483442-63483464 CAGAATCACAAGAGGAAGAAGGG + Intronic
1118225023 14:63890560-63890582 GAGAATGAGGGGAGGGAGACAGG + Intronic
1118411129 14:65479565-65479587 TGGAAGTAGGAGAAGGAGAAAGG - Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118573263 14:67215580-67215602 CAGAAATAGGAAAGGGATACGGG + Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1119139033 14:72248188-72248210 CACACTTAGGAGAGAGAAAAAGG - Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120383027 14:83807325-83807347 CAGAATTATGAGAGAGTGAGTGG + Intergenic
1121012560 14:90529467-90529489 TAGAATTCGGATAGGCAGAATGG - Exonic
1121432021 14:93894247-93894269 GAGAAAGAGGAGAGAGAGAAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122382858 14:101322077-101322099 AGAACTTAGGAGAGGGAGAAGGG - Intergenic
1123668398 15:22628650-22628672 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1124073034 15:26413409-26413431 CGGTATTATGTGAGGGAGAAAGG - Intergenic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1124524377 15:30435111-30435133 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1124534288 15:30531112-30531134 CAGAATGAGGAGGGAGAGATGGG + Intergenic
1124710787 15:32008347-32008369 AAGAAATAGGAGGAGGAGAAGGG - Intergenic
1124764360 15:32476499-32476521 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1124774274 15:32572599-32572621 CAGAATGAGGAGGGAGAGATGGG + Intergenic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125233966 15:37490287-37490309 TAGAATTAGGAAGGGCAGAAGGG + Intergenic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126211158 15:46102652-46102674 AAGAATTAGGAGAGACAAAAAGG - Intergenic
1126347155 15:47708332-47708354 CAGAATCAGGGGAGGGTGATAGG - Intronic
1126939360 15:53749470-53749492 AAGACTGAGGAGAGGGAGAGAGG - Intronic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127573577 15:60267785-60267807 TAGAATTTGGGAAGGGAGAAAGG - Intergenic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128304153 15:66587025-66587047 GAGAATGGGGAGGGGGAGAAGGG - Intronic
1128449567 15:67797062-67797084 CACAATGAAGAAAGGGAGAATGG + Intronic
1128772241 15:70291151-70291173 TAGAAATAGAAGAGGCAGAAGGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1130200938 15:81826285-81826307 CAGAATGAGGAGAGGTTGACTGG + Intergenic
1131302269 15:91210113-91210135 GATAATTAGGAGATGGAGATAGG + Intronic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131420505 15:92300950-92300972 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1131423263 15:92325235-92325257 AATAAGTAGGAGAGGAAGAAAGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131741012 15:95391410-95391432 AATAATTAAGTGAGGGAGAAAGG + Intergenic
1132735765 16:1385166-1385188 CAGAAGGAGGTCAGGGAGAAAGG + Intronic
1133141359 16:3747022-3747044 AATAATTGGGAGTGGGAGAAAGG - Intronic
1133392751 16:5422760-5422782 AAGAAGATGGAGAGGGAGAAGGG + Intergenic
1133452586 16:5916371-5916393 AAGAAATAAGAGAGGGAGGAAGG - Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1133888573 16:9855666-9855688 CATAATTAGAAGAGGGGCAAAGG + Intronic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135995258 16:27243243-27243265 CGGAATTGGGAGACGGTGAACGG - Intronic
1136785571 16:32932173-32932195 CAGCGTGAGGAGAGGTAGAAGGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137387184 16:48052524-48052546 CAGATGTAGGAGAGTGAAAATGG + Intergenic
1137602889 16:49768602-49768624 GAGACTGAGGAGATGGAGAAAGG - Intronic
1137615834 16:49846466-49846488 CAGGATTAGGAGAGGCTCAAAGG + Intronic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138956195 16:61973140-61973162 CAGAGTCAGAAGAGGTAGAAGGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140996441 16:80264291-80264313 CAGAGTTAGAAGAGGAGGAAAGG - Intergenic
1141002432 16:80320577-80320599 GAGAACTAGGAGAGGAAAAACGG - Intergenic
1141067524 16:80926250-80926272 CAAAAGGAGGAGGGGGAGAAGGG + Intergenic
1141206358 16:81935847-81935869 CAGTTATAGAAGAGGGAGAATGG - Intronic
1141275501 16:82584218-82584240 CAGACTTAGGAGTGGTAGAAGGG + Intergenic
1141279574 16:82618842-82618864 ATGAATTTGGAGAGGGAGACAGG + Intergenic
1141551854 16:84811556-84811578 CCCATTTAGGTGAGGGAGAAGGG - Intergenic
1142367456 16:89657606-89657628 CAGCACTCGGAGAGGGAGAAGGG + Exonic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143152997 17:4818651-4818673 CAGAATCAGGAGGGGGACACGGG - Intronic
