ID: 1111781352

View in Genome Browser
Species Human (GRCh38)
Location 13:92729813-92729835
Sequence GAAAACAAGGTGCCACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111781352_1111781354 24 Left 1111781352 13:92729813-92729835 CCAGTGTGTGGCACCTTGTTTTC 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1111781354 13:92729860-92729882 AATTATTGTTTCTGTTAAAATGG 0: 1
1: 0
2: 6
3: 85
4: 795
1111781352_1111781355 28 Left 1111781352 13:92729813-92729835 CCAGTGTGTGGCACCTTGTTTTC 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1111781355 13:92729864-92729886 ATTGTTTCTGTTAAAATGGTTGG 0: 1
1: 0
2: 5
3: 35
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111781352 Original CRISPR GAAAACAAGGTGCCACACAC TGG (reversed) Intronic
900003857 1:31112-31134 CAAAACAAAATACCACACACTGG - Intergenic
900023579 1:201632-201654 CAAAACAAAATACCACACACTGG - Intergenic
900923843 1:5690817-5690839 CATCACAAGGTGCCACACACTGG - Intergenic
901508540 1:9701967-9701989 AAAAACAAGATGCTACAGACAGG - Intronic
902673983 1:17995623-17995645 CATAACAAAGTGCCACACCCTGG + Intergenic
907830657 1:58061272-58061294 TGAAACAAAGTGCCACAAACCGG + Intronic
908310866 1:62881505-62881527 GGAAACAAGATGCCAGACAATGG - Intergenic
908609273 1:65837907-65837929 GGGAACAAGGTAACACACACTGG - Intronic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
909491923 1:76235694-76235716 GGTAACAAGGTGCCACAAACTGG + Intronic
910552368 1:88490143-88490165 CATAACAAAGTGCCACAAACTGG - Intergenic
910815302 1:91286255-91286277 TATAACAAAGTACCACACACTGG + Intronic
914013589 1:143797402-143797424 AAAAAAAAGTAGCCACACACTGG - Intergenic
914652213 1:149706011-149706033 AAAAAAAAGTAGCCACACACTGG - Intergenic
920197872 1:204241587-204241609 CAAAACCTGGTGCCACACCCTGG - Intronic
923070268 1:230558057-230558079 CATAACACGGTACCACACACTGG + Intergenic
923604682 1:235432482-235432504 GACAAGAAGGGGCCAGACACTGG + Intronic
1062991004 10:1817838-1817860 TATAACAAAGTGCCACAAACTGG + Intergenic
1063209336 10:3864607-3864629 CATAACAAAGTGCCACAGACAGG - Intergenic
1063799240 10:9554077-9554099 GATAACATGGTGCCACACTGGGG + Intergenic
1067427490 10:46220954-46220976 CAAAACAAAGTCCCACACACTGG - Intergenic
1068773191 10:60845039-60845061 TATAACAAAGTGCCACAGACTGG + Intergenic
1068828465 10:61466185-61466207 CATAACAAGGTACCACAGACTGG - Intergenic
1069177188 10:65306704-65306726 GAAAACAATGTGGTATACACAGG - Intergenic
1069533291 10:69234540-69234562 GAAAACAAGGTGGGACACAATGG - Intronic
1070643292 10:78184310-78184332 CATAACAAGATGCCACAAACTGG - Intergenic
1070799588 10:79237393-79237415 CATAACAAAGTGCCACACAGCGG + Intronic
1073682429 10:105718819-105718841 GAAAACATGGTGCCCCAGATGGG - Intergenic
1074094579 10:110299438-110299460 GAAAAAAAGGTAACACACAAAGG + Intronic
1074181402 10:111068036-111068058 CATAACAAAGTACCACACACTGG - Intergenic
1074227811 10:111504737-111504759 CATAACAAAGTGCCACAGACTGG + Intergenic
1074327521 10:112466768-112466790 GACAACAAAGTACCACAGACTGG + Intronic
1074517317 10:114182134-114182156 GAATACAAGATTCCAGACACGGG - Intronic
1074643634 10:115418065-115418087 CAAAATAAGGTGCCAGAGACTGG + Intronic
