ID: 1111795198

View in Genome Browser
Species Human (GRCh38)
Location 13:92910540-92910562
Sequence CCTTGGTTCTTACCTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111795198_1111795206 11 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795206 13:92910574-92910596 GTGGCTGAGATGATTCCTGTGGG No data
1111795198_1111795202 -8 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795202 13:92910555-92910577 AACCAAGGTGGCCAAACGAGTGG No data
1111795198_1111795205 10 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data
1111795198_1111795208 25 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795208 13:92910588-92910610 TCCTGTGGGTCAAGTCTGGCAGG No data
1111795198_1111795207 21 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111795198 Original CRISPR CCTTGGTTCTTACCTGGACC TGG (reversed) Intergenic
No off target data available for this crispr