1143506639 17:7369598-7369620 CTGGATTAGGAGAGTGAGACTGG - Intergenic
1143585956 17:7850340-7850362 CAGCATTTGGCAAGGGAGAAGGG + Intronic
1143619028 17:8070679-8070701 CAGAATTTGAATTGGGAGAAAGG - Intergenic
1143738977 17:8938534-8938556 GAGGATAAGGGGAGGGAGAATGG - Intronic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1145024419 17:19457239-19457261 CAGAATTCCAACAGGGAGAAGGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146488401 17:33262308-33262330 GGGAATGGGGAGAGGGAGAAAGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146997374 17:37333137-37333159 TAGAATTAGGAGCAGGAAAAAGG + Intronic
1147270951 17:39270674-39270696 CAGAATTGGGTGAGTGAGACGGG - Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148459660 17:47831857-47831879 GAGACTTAGGAGAGGAGGAAAGG - Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1148826920 17:50400631-50400653 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1148898215 17:50853292-50853314 CACAATTAGGAAAGGGAAATCGG - Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149438850 17:56657723-56657745 CATTCTTAGGAGAGGGAGTAAGG + Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149633882 17:58150517-58150539 CAGAAATAGGAGAGCCAGAGAGG + Intergenic
1150830421 17:68513108-68513130 CAAAATTGGGAAAGGGAGAGAGG - Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1152384883 17:79966504-79966526 AAGAATTAGAAGAGAGAGAGAGG - Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155335248 18:24757032-24757054 AAGAATTAGGACAGTGAAAAGGG + Intergenic
1155581505 18:27313296-27313318 CAGATTTGGGATAGGGAGATGGG + Intergenic
1155721154 18:29013314-29013336 CAGAAGCAGAACAGGGAGAAAGG - Intergenic
1156039867 18:32808732-32808754 AAGAATTAAGAGAGTGGGAAGGG + Intergenic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156447886 18:37250412-37250434 CAGACCTAGGGGAGGGAGAAGGG - Intronic
1157080372 18:44518364-44518386 CTGCACTGGGAGAGGGAGAAGGG + Intergenic
1157332579 18:46714444-46714466 AAGAAGGAGAAGAGGGAGAATGG + Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157969293 18:52247856-52247878 GAGAACTAGGAAAGGGGGAATGG - Intergenic
1158332328 18:56376258-56376280 AGGAAAAAGGAGAGGGAGAAAGG + Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158485216 18:57860145-57860167 CAGAAAGAGAAGAGAGAGAAAGG - Intergenic
1158786001 18:60712473-60712495 TAGAATTAGGAGAAGGGAAAAGG + Intergenic
1159306880 18:66654500-66654522 CAGAAGTAGACAAGGGAGAACGG + Intergenic
1159522980 18:69549457-69549479 AAGAATTTGTAGAGGGAGCAGGG - Intronic
1159565502 18:70043390-70043412 CAATATTAGGAGAATGAGAAGGG + Intronic
1159675693 18:71282447-71282469 CAGGATTGGGAGAGGCTGAAAGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161257388 19:3316879-3316901 CAGAGCTGGGAGTGGGAGAAGGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161442604 19:4300812-4300834 CAGAGTGAGGACAGGGAGAGAGG + Intronic
1161619213 19:5289585-5289607 CAGAGGGAGGAGGGGGAGAAAGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161639777 19:5414469-5414491 CAGAATTATAAGATGAAGAATGG - Intergenic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164250118 19:23468626-23468648 GAGAAAGAGGAGAGGGAAAAAGG - Intergenic
1164323041 19:24167813-24167835 TAGAATTAGGAGAATGAAAAAGG - Intergenic
1166165863 19:40987927-40987949 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166818311 19:45560504-45560526 AAGCATCAGGAGAGAGAGAAGGG - Intronic
1167019283 19:46861633-46861655 CACAATTAAGAGATGCAGAATGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168274042 19:55266282-55266304 CAGACCTGGGAGAGGGGGAAAGG + Exonic
925114358 2:1365954-1365976 CAGAATGAGGGGGTGGAGAATGG - Intronic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
926070534 2:9885101-9885123 GAGAACTAGGATAGTGAGAAGGG + Intronic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926658552 2:15438184-15438206 CAGAATTAGGAACAGGTGAAAGG - Intronic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926894459 2:17669512-17669534 CAGAATTAGGGGAGGCAGCTTGG + Intronic
927023502 2:19041905-19041927 CAGAATTGGGAGTGGGAGTTAGG - Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
930045238 2:47165029-47165051 CAAAATTTGGGGAGGGATAAGGG - Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
931011362 2:57918295-57918317 CAGAAGGAGGAGAGGGGGAGTGG + Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931718202 2:65046174-65046196 AGAAGTTAGGAGAGGGAGAAGGG + Intergenic
