ID: 1111808243

View in Genome Browser
Species Human (GRCh38)
Location 13:93065174-93065196
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111808243_1111808244 4 Left 1111808243 13:93065174-93065196 CCAGATAGCTACGAGCTAGTGAG No data
Right 1111808244 13:93065201-93065223 ATGAAGTCTACATGCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111808243 Original CRISPR CTCACTAGCTCGTAGCTATC TGG (reversed) Intergenic
No off target data available for this crispr