ID: 1111795205

View in Genome Browser
Species Human (GRCh38)
Location 13:92910573-92910595
Sequence AGTGGCTGAGATGATTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111795197_1111795205 11 Left 1111795197 13:92910539-92910561 CCCAGGTCCAGGTAAGAACCAAG No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data
1111795198_1111795205 10 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data
1111795196_1111795205 16 Left 1111795196 13:92910534-92910556 CCAAGCCCAGGTCCAGGTAAGAA No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data
1111795203_1111795205 -7 Left 1111795203 13:92910557-92910579 CCAAGGTGGCCAAACGAGTGGCT No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data
1111795201_1111795205 4 Left 1111795201 13:92910546-92910568 CCAGGTAAGAACCAAGGTGGCCA No data
Right 1111795205 13:92910573-92910595 AGTGGCTGAGATGATTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111795205 Original CRISPR AGTGGCTGAGATGATTCCTG TGG Intergenic
No off target data available for this crispr