932013822 2:68003904-68003926 CACAATTAGAAGAGCTAGAAAGG + Intergenic
932259712 2:70317043-70317065 CAGTAATAAGAGGGGGAGAAAGG - Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932445017 2:71775067-71775089 CTAAATTGGGAGAGGAAGAATGG - Intergenic
932828903 2:74969167-74969189 TAGAATTAGAAGTGGGAAAAGGG - Intronic
932917998 2:75877812-75877834 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933175296 2:79167028-79167050 CAGAATCAGAACATGGAGAATGG - Intergenic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
934948683 2:98561094-98561116 CATCAGTAGGGGAGGGAGAAAGG - Intronic
935362138 2:102254585-102254607 AAGAACGAGGAGAGGGAGAAGGG + Intergenic
935433019 2:102998341-102998363 AAGAATTAAGAGAGAAAGAAAGG - Intergenic
935730700 2:106062938-106062960 CAGACTTAGCAGCGGGAGAAAGG + Intergenic
935855340 2:107267332-107267354 CATAATTAGGAGAGATAGAAGGG + Intergenic
935958769 2:108403397-108403419 AGAACTTAGGAGAGGGAGAAGGG - Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936502654 2:113078342-113078364 CAGAAGTCAGGGAGGGAGAAGGG - Intergenic
936607500 2:113972957-113972979 CAGTATTATGAGTGGGAGCAGGG + Intergenic
936995393 2:118409030-118409052 CAGAATTAGAAGAAGCAAAATGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937274922 2:120678168-120678190 CAAAATTAGGAGAGGAACATGGG - Intergenic
937336413 2:121065059-121065081 CAGAGATAGAACAGGGAGAATGG - Intergenic
937602293 2:123753234-123753256 AAGAAGTAAGAGAGAGAGAACGG + Intergenic
938036806 2:128041446-128041468 AGAACTTAGGAGAGGGAGAAGGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
939018347 2:136927955-136927977 GAGAAGTGGGAGAGGGAGATAGG + Intronic
940556930 2:155240597-155240619 TAGACATGGGAGAGGGAGAAGGG - Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
941029573 2:160494672-160494694 GACAATTAGGAGATGGAGAGAGG - Intergenic
941105447 2:161346742-161346764 CAAAATTAGAAGAGACAGAAAGG - Intronic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942340011 2:174933977-174933999 GAAAATTAGGAGAGGGAGTAAGG + Intronic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942977786 2:182039800-182039822 CAGAATTGGGAGAGGGTGAGGGG - Intronic
943094739 2:183415821-183415843 CTAAATTAGGAAAGGGAAAATGG + Intergenic
943322628 2:186464456-186464478 CAGAAGTAGGAGGGTGGGAAGGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944256860 2:197631963-197631985 TTTAATTAGAAGAGGGAGAATGG - Intronic
946332474 2:219018185-219018207 CAGACTTAGGAGAGGGATCCAGG - Intronic
946435571 2:219650299-219650321 CGGAAGTGGGAAAGGGAGAAAGG + Intergenic
946539723 2:220670987-220671009 GAGACATAGGAGAGGAAGAAAGG - Intergenic
947544617 2:231002022-231002044 CAGAATCAGGAAAGTGAGCAGGG + Intronic
948106288 2:235416860-235416882 AAGTATTAGGAGAAAGAGAAAGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948580197 2:238981894-238981916 TAGGATTAGGAAAAGGAGAAAGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169006765 20:2213718-2213740 AAGAAATGGGAGAGGGAGGAAGG + Intergenic
1169428262 20:5512797-5512819 CAGTATTGGGAGAGGCAGCAGGG + Intergenic
1169789478 20:9393903-9393925 CAGAATTTGGAGAGGGCCCAAGG + Intronic
1169901105 20:10552337-10552359 CCTAATTAGGAGGAGGAGAAAGG + Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170039324 20:12023578-12023600 CAGAATCAGGAAGTGGAGAAGGG + Intergenic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170587049 20:17742685-17742707 GAGAAGAAGGAGGGGGAGAAGGG + Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1171301294 20:24063157-24063179 TAGATTTAAGAGAGAGAGAAAGG - Intergenic
1171794613 20:29557066-29557088 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1171853840 20:30327198-30327220 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172246237 20:33446914-33446936 AAGGAATAGGAGAGGGGGAAGGG + Intergenic
1172281257 20:33709946-33709968 TAGAGGTAGGAGTGGGAGAAAGG - Intronic
1173368909 20:42417056-42417078 TAGAAGCTGGAGAGGGAGAAAGG + Intronic
1173634403 20:44542343-44542365 CAAAATCAGGACTGGGAGAAAGG - Intronic
1174130320 20:48339917-48339939 CAGGTATTGGAGAGGGAGAAGGG - Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1174896904 20:54459048-54459070 CAGAATGAGGAGGGGGGAAAAGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176667605 21:9701881-9701903 AAGAAATAGGGAAGGGAGAAAGG - Intergenic
1176982315 21:15397498-15397520 CAGGAATAAGAGAGAGAGAAGGG - Intergenic