1074915345 10:117950119-117950141 TATAACAAAGTGCCACACACTGG - Intergenic
1074969199 10:118521713-118521735 GGCTACAATGTGCCACACACTGG + Intergenic
1075425232 10:122337012-122337034 GAAATTAATGTGCCACTCACAGG - Intronic
1076917012 10:133428436-133428458 CATAACAAAGTGCCACAGACAGG - Intergenic
1076937111 10:133573241-133573263 CATAACAAAGTGCCACAGACAGG - Intergenic
1078255784 11:9657701-9657723 CATAACAAGGTACCACAAACAGG + Intergenic
1078918974 11:15809154-15809176 TAAAACAAGGTATCACAGACTGG + Intergenic
1079260573 11:18875378-18875400 CACAACAAGGTACCACAAACTGG - Intergenic
1080116702 11:28629615-28629637 AATAACAAGGTACCACATACTGG + Intergenic
1080450472 11:32374878-32374900 GAAGGCATGGTGCCACCCACTGG - Intergenic
1081486260 11:43531989-43532011 CATAACAAGGTGCCATAAACTGG - Intergenic
1082755520 11:57072185-57072207 CATAACAAAGTACCACACACTGG + Intergenic
1083039503 11:59671914-59671936 GAAAACAAAGTGTCATAGACAGG + Intergenic
1083055948 11:59819912-59819934 CAAAACAAAGTACCACACACTGG + Intergenic
1083082678 11:60110240-60110262 GATAACAAAGTACCACAGACTGG - Intergenic
1083757101 11:64797487-64797509 GAATTCCAGGTGCCACACAGAGG - Exonic
1083983697 11:66195261-66195283 GAATATAAGGTGGGACACACAGG - Intronic
1086050518 11:82583732-82583754 CAAAACACAGTGCCAGACACAGG + Intergenic
1087132888 11:94684123-94684145 CATAACAAAGTGCCACAAACTGG + Intergenic
1087570489 11:99921145-99921167 CATAACAACGTGCCACAGACTGG - Intronic
1088073642 11:105820185-105820207 GGAAACAAAGTGCCACAGATTGG - Intronic
1088838023 11:113595292-113595314 TATAACAATGTGCCACAAACTGG + Intergenic
1089576752 11:119449934-119449956 CATAACAAAGTACCACACACTGG - Intergenic
1090024044 11:123152688-123152710 CAAAACAAAGTACCACAGACTGG - Intronic
1090237752 11:125161868-125161890 CACAACAAAATGCCACACACTGG - Intergenic
1090721303 11:129475813-129475835 GAAAAAGAAATGCCACACACTGG - Intergenic
1091377276 12:33166-33188 CAAAACAAAATACCACACACTGG - Intergenic
1095120236 12:38408533-38408555 CATAACAAGGTACCACAGACTGG - Intergenic
1095345698 12:41146776-41146798 TGTAACAAGGTGCCACAAACTGG - Intergenic
1095515613 12:43002279-43002301 TATAACAAAGTGCCACAGACTGG + Intergenic
1097232163 12:57519613-57519635 GAAAGCCAAGTCCCACACACTGG - Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1099948898 12:89277897-89277919 TATAACAAGGTGCCACAGACTGG - Intergenic
1100382293 12:94073154-94073176 GAACACAATGTGCCACCCATTGG - Intergenic
1101196643 12:102390299-102390321 GAAAACGGTGTGACACACACCGG + Intergenic
1101405685 12:104426605-104426627 CAAAACAAGTTACCACAAACTGG - Intergenic
1101602699 12:106224324-106224346 GAAAATCAGGTGCCACTCAGAGG - Intergenic
1101833212 12:108275340-108275362 CAAATCAAAGTGCCACAAACCGG + Intergenic
1101854194 12:108428462-108428484 TATAACAAGTTGCCACAAACTGG - Intergenic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1104170166 12:126272982-126273004 TACAACAAAGTGCCACAAACTGG - Intergenic
1104426545 12:128682736-128682758 CATAACACAGTGCCACACACTGG + Intronic
1104510637 12:129374608-129374630 GGAAACAAGGTGCCACCCAAGGG + Intronic
1104510950 12:129377322-129377344 CAAAACAAAGCACCACACACTGG - Intronic
