ID: 1111782501

View in Genome Browser
Species Human (GRCh38)
Location 13:92746087-92746109
Sequence CCCAATCTTACAGGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111782501_1111782508 12 Left 1111782501 13:92746087-92746109 CCAACAAAACCTGTAAGATTGGG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1111782508 13:92746122-92746144 GTCTAGTCATTCCCTCAAAATGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111782501 Original CRISPR CCCAATCTTACAGGTTTTGT TGG (reversed) Intronic
902396910 1:16137209-16137231 TCCAATCTTTCAGCTTCTGTGGG + Intronic
904766109 1:32848648-32848670 CCAATTCTGACAGGTTTTATAGG - Intronic
905601338 1:39254397-39254419 CCCATTCTTCCAGGCTGTGTTGG + Intronic
909493554 1:76252347-76252369 CCCAACCTTGAGGGTTTTGTGGG + Intronic
909979851 1:82085849-82085871 CCCCATCTCATAGGTTTTGTGGG - Intergenic
910094534 1:83505893-83505915 AACAAGCTTACAGGTTTAGTTGG - Intergenic
911210831 1:95136752-95136774 TCCAATCTACCAGGATTTGTTGG + Intronic
912981606 1:114379050-114379072 CCCAGACTTACAGATTATGTTGG - Intergenic
919516827 1:198535240-198535262 CCCTGTCTTGCATGTTTTGTAGG - Intronic
920671473 1:208006735-208006757 CACTATCTTGCAGTTTTTGTGGG - Intergenic
920685084 1:208103136-208103158 CCCAAACTTACATGTTGTGCAGG + Exonic
920983479 1:210861570-210861592 CCCATTCTGTCAGGTTCTGTTGG + Intronic
921866527 1:220092940-220092962 TCCTATCTCACAGGTTTTTTTGG + Intergenic
1065839110 10:29685816-29685838 ACTAATTTTTCAGGTTTTGTTGG + Intronic
1075938797 10:126370230-126370252 TACAATCTCACAGCTTTTGTGGG - Intronic
1078657833 11:13258942-13258964 CCCATTCTGACACTTTTTGTAGG - Intergenic
1083079734 11:60078171-60078193 CCCAATCTGATAGGATCTGTTGG - Intergenic
1093709332 12:22312020-22312042 CCCAACCTACCAGGCTTTGTGGG + Intronic
1098002794 12:65962677-65962699 CCCAAAATTACAGGGTGTGTGGG - Intronic
1102631859 12:114288042-114288064 ATCTATCTTACAGTTTTTGTGGG + Intergenic
1103762200 12:123258960-123258982 CCCACTCTTACTGGTTTCTTAGG - Intergenic
1110093951 13:71491783-71491805 CCCAATATTACAATCTTTGTAGG - Intronic
1110459763 13:75732738-75732760 CCCCATCTTTGTGGTTTTGTCGG + Intronic
1111782501 13:92746087-92746109 CCCAATCTTACAGGTTTTGTTGG - Intronic
1114591526 14:23869357-23869379 CCCTATCTTCCAGTTTCTGTGGG - Intergenic
1114911265 14:27200911-27200933 CCCAATCTCACAGATATTCTGGG + Intergenic
1120570543 14:86111226-86111248 CCCAATTTTCCAGGTGCTGTCGG + Intergenic
1124929280 15:34103330-34103352 CCAAATCGTACTCGTTTTGTCGG - Exonic
1126334855 15:47575939-47575961 CCCAGTCTTACTGGTTTGGCTGG + Intronic
1135171010 16:20183459-20183481 CCCTATCTTACAGTTTGTGATGG - Intergenic
1135848292 16:25939224-25939246 CCAGATCTTACAGGTTTTTAAGG + Intronic
1137884314 16:52086203-52086225 CATTATCTCACAGGTTTTGTGGG + Intergenic
1137889135 16:52140073-52140095 CCCAAGTTTACAGGTCTTTTTGG - Intergenic
1138120049 16:54393347-54393369 GCAAATATTTCAGGTTTTGTGGG - Intergenic
1141279116 16:82614689-82614711 CCCAACCTTTCAGATATTGTGGG + Intergenic
1146132345 17:30289379-30289401 GCCAATCTTACCTGTTTTTTTGG - Exonic