1177146598 21:17413374-17413396 CAGAATTAGCAGAAGGCCAAAGG + Intergenic
1177657622 21:24039660-24039682 TAGAAATAGGAAAAGGAGAATGG - Intergenic
1177762842 21:25421256-25421278 CAGAAGTGGGAGAGGTGGAAGGG - Intergenic
1178213927 21:30571893-30571915 CAGAATTAGCAGGGGGACAAAGG + Intergenic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1180642795 22:17312611-17312633 AGGAATTAGGAGAGATAGAAAGG - Intergenic
1181955822 22:26587264-26587286 CAGTATTAGGAGGGGGTGAAAGG - Intronic
1182793013 22:32968682-32968704 AAGAATTAGGTGAGGGTGAGTGG - Intronic
1183163899 22:36133071-36133093 CAGAATGAGGGGGGTGAGAAGGG - Intergenic
1183347671 22:37316999-37317021 CAGAGTGAGGAGTGGCAGAATGG - Intergenic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
949980656 3:9500184-9500206 CAGAGTTAGGAGAGAGTGAGGGG - Exonic
950779426 3:15378630-15378652 CAGAAGGAGGAGTGAGAGAATGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951293423 3:20902360-20902382 CAGTCTTAGGAGTGTGAGAATGG + Intergenic
951656420 3:25013989-25014011 CAAAGTTGAGAGAGGGAGAAGGG - Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952548230 3:34446211-34446233 CAGAAGTAAGAGAGAGAAAAGGG - Intergenic
952704609 3:36364820-36364842 GAGAATTAGGAAAGGCAAAAGGG + Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952921892 3:38291082-38291104 TAAAATTAGGAGAAGGAAAAAGG - Intronic
953279994 3:41545722-41545744 CAGAAACAGAAGAGAGAGAATGG - Intronic
953702477 3:45207481-45207503 CAGACTTTGCAGAGAGAGAAAGG + Intergenic
954093801 3:48306623-48306645 CAGAGTTGGGGTAGGGAGAATGG + Intergenic
954352409 3:50055643-50055665 AAGAAGTAGGAGTGGGAGAAAGG - Intronic
954499275 3:50995554-50995576 CAGACTTTGCAGAGGAAGAAAGG + Intronic
955498022 3:59556512-59556534 TAAAAATAGGAGAGGGAGGAGGG + Intergenic
956526071 3:70163490-70163512 ATGAATGAGGAGAGGGGGAAGGG - Intergenic
956813980 3:72891054-72891076 CAGAATTAGGAAAGCAATAAAGG - Intronic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957231542 3:77523770-77523792 CACAGTTAGCAGTGGGAGAAAGG - Intronic
957580942 3:82072373-82072395 AGAAATAAGGAGAGGGAGAAAGG + Intergenic
958175613 3:89992052-89992074 CAGAAGGAAGAGAGAGAGAAAGG - Intergenic
958970251 3:100603158-100603180 CAGACTTTGGAGATGGAAAATGG + Intergenic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
959567016 3:107842771-107842793 CAGAAGTGAGAGAGAGAGAAAGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960122198 3:113958345-113958367 CCGAGCTAGGAGAGGGAAAAAGG - Exonic
960405508 3:117254371-117254393 TGGAATTAGGAGAGAGAGAGAGG - Intergenic
960447049 3:117762049-117762071 CATAATGAGGAAAGGGAGATAGG - Intergenic
960447875 3:117769854-117769876 CAGAAATAAGAGAGACAGAATGG + Intergenic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960623797 3:119660878-119660900 CAGAATGAGGAGAGCCAGCATGG + Intronic
960858409 3:122126567-122126589 GAGAATTAGTAGTGGGAGGATGG + Intergenic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961117244 3:124341071-124341093 CACAATTAGATGAGGAAGAAAGG + Intronic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961995170 3:131234668-131234690 AAGAAATGGGAGAGAGAGAAGGG - Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962068003 3:132003531-132003553 TAGAAGTAGTAGAGAGAGAAGGG - Intronic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
962655078 3:137535505-137535527 CAGAATTAAGAGAGAGAGTGTGG - Intergenic
962932862 3:140053655-140053677 CAGAAATAAGAGAGAGAGGAGGG - Intronic
963131421 3:141861810-141861832 CAGAATTATGAGAGAGATTAGGG - Intergenic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963809150 3:149757695-149757717 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964539403 3:157762386-157762408 CAGTATGAGGAGAGTTAGAAAGG + Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965339145 3:167464359-167464381 GAGAATTAGGAAAGGGATAAAGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965843787 3:172938236-172938258 GAGAATGAGGAGAGGTAAAAGGG + Intronic
966223445 3:177572907-177572929 CAGAAATAGTAGAAAGAGAAAGG - Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966945776 3:184776251-184776273 CAAACTTAGGGGAGCGAGAAAGG + Intergenic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967683384 3:192391909-192391931 CAGATTGAGGAGTGGGAGAGAGG + Intronic