1104588919 12:130068861-130068883 CATAACAAAGTGCCACAGACTGG + Intergenic
1104650030 12:130524847-130524869 GAAAAGAAGGTGCCACATTCTGG + Intronic
1105743251 13:23351137-23351159 GAAAGCAAGGTGTCACTTACTGG + Intronic
1108435961 13:50401837-50401859 GGAAACAAGGTGCCAAGTACAGG - Intronic
1109679124 13:65724131-65724153 GAAAAGAAGATTCCACACAAAGG + Intergenic
1110098957 13:71571513-71571535 GATAACAATGTGGCACTCACTGG + Intronic
1110550348 13:76805048-76805070 CACAACAAAGTGCCACAAACTGG + Intergenic
1111714085 13:91856147-91856169 GAAAACAATGAACCACACAATGG - Intronic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1113864136 13:113509916-113509938 GAAAACACCGAGGCACACACAGG - Intronic
1114304169 14:21405842-21405864 GAACACAAGGTGCTACTCACAGG - Exonic
1115286335 14:31717074-31717096 AAAAACAAGGTGCCACAAAAGGG - Intronic
1116594155 14:46819178-46819200 TAACACAAGCAGCCACACACTGG + Intergenic
1120486978 14:85126270-85126292 CATAACAATGTGCCACAAACTGG - Intergenic
1121255383 14:92526797-92526819 CATAACAAAGTGCCACAAACTGG + Intronic
1125167996 15:36732355-36732377 GGAATCAAGGTGCAACAAACAGG - Intronic
1125297275 15:38216852-38216874 GAAAACAAGGTAGCACATTCAGG - Intergenic
1127616356 15:60690031-60690053 GGTAACAAAGTGCCACAAACTGG - Intronic
1128781340 15:70360630-70360652 GAAAACATGGGCCCACACAAAGG + Intergenic
1129176390 15:73842570-73842592 CATAACAAAGTACCACACACTGG - Intergenic
1131805343 15:96116154-96116176 GAAAACAAAGTGACAGAAACAGG + Intergenic
1132449646 15:101959824-101959846 CAAAACAAAATACCACACACTGG + Intergenic
1132645778 16:998663-998685 GCACACCAGGTGCCACACAGTGG + Intergenic
1132753498 16:1470493-1470515 GGAAACAAGGTGACACACAAAGG + Intronic
1133509620 16:6444855-6444877 GAGAACAGGGAGTCACACACAGG + Intronic
1133618149 16:7499073-7499095 GAAAACAAAGAACCACAAACTGG + Intronic
1134095755 16:11417413-11417435 CACAACAAAGTCCCACACACTGG - Intronic
1134229056 16:12415168-12415190 GAAAACCAGGACCCACAAACTGG + Intronic
1134425626 16:14141126-14141148 GAAATTACGGTGCAACACACCGG - Intronic
1135224104 16:20640592-20640614 GAAGACAAGGTGCCAGGCATTGG + Intronic
1138366235 16:56479916-56479938 GAGAACAAGCTGCAACCCACAGG - Intronic
1138425712 16:56931055-56931077 CATAACAAAGTGCCACAAACTGG - Intergenic
1139031941 16:62894337-62894359 GAAGACAATGTGCCACAGTCTGG + Intergenic
1139850159 16:69947102-69947124 CCATACAAGGTACCACACACTGG + Intergenic
1139879144 16:70170015-70170037 CCATACAAGGTACCACACACTGG + Intergenic
1139973090 16:70788424-70788446 GAAAGCAAGGGGCAACTCACAGG - Intronic
1140373377 16:74425537-74425559 CCATACAAGGTACCACACACTGG - Intergenic
1140674840 16:77317709-77317731 GAACACAAACTCCCACACACTGG + Intronic
1141314605 16:82950058-82950080 TATAACAAAGTGCCACAAACTGG + Intronic
1141465015 16:84199608-84199630 GAAAACAATGTGTAATACACAGG - Intergenic
1141829326 16:86500849-86500871 GAAAGCAAGGTGCAGCACAGAGG - Intergenic
1141864315 16:86739791-86739813 GAACATAAAGTGCCACAGACCGG + Intergenic
1141896445 16:86961715-86961737 GACAACAAACTGCCACACACTGG + Intergenic
1143363539 17:6390386-6390408 GCACAGAAGCTGCCACACACAGG - Intergenic
1143726531 17:8850830-8850852 GAAAACCATGTGCGACACAGGGG - Intronic
