ID: 1111798872

View in Genome Browser
Species Human (GRCh38)
Location 13:92958266-92958288
Sequence CAATTTGACTGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111798872_1111798879 4 Left 1111798872 13:92958266-92958288 CCTTATGCCCCTCAGTCAAATTG No data
Right 1111798879 13:92958293-92958315 TTCTGAGGAGGGAAGAATTGAGG No data
1111798872_1111798878 -7 Left 1111798872 13:92958266-92958288 CCTTATGCCCCTCAGTCAAATTG No data
Right 1111798878 13:92958282-92958304 CAAATTGTTTCTTCTGAGGAGGG No data
1111798872_1111798877 -8 Left 1111798872 13:92958266-92958288 CCTTATGCCCCTCAGTCAAATTG No data
Right 1111798877 13:92958281-92958303 TCAAATTGTTTCTTCTGAGGAGG 0: 7
1: 188
2: 290
3: 413
4: 522
1111798872_1111798880 27 Left 1111798872 13:92958266-92958288 CCTTATGCCCCTCAGTCAAATTG No data
Right 1111798880 13:92958316-92958338 TTGCTGCAGACCTGAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111798872 Original CRISPR CAATTTGACTGAGGGGCATA AGG (reversed) Intergenic
No off target data available for this crispr