967686928 3:192428326-192428348 AAGAATCAGGAGAGGAAGAAGGG + Intronic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968426221 4:525145-525167 CAGGATGAGGAGAGAGAAAAGGG - Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969645292 4:8424979-8425001 TAAAATTAGGAGAAGGAAAAAGG + Intronic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
971420276 4:26468032-26468054 GAGAAGGAGGAGAGAGAGAAGGG + Intergenic
971621557 4:28860474-28860496 CAGAAGTGGAAGAGGTAGAAAGG + Intergenic
971854673 4:32027882-32027904 AAGAATTAGAAGAGAGAAAAGGG - Intergenic
972097410 4:35364927-35364949 CAGTATTAGGAGAAGTAGCAGGG - Intergenic
972162819 4:36245936-36245958 GAGAATTTGGAGAGGGAAAAGGG - Intergenic
972179176 4:36442919-36442941 TAGAATTAGGAGAAAGAAAAAGG - Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972935925 4:44135415-44135437 AAGAATTGGGAAAGGGTGAAGGG - Intergenic
974666334 4:64967517-64967539 CAGTAATAGCAGAGGGTGAAAGG - Intergenic
974803576 4:66851290-66851312 AAGAATTGGGAAATGGAGAAGGG - Intergenic
974844490 4:67334893-67334915 GAGATTTAGGAGAGAAAGAAAGG - Intergenic
974941624 4:68476318-68476340 CAGAAGTAGAAGAGGGTGAATGG + Exonic
975110152 4:70614362-70614384 ATGAAGTAAGAGAGGGAGAAGGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975210005 4:71688983-71689005 CAGAATGAGGAGAGACTGAAAGG - Intergenic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976691040 4:87867458-87867480 AAAAATTAGGAGAGACAGAAAGG - Intergenic
977529952 4:98189081-98189103 TATAATTAGGGGAGGGAGAGTGG - Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978616539 4:110602410-110602432 CAGATTTAGGTTAGGGAGAGTGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978909890 4:114050573-114050595 TAGAATTAGGATAAGGAAAAAGG + Intergenic
979211036 4:118103392-118103414 CAGAATTGAGAGAGGAAGAAGGG + Intronic
979321252 4:119327674-119327696 GAGAATTAGGAGAGAAACAAAGG - Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979417008 4:120454161-120454183 CACAATTAGAAAAGTGAGAAAGG - Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981529982 4:145743013-145743035 AAGAAGTAGGAGAGCTAGAAGGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983666700 4:170191450-170191472 TAGAATTAGGAGAAGAAAAAAGG - Intergenic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984551211 4:181161296-181161318 CAGCATTAGGAAAGCGAGAACGG - Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985288179 4:188358605-188358627 CAGACTTAGAAGAGGAAGAGAGG - Intergenic
985407200 4:189649724-189649746 AAGAAATAGGGAAGGGAGAAAGG + Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985781582 5:1874445-1874467 GAGAAAGAGGAGAGGGAGAGAGG + Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986024336 5:3836118-3836140 CAGGATTTGGTGAGGAAGAAGGG + Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
987228744 5:15870399-15870421 GAGCATTTGAAGAGGGAGAATGG + Intronic
987567092 5:19603343-19603365 GAGACTCAGGAGAGGGAAAATGG + Intronic
988426620 5:31072690-31072712 CAGAAATAGGAGAAGAAGAAGGG - Intergenic
988456978 5:31395302-31395324 TAGAATTGGGAGAAGGAAAAAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988906741 5:35798317-35798339 CAGAATTGGCAAAGGGAGCATGG - Intronic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989997194 5:50849802-50849824 CAGCATTAAGAGAGGGCAAAGGG - Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991026053 5:62030971-62030993 CAGAGATAGGATAGGGATAATGG - Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991562809 5:67972418-67972440 CAGGAGTAGGAGAGAGAGAGAGG - Intergenic
991613997 5:68477096-68477118 CATAGGGAGGAGAGGGAGAAAGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
992688735 5:79222805-79222827 GTGAATTAGCAAAGGGAGAAAGG + Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993111600 5:83663632-83663654 CAGATTTGGGCGAGGGAGGAGGG - Intronic
993137163 5:83983942-83983964 CAGAATCAGGAGACTAAGAAGGG + Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995645172 5:114303728-114303750 CAGATTTGAGAGAGGTAGAATGG + Intergenic
995674075 5:114642689-114642711 CAAAATCAGCAAAGGGAGAATGG - Intergenic
995800062 5:115984274-115984296 TAGAATTAGGTGGGAGAGAAAGG + Intronic
995803084 5:116020801-116020823 GAGAAGAAGGAGAGGCAGAAAGG + Intronic
995836514 5:116405293-116405315 GAGCAGTAGGGGAGGGAGAATGG + Intronic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
997760376 5:136442162-136442184 TAGAATTAGGAAAAGGACAAAGG - Intergenic
998072465 5:139208783-139208805 CAGAATGTGGAAAGGGAGAGGGG + Intronic