1144016756 17:11203600-11203622 AGAAACAAAGTGCCACCCACTGG + Intergenic
1147568146 17:41550321-41550343 GAAAACAAGGTGCGATGAACTGG + Intergenic
1148097586 17:45063897-45063919 GAAAAAAAAGTGGCACACAGTGG + Intronic
1150285207 17:63950276-63950298 GAAAACAAGGACCCCCACCCCGG - Intronic
1150468516 17:65415814-65415836 GAAAGAAAAGTTCCACACACAGG - Intergenic
1151244379 17:72783285-72783307 TATAACAAAGTGCCATACACTGG - Intronic
1152501508 17:80713392-80713414 GAAAACAAGCAGCCACAAACTGG - Intronic
1153135110 18:1908826-1908848 CACAACAAAGTACCACACACCGG + Intergenic
1155365779 18:25047880-25047902 GGAGACAAGGTGCACCACACAGG + Intergenic
1155722171 18:29029240-29029262 AGAAACAAGCTGCCACATACAGG + Intergenic
1155829447 18:30494141-30494163 AAAAAAAAGGTCCCACAAACTGG + Intergenic
1156368573 18:36451950-36451972 GAAAAAAAGGAGCCACATGCAGG - Intronic
1156609284 18:38707456-38707478 TAAAACAAAATGCCACAGACTGG - Intergenic
1158170637 18:54595548-54595570 CTAAAGAAAGTGCCACACACAGG - Intronic
1158783111 18:60676035-60676057 GAAAACAAGTTGGCAAACTCTGG - Intergenic
1158912485 18:62078993-62079015 GAAAAGAAGGGGCCACAGATAGG - Intronic
1159456805 18:68669541-68669563 CATAACAAAGTGCCACAAACTGG + Intergenic
1160212886 18:76897737-76897759 CCAAACACAGTGCCACACACAGG + Intronic
1160328038 18:77968454-77968476 CATAACAAGGTGCCACAATCTGG - Intergenic
1160463393 18:79056216-79056238 TATAACAAAATGCCACACACTGG - Intergenic
1160635610 19:72721-72743 CAAAACAAAATACCACACACTGG - Intergenic
1161586989 19:5110993-5111015 GAAAACACTGTGCCTCAGACTGG - Intronic
1164608713 19:29617998-29618020 CATAACAAAATGCCACACACTGG + Intergenic
1166476738 19:43133163-43133185 CATAACAAAGTGCCACAGACCGG + Intronic
1166480772 19:43171264-43171286 TGAAACAAGATGCCACACAGAGG - Intronic
928172120 2:29010584-29010606 GAACACAATATCCCACACACTGG - Intronic
928580971 2:32707169-32707191 GATAACAGGGTACCACAGACTGG + Intronic
928997688 2:37311681-37311703 GAAAATAAGATGGCACTCACGGG + Intronic
931083368 2:58801116-58801138 TAACACAAGGTGCAACACAATGG + Intergenic
931932600 2:67156995-67157017 AAAAAGATGGTGCCACACAGTGG - Intergenic
933087121 2:78067981-78068003 GAAAACCTGATGCCTCACACGGG + Intergenic
933481759 2:82867060-82867082 TATAACAAAGTGCCACAAACTGG + Intergenic
934677022 2:96256830-96256852 TAAAACAAGGTTCCAAAAACTGG + Intronic
934714866 2:96537572-96537594 GAAGACAAGGGGACACACAAGGG - Intronic
935607429 2:104984868-104984890 GATAACAAGGTGCCAGAGCCTGG - Intergenic
936565872 2:113582327-113582349 CAAAACAAAATACCACACACTGG + Intergenic
938140747 2:128793035-128793057 GCACACACAGTGCCACACACAGG + Intergenic
940292814 2:152094271-152094293 GACAACAACCTGCCACACAGAGG + Intronic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942188277 2:173445482-173445504 CATAACAAAGTGCCACAAACTGG + Intergenic
942270456 2:174269056-174269078 AATAACAAAGTGCCACAGACTGG - Intergenic
942413528 2:175735477-175735499 GCAGGCAAGGTGCTACACACAGG + Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
944114612 2:196172820-196172842 GAAAATAAAATGCCACACACTGG + Intronic
944386365 2:199169486-199169508 GAAAATAGGATGCCACACAAAGG + Intergenic
