ID: 1111795207

View in Genome Browser
Species Human (GRCh38)
Location 13:92910584-92910606
Sequence TGATTCCTGTGGGTCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111795204_1111795207 -5 Left 1111795204 13:92910566-92910588 CCAAACGAGTGGCTGAGATGATT No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data
1111795203_1111795207 4 Left 1111795203 13:92910557-92910579 CCAAGGTGGCCAAACGAGTGGCT No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data
1111795197_1111795207 22 Left 1111795197 13:92910539-92910561 CCCAGGTCCAGGTAAGAACCAAG No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data
1111795201_1111795207 15 Left 1111795201 13:92910546-92910568 CCAGGTAAGAACCAAGGTGGCCA No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data
1111795196_1111795207 27 Left 1111795196 13:92910534-92910556 CCAAGCCCAGGTCCAGGTAAGAA No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data
1111795198_1111795207 21 Left 1111795198 13:92910540-92910562 CCAGGTCCAGGTAAGAACCAAGG No data
Right 1111795207 13:92910584-92910606 TGATTCCTGTGGGTCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111795207 Original CRISPR TGATTCCTGTGGGTCAAGTC TGG Intergenic
No off target data available for this crispr