998472791 5:142396326-142396348 CTGAAATAGGAGAGGCAGAAGGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998657773 5:144201313-144201335 CAGGATTTGGTGAGGGAGATGGG - Intronic
999305258 5:150515482-150515504 GAGACTTAGGAGTGGGAGAGGGG + Intronic
999310663 5:150549661-150549683 CAGAATCTGGAAAGGGAGAAAGG - Exonic
999360064 5:150976695-150976717 CAGAATTAAGAAAGTGAGAAGGG + Intergenic
999461600 5:151761436-151761458 CAGGCTTGGGAGAGGGAGCATGG + Intronic
999479581 5:151935067-151935089 CAGAATTGGGAGTTGGAGAGAGG + Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1000067641 5:157708872-157708894 AAGGATGAGAAGAGGGAGAAAGG + Intergenic
1000143857 5:158433742-158433764 AAGAGAAAGGAGAGGGAGAAAGG - Intergenic
1000480836 5:161771875-161771897 CAAAATTAGGAGCTAGAGAAGGG - Intergenic
1001228277 5:169964017-169964039 CAGGATTGGGGGAGGGAGAAGGG + Intronic
1001645968 5:173282662-173282684 AAGAAGAGGGAGAGGGAGAATGG + Intergenic
1002172007 5:177380251-177380273 AAGAAAGAGGAGAGAGAGAAAGG - Intronic
1003038022 6:2662028-2662050 CTAAATTAGGAGTGGGAGAGAGG + Intergenic
1003246504 6:4386533-4386555 TAAAATTAGGAGAGGAAGAAAGG + Intergenic
1003273229 6:4625367-4625389 CAGACTTGGGAGGAGGAGAACGG + Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003608501 6:7587448-7587470 CCAAATTAGGAGAGGGAGTAAGG - Intergenic
1003778313 6:9394604-9394626 GAGAAACAGGAGAGGGAGCATGG + Intergenic
1004046662 6:12031629-12031651 CAGAACTGGGATAGGGAGACAGG + Intronic
1005078149 6:21928774-21928796 CAGAATGAGGAGAGGTAAAATGG - Intergenic
1005238257 6:23791542-23791564 CACACCTAGGAGAGAGAGAAAGG + Intergenic
1005323330 6:24676975-24676997 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1005348712 6:24913732-24913754 CAGCATTATAAGAGAGAGAATGG - Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007065554 6:38987299-38987321 AAGAAGTAGAAGAGGAAGAAAGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007434184 6:41796786-41796808 CAAAATCAGGAGATGAAGAAAGG + Intronic
1008581993 6:52915904-52915926 TAGCATTAGAAGAAGGAGAAAGG - Intergenic
1008856568 6:56095397-56095419 CAGAGTTGGGAGGGGGAGAGTGG - Intronic
1009545115 6:65010716-65010738 TAAAATTAGGAGAAGGAAAAAGG + Intronic
1010034404 6:71307165-71307187 TAGAGTTCAGAGAGGGAGAAGGG + Exonic
1010136114 6:72555255-72555277 CCGACTGAAGAGAGGGAGAAAGG - Intergenic
1010631522 6:78204569-78204591 CTTAAGTAGGAGAGGGAAAAAGG - Intergenic
1010749570 6:79602970-79602992 GAAAAATGGGAGAGGGAGAAGGG + Intergenic
1010809396 6:80281743-80281765 GAGAATGAGGACAGGGAGAGGGG - Intronic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011160835 6:84388649-84388671 ATGAATTAGGAGGGGAAGAAGGG + Intergenic
1011189452 6:84714481-84714503 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1011539526 6:88415412-88415434 TAGAATTAGGAGAAGGGAAAAGG - Intergenic
1012061041 6:94481491-94481513 AAGAAAAAGGAGAGGAAGAAAGG - Intergenic
1013301075 6:108805376-108805398 CAGATTTTGCATAGGGAGAAGGG + Intergenic
1013322280 6:109005910-109005932 CAGAAGTAGCAGAGGAAGAGAGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013691917 6:112655320-112655342 CAGAAATAGAAATGGGAGAATGG - Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015177124 6:130322189-130322211 CAGAATTGGGACAGGGACAGAGG + Intronic
1015270177 6:131329661-131329683 AAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016381984 6:143493654-143493676 CAGAGATTGGAGAGGGAGCATGG - Intergenic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016674872 6:146752242-146752264 CAGGAGTAAGAGAGAGAGAAAGG + Intronic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1017807548 6:157958798-157958820 CAGAAATAAAGGAGGGAGAAAGG - Intergenic
1018297815 6:162368002-162368024 CAGAAGCAGGAGAGAGGGAAGGG + Intronic
1018628461 6:165802780-165802802 TAGAATTTGGATAGGGAGAGGGG - Intronic
1018751030 6:166806168-166806190 CAGAATGGGGAAAGAGAGAAAGG + Intronic
1018761380 6:166897005-166897027 TAGAATTGGGAGAAGGAAAAAGG + Intronic
1018855806 6:167674052-167674074 CAGAATGAGGACAGGGACCATGG - Intergenic
1019108751 6:169692370-169692392 CAGAATCAGGAGTGGGTAAAAGG + Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021853059 7:24827360-24827382 CAGCATTGGGAGAGGGAAAGAGG + Intronic
1021901706 7:25291888-25291910 GAGAAAGAGGAGAGGAAGAATGG + Intergenic
1022508292 7:30920394-30920416 CAGAGTTAGGACAGGCTGAATGG - Intronic
1022518749 7:30992334-30992356 GACCATAAGGAGAGGGAGAATGG - Intronic
