ID: 1111808253

View in Genome Browser
Species Human (GRCh38)
Location 13:93065374-93065396
Sequence ATGCCATGTGCTTCCCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111808253_1111808258 15 Left 1111808253 13:93065374-93065396 CCCCAGCGGGAAGCACATGGCAT No data
Right 1111808258 13:93065412-93065434 GAGAGGAGAGCATAATAAAAAGG No data
1111808253_1111808256 -2 Left 1111808253 13:93065374-93065396 CCCCAGCGGGAAGCACATGGCAT No data
Right 1111808256 13:93065395-93065417 ATACCTAAACAGAGTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111808253 Original CRISPR ATGCCATGTGCTTCCCGCTG GGG (reversed) Intergenic