944427283 2:199596404-199596426 TATAACAAACTGCCACACACTGG - Intergenic
945700239 2:213160617-213160639 GAGAACAAGGTGCCAGAATCCGG + Intergenic
945749281 2:213760738-213760760 TATAACAAAATGCCACACACTGG + Intronic
946451714 2:219785571-219785593 CACTACAAGGTACCACACACTGG - Intergenic
946499903 2:220236461-220236483 CAAAACAAAGTACCACATACTGG + Intergenic
947142343 2:227031159-227031181 GAAAACAAGTTCCCACAAATAGG + Intronic
947472863 2:230414297-230414319 GAAAACAATGTCAGACACACTGG - Intergenic
948398045 2:237661976-237661998 CATAACAAAGTGCCACAAACTGG + Intronic
948590101 2:239043931-239043953 GAGAAGAAGGTGGTACACACAGG - Intergenic
949049103 2:241887758-241887780 GTTAACAAGGTACCACAAACCGG + Intergenic
949078944 2:242081012-242081034 GAAAGAGAGGTGCAACACACGGG - Intergenic
1169309826 20:4526227-4526249 TAGAACAAAGTGCCATACACTGG - Intergenic
1170044655 20:12072451-12072473 TAAAACAAAGTACCACAAACTGG - Intergenic
1170861108 20:20104693-20104715 CATAACAAAGTGCCACAGACTGG + Intronic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1171495781 20:25554180-25554202 CTAAACAAGGAGCCACACAGCGG + Intronic
1173422310 20:42913196-42913218 TATAACAAAGTGCCACAGACTGG + Intronic
1173572238 20:44084966-44084988 CATAACAAGGTACCACAAACTGG - Intergenic
1173968645 20:47133256-47133278 GAAAAAAAGGTGCCTCTCCCAGG + Intronic
1174459914 20:50675076-50675098 TAAAACAAGATGGGACACACAGG + Intronic
1177603826 21:23353545-23353567 GAAAACAAAGTGTCACTCACAGG + Intergenic
1178162046 21:29928993-29929015 ACAAACAAAGTTCCACACACTGG + Intronic
1179119259 21:38527915-38527937 CATAACAAAGTGCCACACCCTGG + Intronic
1179372076 21:40815617-40815639 GAAAACAAGGAAGCACACCCTGG - Intronic
1179461619 21:41539173-41539195 GAAAACAAGAAGACACAGACTGG + Intergenic
1179466251 21:41575908-41575930 GAAAACATGGGGACACATACAGG + Intergenic
1179895030 21:44357017-44357039 TAAAACAGGGTGCAAGACACTGG - Intronic
1180920169 22:19517546-19517568 CATAACAAAGTGCCACAGACAGG + Intronic
1181615242 22:24049769-24049791 GAAGACAGGATGCCACACAATGG - Intronic
1184411779 22:44330349-44330371 GAACACGAAGTGCCCCACACAGG - Intergenic
1184437327 22:44487257-44487279 TATAACAAGGTACCACAGACTGG + Intergenic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
949955913 3:9268497-9268519 TAAAACAAGATGCCATAGACTGG - Intronic
950141146 3:10616467-10616489 CATAACAAAGTGCCACAGACTGG - Intronic
950914603 3:16631898-16631920 GAAAAAAAGTGGCCCCACACAGG - Intronic
951067613 3:18285398-18285420 GAGAACAAGATTCCAGACACAGG - Intronic
951166683 3:19490581-19490603 GACAACCCGGTGCCACACCCTGG - Intronic
953363336 3:42320413-42320435 TGTAACAAGGTACCACACACTGG - Intergenic
953717637 3:45329648-45329670 CAAAACAAAGAACCACACACTGG - Intergenic
955497121 3:59545304-59545326 GGTAACAAAGTGCCACAAACTGG - Intergenic
955803083 3:62706095-62706117 GAAAAGCAGCTGCCACACTCTGG - Intronic
956525827 3:70159369-70159391 GAAAACAGGTGTCCACACACAGG - Intergenic
956942400 3:74178806-74178828 GAATACAAGTTGCCACAGATAGG + Intergenic
957432170 3:80124580-80124602 GAAGACACAGAGCCACACACGGG - Intergenic
958800005 3:98744282-98744304 TGAAACAAAGTGCCACATACTGG - Intronic