1022995142 7:35747617-35747639 TAGAATTAAGAGAGAGACAAGGG + Intergenic
1023032931 7:36106896-36106918 TAGATTAAGGATAGGGAGAAGGG + Intergenic
1023396941 7:39760103-39760125 AGAACTTAGGAGAGGGAGAAGGG - Intergenic
1023439194 7:40169141-40169163 TATAATTAGGAGAAGGAAAAAGG - Intronic
1023738867 7:43259860-43259882 TAGAATAATGAGAGAGAGAATGG + Intronic
1024485230 7:49910138-49910160 CAGAGTTCAGGGAGGGAGAAGGG + Intronic
1025148986 7:56531693-56531715 CAGAAGTTTGAGAGGAAGAAGGG + Intergenic
1026451022 7:70529730-70529752 CAGAATTTGGAGAGGAACAATGG + Intronic
1027537710 7:79426327-79426349 AACAAGTAGGAGAAGGAGAAAGG - Intronic
1028588247 7:92471887-92471909 TAGAATTAGGAGAAGAAAAAAGG - Intronic
1029361350 7:100090528-100090550 GAGAATGAGGGGAAGGAGAAAGG + Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030614330 7:111722562-111722584 GAGAGTGAGGGGAGGGAGAATGG + Intergenic
1030794347 7:113769871-113769893 CAGGAGTAGGAGATAGAGAAAGG - Intergenic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030859459 7:114606579-114606601 AAGAATGAGGAGAGGGCAAAAGG - Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031264893 7:119569589-119569611 TAAAATTAGGAGAAGGAAAAAGG + Intergenic
1031471640 7:122174758-122174780 TAGAATTAGGAGAAAGAAAAAGG + Intergenic
1031551840 7:123124168-123124190 AAGAATGAGGGGAGAGAGAAAGG + Intronic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031770926 7:125841354-125841376 CAGAAAGTGGAGAGTGAGAATGG + Intergenic
1031970405 7:128060999-128061021 CAGAATTGGGAGGTGGAGCAGGG + Intronic
1031987017 7:128169781-128169803 CAGAAGTAGGATAGGCAGGATGG - Intergenic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032505476 7:132431320-132431342 CAGGATTGGGAGGGGGAGAGGGG - Intronic
1032725941 7:134590205-134590227 TAGAATTAGGAGAAGAAAAAAGG + Intergenic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1033615764 7:143012755-143012777 AGGAAGAAGGAGAGGGAGAATGG + Intergenic
1034465668 7:151227085-151227107 GAGAATTAGAAGAGGAAGCAGGG - Intronic
1034882268 7:154771699-154771721 CAGAATTGGAAAAGGCAGAAAGG - Intronic
1034976249 7:155450573-155450595 GAGAGTTAGGAGAGGGGGAGAGG + Intergenic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037340131 8:17835541-17835563 AAGAACCTGGAGAGGGAGAAAGG - Intergenic
1037497022 8:19450148-19450170 GAGGAGGAGGAGAGGGAGAAGGG + Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038167404 8:25099126-25099148 CAGGATTTGGAGAGGTAGACTGG + Intergenic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040527421 8:48237168-48237190 TAGAATTAGGAGAATGAAAATGG - Intergenic
1040680275 8:49800877-49800899 CAGAAAGAGGAGTGGGAGAAAGG - Intergenic
1040871665 8:52106030-52106052 CAAAATCAGGAAAGGAAGAATGG - Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041383935 8:57279422-57279444 CAGCTTCAGGAGAGTGAGAAAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041605487 8:59778309-59778331 GAGAAGGAGGAGAGGGAAAATGG - Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041846977 8:62340465-62340487 GTGAAATAGGAGAAGGAGAAAGG + Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1043188817 8:77190661-77190683 CAGAAGTAAGAAATGGAGAAAGG + Intergenic
1043665354 8:82803950-82803972 GAGAATTAGGGGATTGAGAATGG + Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044518016 8:93162317-93162339 CAGAATAAGGATATGAAGAATGG + Intronic
1045733963 8:105273806-105273828 GTGGATTAGGAGAGGGATAAAGG + Intronic
1045745013 8:105408171-105408193 GAGAATTAGGAGAGCGGGTAGGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1047124075 8:121940791-121940813 CAAAAACAGGAGAGAGAGAAAGG - Intergenic
1047979006 8:130160380-130160402 CAGAATGTGTAAAGGGAGAAAGG - Intronic
1048069434 8:131005999-131006021 GAGAATTTGGAGTGGGAGCAGGG - Intronic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048788376 8:138076538-138076560 CAGAACTAGGATAAGGTGAAAGG - Intergenic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049252844 8:141598385-141598407 CTGAATTAGGAGGCGGAGATGGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050267780 9:3908851-3908873 AATAATTAGGAAAGGGAAAAAGG + Intronic
1050276713 9:4008378-4008400 CAGAATGAGGGCAGGGAAAATGG - Intronic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1050876205 9:10640065-10640087 CAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1051155361 9:14138085-14138107 CATAAGTAGCAGAGGTAGAATGG - Intronic