1149224155 17:54449204-54449226 CACAATATTACACGTTTTGATGG - Intergenic
1153669337 18:7395226-7395248 CCCAATCTTACATATTTTTTAGG - Intergenic
1156096936 18:33544878-33544900 CCCAGTCTTATACGTTTTGGTGG + Intergenic
1156733282 18:40222361-40222383 CCCAATGTCACAGATTTAGTGGG - Intergenic
1158240082 18:55367782-55367804 CACATTTTTACAGCTTTTGTGGG - Intronic
1161415549 19:4144860-4144882 CCCAAACTCACAGGATTTGGAGG + Intergenic
1166224359 19:41385954-41385976 CCCCATCTCACAGGGTTGGTGGG + Intronic
1166732693 19:45067846-45067868 CCCTGTCTTACAGGTTCTGTGGG + Intronic
1168624450 19:57906077-57906099 CCCAATTATAAAGGTTTTGTGGG + Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
928100185 2:28432267-28432289 CCCAAGCTGAGCGGTTTTGTAGG - Intergenic
929221676 2:39471060-39471082 CTCAGTCTTACTGGTTTTGGGGG - Intergenic
930389171 2:50738650-50738672 CCCAAATTTAAAGGTTTTATCGG - Intronic
932969250 2:76518974-76518996 TTCAAACTTACAGATTTTGTTGG + Intergenic
937411470 2:121680488-121680510 CCCCATCTTAAGAGTTTTGTGGG + Intergenic
937844031 2:126557660-126557682 CCCAATCTGACAGGATGTGTTGG + Intergenic
943010285 2:182439700-182439722 CCCAACCTTAAAGGTTTTCTTGG - Intronic
943610382 2:190026281-190026303 ACAAATCTTTTAGGTTTTGTAGG - Intronic
945529348 2:210931219-210931241 CCAAATTTTACAGTTCTTGTGGG - Intergenic
947294515 2:228616007-228616029 CACAATCTTACAGGTTAGGCTGG + Intergenic
1174301902 20:49588553-49588575 ACCAATCTTGGAGGTTTTTTAGG + Intergenic
1175956981 20:62616346-62616368 CCCCATCTTTCAGGGTCTGTGGG + Intergenic
1177620561 21:23586359-23586381 CTCAATTTTACAGGTTATGGAGG - Intergenic
1178984600 21:37291932-37291954 CCCAAGCTTAGAGTTTTTATTGG + Intergenic
1179055494 21:37928221-37928243 CCCATTTTTAATGGTTTTGTGGG + Intergenic
949124007 3:423608-423630 CCAAATCTTGCAGGGTTTTTAGG - Intergenic
951305358 3:21053801-21053823 CCCCATCTTAGACATTTTGTTGG - Intergenic
953470212 3:43159758-43159780 CCCACTGTGACTGGTTTTGTCGG + Intergenic
955056904 3:55462925-55462947 CCCTCTCTGGCAGGTTTTGTGGG - Intergenic
958106633 3:89082301-89082323 CTCAATCTTACAGGTGATGCTGG + Intergenic
958638098 3:96771115-96771137 CCACATCTTTCAGGTTTTGTAGG - Intergenic
959342942 3:105154200-105154222 CCCAAACTTATAGGATTTTTAGG - Intergenic
961187248 3:124926467-124926489 CCCAATCTTTCATGTTTGGAGGG - Intronic
963758675 3:149262530-149262552 CTGAATCTTAAAGGATTTGTTGG - Intergenic
965089043 3:164139641-164139663 CCCAGTCTTAAAGGGTCTGTGGG - Intergenic
967536571 3:190611041-190611063 CCCAATGTTACATGTCTTCTAGG - Intronic
967769482 3:193319020-193319042 CCCCATCTTTAAGGTTTTGTGGG + Exonic
970164125 4:13218275-13218297 CCCAATCCTTAAGGTTTTGATGG - Intergenic
976046780 4:80958110-80958132 CCCAAAGTTACAGGTTTTACAGG - Intronic
978094628 4:104761163-104761185 CCCAACCTTCCAGGTTGTGTTGG - Intergenic
980792445 4:137636982-137637004 CCCAAGCTTACAAGGTTAGTTGG + Intergenic
980880140 4:138701495-138701517 CACAGTCTTTCAGATTTTGTAGG - Intergenic
981792494 4:148554427-148554449 CCCATTCTAACAGATATTGTAGG + Intergenic