958999770 3:100949829-100949851 GAACATAATGGGCCACACACAGG + Intronic
959498331 3:107076691-107076713 CATAACAAAGTGCCACAGACTGG + Intergenic
961320168 3:126067621-126067643 CATAACAAAGTCCCACACACTGG - Intronic
961557893 3:127709206-127709228 AAAGACCAGGGGCCACACACTGG + Intronic
962176079 3:133156839-133156861 GAAAACAATGATTCACACACAGG - Intronic
962844568 3:139263256-139263278 GAAAAGCATGTGCCTCACACTGG + Intronic
962868241 3:139465702-139465724 GAAAACAAACTGCCTCAAACAGG - Intronic
964293552 3:155208720-155208742 AATAACAAAGTGCCACAGACTGG - Intergenic
965019487 3:163209911-163209933 CCAAACATGGTGGCACACACTGG + Intergenic
965609495 3:170529824-170529846 GTAAACAAAGTCACACACACAGG + Intronic
966733102 3:183167059-183167081 CATAACAAAGTGCCACAGACTGG + Intergenic
967906896 3:194508993-194509015 CAGAACAAGGTGACACCCACTGG - Intergenic
968280116 3:197470805-197470827 CAAAACAAAGTGCCACAAATTGG + Intergenic
969910836 4:10444182-10444204 GAAATCAACGTGTCACTCACTGG - Exonic
969986041 4:11211952-11211974 CATAACAACGTGCCACAGACTGG - Intergenic
972370985 4:38423221-38423243 CATAACAAGGTACCACACAGTGG + Intergenic
973004486 4:44990899-44990921 AAAAAACAGTTGCCACACACAGG - Intergenic
973333479 4:48933190-48933212 GAAGACAAGGTGGCACTCACAGG - Intergenic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
975350074 4:73336002-73336024 GAAAAGAAGGTGGAACACACAGG + Intergenic
976488688 4:85641356-85641378 CATAACAAGGTACCACAGACAGG + Intronic
977399814 4:96518733-96518755 CTTAACAAGGTGCCACAGACTGG + Intergenic
979119270 4:116874338-116874360 GATGACCAGGTGTCACACACTGG + Intergenic
980876439 4:138666797-138666819 CAAAACAAAGTACCACAGACTGG + Intergenic
981220679 4:142229995-142230017 GAAACCAAGGTACCACTAACTGG + Intronic
983202314 4:164874210-164874232 TATAACAAAGTGCCACAGACTGG + Intergenic
985045163 4:185933382-185933404 GATAACAAAGTACCACAGACAGG + Intronic
985882320 5:2647734-2647756 AAAAACATGGTGCAACAGACAGG - Intergenic
986215999 5:5719805-5719827 GATAACAAAGTGCCACAGGCCGG + Intergenic
986576450 5:9218260-9218282 TAAAACAAAGTACCACAAACAGG - Intronic
986710782 5:10486668-10486690 GGGAACAAACTGCCACACACAGG - Intergenic
987324280 5:16798210-16798232 CAAAACAGGATACCACACACTGG - Intronic
987617273 5:20292540-20292562 TAAAACAAGGAACCACAAACTGG + Intronic
988181339 5:27797693-27797715 AAAAATAAGGTGCCAGAGACTGG + Intergenic
988455900 5:31386950-31386972 GAATATAAGGTGCCATACAGAGG - Intergenic
989073691 5:37539568-37539590 CACAACAAAGTGCCACAGACTGG - Intronic
989507386 5:42243216-42243238 GAAAAAAAGGAGCCAAACCCAGG + Intergenic
989625341 5:43424373-43424395 GAAAACAAGATGCAAAACAGTGG + Intergenic
990057707 5:51604804-51604826 TAAAACAAAGTGCCACAAAGAGG - Intergenic
990115516 5:52385623-52385645 GAACACAAGCTTCCACACCCTGG + Intergenic
990382114 5:55228240-55228262 GAAAACAAGGTGCCCAACATAGG - Intergenic
991292907 5:65050133-65050155 CAAAATAAAGTGCCACAAACTGG + Intergenic
992382122 5:76248216-76248238 CATAACAAAGTGCCACAGACTGG + Intronic
995356028 5:111238573-111238595 GGTAACAAAGTGCCACAGACTGG - Intronic
995400807 5:111739058-111739080 CATAACAAAGTGCCACAGACTGG - Intronic