1052046187 9:23796956-23796978 AAGAATGAGGACAGGGACAATGG + Intronic
1052528884 9:29656495-29656517 TACAATTAGGAGAAGGAAAAAGG - Intergenic
1053033431 9:34802973-34802995 CACAAGTAGGTGAGGGAGCAAGG - Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1053134529 9:35641973-35641995 TAGAATTAGGAGAAGGGAAAAGG - Intronic
1053308224 9:36999174-36999196 CAGGATTTGGAAAGGGAGAGAGG - Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053470867 9:38345495-38345517 CAGATTTGGGAAGGGGAGAAGGG - Intergenic
1053791639 9:41690490-41690512 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054153519 9:61624280-61624302 CTGATTTAGCAGAGGGTGAAGGG - Intergenic
1054180042 9:61902505-61902527 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054657551 9:67678636-67678658 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1055288877 9:74761771-74761793 CAGAAATAGGGCAGGGAGCATGG - Exonic
1056377141 9:86025563-86025585 ACGAAGTAGGAGAGGCAGAAGGG - Intergenic
1056396319 9:86184546-86184568 CATAATTTGGACAGAGAGAAAGG + Intergenic
1056560402 9:87724753-87724775 CTGAGCTAGGAGAGGGGGAATGG + Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1058028911 9:100174491-100174513 CAAAGATAGGAGAGAGAGAATGG + Intronic
1058262817 9:102857837-102857859 GAGAAAGAGGAGAGAGAGAATGG - Intergenic
1058375307 9:104316081-104316103 CGGTAATGGGAGAGGGAGAAGGG - Intergenic
1058455577 9:105135027-105135049 TTGAATTTGGAGAGGTAGAAAGG + Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1059055051 9:110970663-110970685 GAGAAGGAGGAGAGGGAAAAAGG - Intronic
1059548054 9:115198936-115198958 CAGAATTAGGGGAGCTACAAAGG - Intronic
1059838156 9:118180673-118180695 AAAAATTAGCAGAGGGATAAAGG - Intergenic
1059935365 9:119304875-119304897 CAGCCTGAGGAGTGGGAGAAAGG - Intronic
1059961642 9:119570759-119570781 TAGAATTTGGACAAGGAGAATGG + Intergenic
1060502475 9:124171663-124171685 CAGAAGTAGAAGAGAGAGAGAGG - Intergenic
1061745086 9:132733765-132733787 CAGAGCCAGGAAAGGGAGAAAGG + Intronic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1203658210 Un_KI270753v1:18818-18840 AAGAAATAGGGAAGGGAGAAAGG + Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1186139783 X:6559420-6559442 TAGAATAAGGAGAGTGTGAAGGG + Intergenic
1186512557 X:10140940-10140962 CAGAGCTAGGGGAGGGAGAACGG - Intronic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186788714 X:12976119-12976141 CAGCAGTAGGAGAGCGAGAAGGG + Exonic
1187547350 X:20266903-20266925 CGGAAGGAGGAGAGGAAGAAAGG - Intronic
1187926380 X:24254165-24254187 AAGAGATAGGAGAGGGAGGAAGG - Intergenic
1188195180 X:27224204-27224226 AATGATTAGGAGAGGGATAAGGG - Intergenic
1189067384 X:37824807-37824829 AAGAAATAGGAGAGGGAGATTGG - Intronic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189347021 X:40249476-40249498 GAGAATTAGGAAAGGTAAAAGGG - Intergenic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1191895421 X:65987438-65987460 AAAAATGAGGAGGGGGAGAAAGG + Intergenic
1191924873 X:66298305-66298327 TAGAATTAGGAGAACGAAAAAGG - Intergenic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192400752 X:70832683-70832705 CTGAAATAGGAGAGAAAGAATGG + Intronic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1194128085 X:90045023-90045045 GAGAATTAGGGGCGGGAGACAGG + Intergenic
1194399192 X:93421953-93421975 CAGACTTGGGATAGGGAGAAGGG - Intergenic
1194725897 X:97396841-97396863 CACACATAAGAGAGGGAGAAAGG - Intronic
1194771960 X:97916780-97916802 CTGAATAATGACAGGGAGAATGG + Intergenic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1195565393 X:106333855-106333877 GAGAAATAGCAGAGGCAGAAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196386908 X:115165404-115165426 AAGAATTAGGAGATGAAAAAAGG - Exonic
1196417203 X:115484081-115484103 AAGAAAAAGGAGAGGGGGAAGGG + Intergenic
1196596480 X:117551614-117551636 AGGAAATAGGTGAGGGAGAAGGG + Intergenic
1196764796 X:119233483-119233505 GGGAACTTGGAGAGGGAGAAAGG + Intergenic
1196773374 X:119317870-119317892 GAGAGTCAGGAAAGGGAGAAAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1197980173 X:132209908-132209930 GAGAATTAGGAGTAGTAGAAAGG + Intronic
1198116474 X:133549665-133549687 GAGAAAGAAGAGAGGGAGAAGGG - Intronic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199520460 X:148729499-148729521 TAGATTTGTGAGAGGGAGAATGG + Intronic
1199860751 X:151798743-151798765 TGGAATTAGGAGGGAGAGAAAGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic