ID: 1111796400

View in Genome Browser
Species Human (GRCh38)
Location 13:92926107-92926129
Sequence TTGTGCAAATGAGAGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111796396_1111796400 22 Left 1111796396 13:92926062-92926084 CCCCAAACAGAAGCATAAATGAC No data
Right 1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG No data
1111796398_1111796400 20 Left 1111796398 13:92926064-92926086 CCAAACAGAAGCATAAATGACAT No data
Right 1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG No data
1111796397_1111796400 21 Left 1111796397 13:92926063-92926085 CCCAAACAGAAGCATAAATGACA No data
Right 1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG No data
1111796395_1111796400 30 Left 1111796395 13:92926054-92926076 CCAGTGAACCCCAAACAGAAGCA No data
Right 1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111796400 Original CRISPR TTGTGCAAATGAGAGATAAA GGG Intergenic
No off target data available for this crispr