995403030 5:111762765-111762787 GATAACAAAGTACCACAGACCGG - Intronic
995474280 5:112532291-112532313 GACAACCCGGTGCCACACCCTGG + Intergenic
997290923 5:132734379-132734401 GAAATCAATGTGCTACAAACAGG - Exonic
997387405 5:133484112-133484134 GCAGAGAAGGTGCCACACCCAGG - Intronic
998340947 5:141417686-141417708 GAAAACCAGCTCCCACACAGAGG + Exonic
998522489 5:142813507-142813529 CATAACAAGGTCCCACAGACAGG + Intronic
999032739 5:148312321-148312343 CAAAGCACGGTGCCACACCCTGG - Intergenic
1000810839 5:165858792-165858814 GTAAACAAAGTGCTACAAACAGG + Intergenic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1001288504 5:170440265-170440287 TATAATAAGGTGCCACAGACTGG - Intronic
1001657324 5:173361687-173361709 CATAACAAAGTGCCACAGACTGG + Intergenic
1002613922 5:180438633-180438655 GAACAGCAGGGGCCACACACTGG - Intergenic
1002692974 5:181063660-181063682 TGTAACAAGATGCCACACACGGG + Intergenic
1003393779 6:5735814-5735836 CAAAGCACGGTGCCACAGACAGG - Intronic
1003614078 6:7639626-7639648 TATAACAAAGTGCCACAGACTGG + Intergenic
1003640366 6:7870524-7870546 GAAAAGAAGGTGGCAGAGACAGG - Intronic
1006039325 6:31240928-31240950 CATAACAAAGTACCACACACTGG + Intergenic
1007309188 6:40931918-40931940 TATAACAAAGTGCCACAGACTGG - Intergenic
1007839968 6:44708061-44708083 CATAACAAAATGCCACACACTGG + Intergenic
1008428944 6:51392277-51392299 AAAAAGCAGGTGTCACACACAGG + Intergenic
1008677421 6:53834817-53834839 CAAAAAATGGTGGCACACACCGG + Intronic
1011790422 6:90893001-90893023 CATAACAAGGTGCCACAGATGGG + Intergenic
1012073054 6:94647634-94647656 GAAAACAAAGTACCACAAATTGG + Intergenic
1012841797 6:104338062-104338084 TAAGACACGGTGCCAAACACTGG + Intergenic
1013387064 6:109642238-109642260 CATAACAAAGTGCCACAAACTGG - Intronic
1013598394 6:111681853-111681875 GAAAGCAATGTGCCAAACAAAGG + Intronic
1013611684 6:111801909-111801931 CTAAACAAGGTGCAAGACACTGG + Intronic
1013863695 6:114667489-114667511 GACAACACGGTGGCACACAATGG - Intergenic
1014635505 6:123842208-123842230 CAAAACAAAATACCACACACTGG + Intronic
1015393752 6:132712657-132712679 GAAAAAGAGGAGCCACAAACTGG + Intronic
1015975455 6:138786006-138786028 CAAAACAAAGTACCACAGACTGG + Intronic
1016231459 6:141810299-141810321 CATAACTAAGTGCCACACACTGG - Intergenic
1017229611 6:152058656-152058678 GAAAGCCAGGTGCAAGACACAGG - Intronic
1017602433 6:156098248-156098270 CATAACAAGGTACCACAGACTGG - Intergenic
1021972629 7:25980746-25980768 CAAAACAAAGTGCCACAGACTGG - Intergenic
1023475334 7:40572064-40572086 GGAAACAAGATGCCACATTCGGG - Intronic
1023624315 7:42100982-42101004 CAGAACAAGGTACCACAGACTGG - Intronic
1024241367 7:47438942-47438964 GAAAACAAGGGGCCAATCAGAGG + Intronic
1024572301 7:50733345-50733367 CATAACAAAGTGCCACAGACTGG - Intronic
1027199402 7:76053702-76053724 GCAAACAAAGTGGCAGACACGGG - Intronic
1027778573 7:82496407-82496429 AATAACAAAGTGCCACAGACTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028323938 7:89498288-89498310 TGAAACAATGTGCCACAAACTGG - Intergenic
1029894023 7:103962476-103962498 CAGAAATAGGTGCCACACACAGG + Intronic
1029907566 7:104106918-104106940 CATAACAATGTGCCACAAACTGG + Intergenic
