ID: 1111795202

View in Genome Browser
Species Human (GRCh38)
Location 13:92910555-92910577
Sequence AACCAAGGTGGCCAAACGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111795197_1111795202 -7 Left 1111795197 13:92910539-92910561 CCCAGGTCCAGGTAAGAACCAAG No data
Right 1111795202 13:92910555-92910577 AACCAAGGTGGCCAAACGAGTGG No data
1111795198_1111795202 -8 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795202 13:92910555-92910577 AACCAAGGTGGCCAAACGAGTGG No data
1111795196_1111795202 -2 Left 1111795196 13:92910534-92910556 CCAAGCCCAGGTCCAGGTAAGAA No data
Right 1111795202 13:92910555-92910577 AACCAAGGTGGCCAAACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111795202 Original CRISPR AACCAAGGTGGCCAAACGAG TGG Intergenic
No off target data available for this crispr