982789094 4:159569989-159570011 CCCAATTTCAGAGATTTTGTTGG + Intergenic
983432794 4:167672674-167672696 CCCAATCTTGCAGGATTTTAAGG + Intergenic
990125540 5:52512578-52512600 TCCAATATTCCAGGTTTTGGAGG + Intergenic
990152310 5:52832889-52832911 CCCAATCTCAAAGCTTTTGATGG - Intronic
994040364 5:95252323-95252345 CCCTATCTTCCAGTTTTTGTGGG - Intronic
997564270 5:134874951-134874973 ACCGATCTGACAGGGTTTGTGGG - Intronic
998137973 5:139684440-139684462 CCCACTCTCAGAGGGTTTGTTGG + Intergenic
999498905 5:152127051-152127073 GACAAGCTTACAGGATTTGTGGG - Intergenic
999879138 5:155841713-155841735 CCCCATTTTATAGGTTTTGTAGG + Intergenic
1000384105 5:160657486-160657508 CCCAATCTGCCTGCTTTTGTGGG - Intronic
1001070197 5:168579245-168579267 CCCCGTCTTACAGGGTTTCTTGG + Exonic
1002128137 5:177062073-177062095 CACTATCTTACATGTTTTGCAGG - Exonic
1003405041 6:5821132-5821154 CCCCATTTCACAGGATTTGTTGG + Intergenic
1007552346 6:42739760-42739782 CCCAGTCTTACAGCTGTTATTGG + Intergenic
1008187335 6:48410336-48410358 ACCAACCCTACAGGATTTGTGGG - Intergenic
1013537220 6:111074399-111074421 CCCAATCTTACATTTTTTTATGG + Intergenic
1016758094 6:147708884-147708906 CCCAGTCTGTCTGGTTTTGTTGG + Intronic
1018235475 6:161719399-161719421 ACCAACATTACAGGCTTTGTGGG + Intronic
1022726171 7:32983707-32983729 CCCAATGTTACTGAATTTGTAGG - Intronic
1023170230 7:37384113-37384135 CCGAAACATACAGGTTTTGATGG + Intronic
1024252219 7:47514803-47514825 CCAAAAGTTACAAGTTTTGTGGG - Intronic
1025870297 7:65425070-65425092 CCCAATCTTTCATGGCTTGTAGG - Intergenic
1027392719 7:77721559-77721581 CGTAATCTTACAGGATGTGTAGG + Intronic
1028540101 7:91933786-91933808 CACAATGTTACAGTTTTTATCGG - Intergenic
1029114232 7:98229157-98229179 CCCATCCTTCCAGGTTTTGGCGG - Exonic
1031554243 7:123152003-123152025 CAAAATCTTTCAGATTTTGTAGG - Intronic
1035278154 7:157760227-157760249 CCAAATCTTACAGCTGATGTGGG + Intronic
1037385717 8:18338372-18338394 CCCAATCTTTCAGTTTTTCCTGG + Intergenic
1039642215 8:39236585-39236607 CACAGTGGTACAGGTTTTGTGGG - Intronic
1048350273 8:133610270-133610292 GCCAATATTTTAGGTTTTGTAGG - Intergenic
1050512421 9:6410143-6410165 CACAATCCTACAAGTTTTATAGG + Intergenic
1055196203 9:73597289-73597311 CCCAAACTGACAGATTTTCTAGG - Intergenic
1055286534 9:74734558-74734580 CCTAATCTTACAGGGTTACTGGG + Intronic
1056087850 9:83170799-83170821 CCAATTCTAACAGGTTTTTTTGG + Intergenic
1190847694 X:54209490-54209512 CACAATTATACATGTTTTGTTGG - Intronic
1192323046 X:70107659-70107681 TCCACTCTTCCAGGTTCTGTAGG + Intergenic
1198455905 X:136817468-136817490 CCCCATCTCCCAGTTTTTGTGGG - Intergenic
1199239917 X:145534562-145534584 CCAAATCATACAGCATTTGTGGG + Intergenic
1199458939 X:148061194-148061216 TCAATTCTTACAGTTTTTGTTGG + Intergenic
1200830776 Y:7687335-7687357 CCCAATCTTAAGGGGTTGGTAGG + Intergenic
1200892719 Y:8340798-8340820 CACAATCTTACATGTTTTTTGGG - Intergenic
1201011365 Y:9550293-9550315 CCCAATCTTATGGGGTTGGTAGG - Intergenic
1202116146 Y:21470318-21470340 CCCAATCTTAAGGGGTTGGTAGG - Intergenic