1030101042 7:105945591-105945613 GTGAACAAAGTGCCACAAACTGG - Intronic
1030174213 7:106633626-106633648 CATAACAAAGTACCACACACTGG - Intergenic
1030201478 7:106909842-106909864 CATAACAAAGTGCCACAAACTGG - Intergenic
1030345609 7:108429983-108430005 GGAAAGAAGGTTCCAGACACAGG + Intronic
1031511279 7:122653246-122653268 AAAAACAAGGGGCCACACAAGGG + Intronic
1035297820 7:157877009-157877031 GAAACCCTGGTGCCACACTCAGG - Intronic
1036589189 8:10152401-10152423 AAAAAGAAGCTGACACACACTGG - Intronic
1036656075 8:10678359-10678381 AAAATAAAGGTGCCACTCACTGG - Intronic
1036783795 8:11671785-11671807 GCAAATAAAGTGCCACTCACCGG + Intergenic
1040601757 8:48891659-48891681 GAAATCAAGCAGCCAGACACAGG + Intergenic
1041570940 8:59336307-59336329 TGGAACAATGTGCCACACACTGG + Intergenic
1043327535 8:79070806-79070828 TAAAACAAGGTGGCTAACACTGG - Intergenic
1046518660 8:115296369-115296391 GAAAACAAGGTGCTGAACAAGGG + Intergenic
1047313000 8:123708198-123708220 GAAAAGAAGGAGCCACACACTGG + Intronic
1048040170 8:130719806-130719828 TATAACAAAGTGCCATACACTGG - Intergenic
1048230387 8:132634741-132634763 TATAACAAAGTGCCACAAACTGG - Intronic
1049886552 9:30894-30916 CAAAACAAAATACCACACACTGG - Intergenic
1050635401 9:7607071-7607093 TAAACCAATGTGCCACACCCAGG - Intergenic
1051813203 9:21074249-21074271 GAAAAGAACATGCCACAGACTGG - Intergenic
1052084017 9:24241565-24241587 GAAAAAAAGGTTCCAGACATGGG + Intergenic
1052171192 9:25399269-25399291 GAAAACAAGCTGAGACACTCGGG - Intergenic
1052296002 9:26896419-26896441 CATAACAAAGTGCCACAAACTGG - Intergenic
1052648096 9:31264158-31264180 GAAAACAAGGTCCTAGATACAGG - Intergenic
1053596352 9:39565873-39565895 CATAACAAAGTGCCACACACTGG + Intergenic
1053854319 9:42322513-42322535 CATAACAAAGTGCCACACACTGG + Intergenic
1054569904 9:66799145-66799167 CATAACAAAGAGCCACACACTGG - Intergenic
1057315596 9:93966456-93966478 GAGAACAAGGGGCCACATTCTGG + Intergenic
1057838865 9:98469009-98469031 GCCAACAAGTTCCCACACACTGG + Intronic
1058219322 9:102277419-102277441 GAAAACATGGTGCCACACGATGG - Intergenic
1059627086 9:116079010-116079032 AAAAGCAAGATGCCTCACACAGG - Intergenic
1060115924 9:120940682-120940704 GGTAACAAAGTGCCACAAACTGG + Intergenic
1062488977 9:136795270-136795292 AAAAACAAGGCGCCACCGACTGG - Intronic
1062674570 9:137733032-137733054 GGGAACAAGCTACCACACACGGG - Intronic
1187294392 X:17984869-17984891 GATCACCATGTGCCACACACTGG + Intergenic
1187301754 X:18057731-18057753 TATAACAAAGTGCCACAGACTGG - Intergenic
1190614429 X:52216319-52216341 GAAAATATGGTGACACACAATGG + Intergenic
1191896203 X:65995959-65995981 AATAACAAAATGCCACACACTGG + Intergenic
1197137649 X:123081726-123081748 GTAAACAAGGTGCTAGAGACTGG + Intergenic
1198701695 X:139403835-139403857 GAAAACAAAGAGCTCCACACTGG + Intergenic
1199948783 X:152688827-152688849 CATAACAAGGTACCACAGACTGG - Intergenic
1199960893 X:152779622-152779644 CATAACAAGGTACCACAGACTGG + Intergenic
1201059980 Y:10036650-10036672 GCAAACAAGGTGGCAGGCACCGG + Intergenic
1201504278 Y:14680659-14680681 TAAAACAGCGTGCCCCACACTGG + Intronic
1201542841 Y:15127473-15127495 CACAACAAAATGCCACACACTGG + Intergenic